Compounds and Methods for Treating Cancer

CLAIM OF PRIORITY

This application claims priority to U.S. Provisional Patent Application Serial No. 62/895,775, filed on September 4, 2019, the entire contents of which are hereby incorporated by reference.

STATEMENT OF FEDERALLY SPONSORED RESEARCH

This invention was made with government support under Grant numbers R01 DK043889 and CA120458 awarded by the National Institutes of Health. The government has certain rights in the invention.

TECHNICAL FIELD

This disclosure relates to compounds useful in treating cancer, in particular to chromen-2-one derivatives useful in treating cancer identified as having a homologous recombination (HR) deficiency.

BACKGROUND

Large-scale genomic studies have shown that half of epithelial ovarian cancers (EOCs) have alterations in genes regulating homologous recombination (HR) repair. Loss of HR accounts for the genomic instability of EOCs and for their cellular hyper dependence on alternative poly-ADP ribose polymerase (PARP)-mediated DNA repair mechanisms. PARP inhibitors (PARPi) can be used to treat some HR-deficient cancers. However, certain cancers are resistant to treatment with PARP inhibitors. Accordingly, there is a general need to develop novel methods of regulating DNA repair mechanisms for the treatment of HR-deficient cancer.

SUMMARY

Cancer cells are often defective in one of the six major DNA repair pathways. As an example, approximately half of the epithelial ovarian cancers (EOCs) have alterations in genes regulating homologous recombination (HR), which accounts for their genomic instability and poly(ADP-ribose) polymerase inhibitor (PARPi) sensitivity. Several other solid tumor types, including breast, prostate, and pancreatic cancers, also often have HR deficiency. POLQ, a translesion DNA polymerase that is involved in alternative end joining (Alt-EJ), regulates genomic stability in HR- deficient cancers. For example, loss of POLQ-mediated DNA repair in HR-deficient ovarian cancer cells creates a synthetic lethality (Ceccaldi et al., 2015).

In a first general aspect, the present disclosure provides a method of treating a homologous recombination (HR)-deficient cancer or a POLQ-overexpressing cancer, the method comprising: (i) identifying a subject having an HR-deficient cancer or a POLQ-overexpressing cancer, or both; and (ii) after (i), administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof. In some embodiments, the gene regulating homologous recombination is BRCAl/2. In some embodiments, the cancer is selected from prostate cancer, colon cancer, lung cancer, liver cancer, sarcoma, melanoma, breast cancer, ovarian cancer, and pancreatic cancer. In some embodiments, the cancer has an acquired resistance to a PARP inhibitor. In some embodiments, the cancer has a de novo resistance to a PARP inhibitor.

In some embodiments, the method further comprises administering to the subject a therapeutically effective amount of an additional anti-cancer agent. In some embodiments, the additional anti-cancer agent is a platinum-based anti-cancer agent. In some embodiments, the platinum-based anti-cancer agent is selected from carboplatin and cisplatin. In some embodiments, the additional anti-cancer agent is a PARP inhibitor. In some embodiments, the PARP inhibitor is selected from olaparib, veliparib, rucaparib, BGB-290 (pamiparib), talazoparib (BMN 673), and niraparib.

In a second general aspect, the present disclosure provides a method of killing a POLQ-overexpressing cancer cell, the method comprising (i) determining that a cancer cell is overexpressing POLQ, wherein POLQ overexpression is a predictive biomarker that the cancer cell is susceptible to killing by a POLQ inhibitor; and (ii) after (i), contacting the POLQ-overexpressing cancer cell with an effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof. In some embodiments, contacting the cancer cell with the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is carried out in vitro, in vivo, or ex vivo.

In a third general aspect, the present disclosure provides a method of treating a cancer having a de novo or an acquired resistance to a PARP inhibitor, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof. In some embodiments, the method further comprises administering to the subject a therapeutically effective amount of an additional anti-cancer agent. In some embodiments, the additional anti-cancer agent is a PARP inhibitor. In some embodiments, the PARP inhibitor is selected from olaparib, veliparib, pamiparib (BGB-290), talazoparib (BMN 673), and niraparib.

In a fourth general aspect, the present disclosure provides a method of inhibiting DNA polymerase q (Roΐq) in a cancer cell, the method comprising contacting the cancer cell with an effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

In a fifth general aspect, the present disclosure provides a method of inhibiting heat shock protein 90 (Hsp90) in a cancer cell, the method comprising contacting the cancer cell with an effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, selectively inhibits a C- terminal binding domain of the Hsp90.

In some embodiments, the cancer cell is contacted in vitro. In some embodiments, the cancer cell is contacted in vivo. In some embodiments, the cancer cell is contacted ex vivo.

In a sixth general aspect, the present disclosure provides a pharmaceutical composition comprising a compound of Formula (I), or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.

In some embodiments, the compound of Formula (I) has formula: or a pharmaceutically acceptable salt thereof.

In some embodiments of the compound of Formula (I):

R ¹ is Ce-12 aryl, optionally substituted with 1, 2, 3, 4, or 5 substituents independently selected from R ^g ;

R ^g is selected from the group consisting of: OH, NO2, CN, halo, Ci-6 alkyl, C2- 6 alkenyl, C2-6 alkynyl, C1-4 haloalkyl, Ci-6 alkoxy, Ci-6haloalkoxy, cyano-Ci-3 alkyl, HO-CI-3 alkyl, amino, Ci-6 alkylamino, di(Ci-6 alkyl)amino, Ce-n aryl-Ci-3 alkyl, and Ce-12 aryloxy;

R ² , R ³ , R ⁴ , and R ⁵ are independently selected from the group consisting of: H, Ci-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C1-4 haloalkyl, Ci-6 alkoxy, and Ci-6haloalkoxy;

R ⁶ is Ci-6 alkyl, optionally substituted with 1, 2, or 3 substituents indepndently selected from the group consisting of: OR ^al , NR ^al R ^a2 . C(=0)NR ^al R ^a2 , C(0)OR ^al , NR ^al C(=0)NR ^al R ^a2 , and NR ^al C(0)OR ^al ;

R ^al and R ^a2 are independently selected from the group consisting of: H, C1-3 alkyl, and C1-3 haloalkyl; and

R ⁷ and R ⁸ are independently selected from the group consisting of: H and C1-3 alkyl.

In some embodiments, R ¹ is phenyl, optionally substituted with 1, 2, or 3 independently selected R ^g .

In some embodiments, R ^g is selected from the group consisting of: CN, halo, Ci-6 alkyl, C1-4 haloalkyl, Ci-6 alkoxy, di(Ci-6alkyl)amino, C6-12 aryl-Ci-3 alkylene, and C6-12 aryloxy.

In some embodiments, R ² , R ³ , R ⁴ , and R ⁵ are independently selected from the group consisting of: H and Ci-6 alkyl.

In some embodiments:

R ² , R ³ , and R ⁴ are each H; and

R ⁵ is Ci-6 alkyl.

In some embodiments, R ⁶ is Ci-6 alkyl.

In some embodiments, R ⁷ and R ⁸ are both H.

In some embodiments, the compound of Formula (I) has Formula (la): or a pharmaceutically acceptable salt thereof.

In some embodiments of Formula (la):

R ¹ is phenyl, optionally substituted with 1, 2, or 3 independently selected R ^g ; R ^g is selected from the group consisting of: CN, halo, Ci-6 alkyl, Ci-4 haloalkyl, Ci-6 alkoxy, di(Ci-6 alkyl)amino, Ce-u aryl-Ci-3 alkylene, and Ce-u aryloxy; R ⁵ is Ci-6 alkyl; and R ⁶ is Ci-6 alkyl.

In some embodiments, the compound of Formula (I) is selected from any one of the compounds described herein.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. Methods and materials are described herein for use in the present application; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

Other features and advantages of the present application will be apparent from the following detailed description and figures, and from the claims.

DESCRIPTION OF DRAWINGS

FIG. 1 A contains a bar graph showing ATPase activity of novobiocin and compounds 1, 7, 8, and 9. ADP-Glo assay for quantification of POLQ ATPase activity in presence of indicated compounds was performed. Mean and SEM of (n = 4) were shown. Statistical significance was determined by uncorrected Fisher’s LSD test.

FIG. IB contains a bar graph showing IC50 ratio for killing wild-type (WT) over BRCA1-KO cancer cells by olaparib, novobiocin, and compounds 1, 7, 8, and 9.

FIG. 1C contains a bar graph showing ATPase activity of novobiocin and compounds 2-19.

FIG. 2 contains a line plot showing that compound 1 efficiently kills B40 cells.

FIG. 3 contains a bar graph showing that compounds 1, 8, and 9 effectively kill B RC A 1 cells. Clonogenic formation in BRCA 1 and WT RPEl cells in presence of indicated compounds (200 nM) or novobiocin (100 mM) were shown. Results from one experiment were shown.

FIG. 4 contains a bar graph showing that compounds 1, 8, and 9 more effectively killed BRCA1 -mutated cancer cell lines (MDA-MB-436 and UWB1) than their WT counterparts (MDA-MB-436 + BRCA1 and UWB1 + BRCA1). Clonogenic formation in parental MDA-MB-436 (BRCA1 -mutated) and complemented MDA- MB-436 + BRCA1 cDNA cells in presence of indicated test compounds (200 nM) or novobiocin (100 mM) were shown. Results from one experiment were shown.

FIG. 5A contains an image showing the results of the clonogenic survival assays performed with novobiocin, olaparib, and compound 1. Compound 1 selectively killed BRCA1 null cells (RPE-P53 / BRCAl ).

FIG. 5B contains a bar graph showing the results of the survival assays performed with novobiocin, olaparib, compounds 1, 8, and 9. All tested compounds selectively killed BRCA1 null cells (RPE-P53 / BRCAl ).

FIG. 6 contains bar graph showing that compound 1 kills UWB1 (BRCA1 mutated) more efficiently than BRCA1 -complemented UWB1 cells.

FIG. 7 contains images showing that compound 1 killed MB436+EV more readily than MB436+BRCA1 (selective cell killing in the MB436 isogenic pair).

FIG. 8 contains bar graph showing that compounds 1, 8, and 9 killed MB436+EV more readily than MB436+BRCA1 (selective cell killing in the MB436 isogenic pair).

FIG. 9 contains images showing that compound 9 killed MB436+EV more readily than MB436+BRCA1 (selective cell killing in the MB436 isogenic pair).

FIG. 10 contains an image of western blot of MCF7 lysate for compound 1, and anti-proliferative ECso against MCF7 and SKBR3. FIG. 11 contains an image of western blot of MCF7 lysate for compound 6, and anti-proliferative EC50 against MCF7 and SKBR3.

FIG. 12 contains an image of western blot of MCF7 lysate for compound 9, and anti-proliferative EC50 against MCF7 and SKBR3.

FIG. 13 contains an image of western blot of MCF7 lysate for compound 13, and anti-proliferative EC50 against MCF7 and SKBR3.

FIG. 14 contains an image of western blot of MCF7 lysate for compound 16, and anti-proliferative EC50 against MCF7 and SKBR3.

FIG. 15 contains a bar graph showing ATPase activity for novobiocin and compound 1 compared to DMSO and no enzyme control. FIG. 16 contains a bar graph showing fraction of clonogenic survival of RPE cells treated with olaparib, novobiocin, and compound 1.

FIG. 17 contains a line plot showing surviving fraction of RPE 1 WT and RPE1 BRCA1 cells when treated with compound 1. FIG. 18 contains a bar graph showing fraction of clonogenic survival of MDA-MB-436 cells treated with olaparib, novobiocin, and compound 1.

FIG. 19 contains a table showing IC50 values for olaparib, novobiocin, and compound 1 in BRCAl (RPE) cells.

FIG. 20A provides results of CTG Glo assay (7 days) for compound 25.

FIG. 20B provides results of CTG Glo assay (7 days) for compound 26.

FIG. 20C provides results of CTG Glo assay (7 days) for compound 27.

FIG. 21 contains a table showing IC50 values for compounds 11-14 on BRCAl and WT RPE cells.

FIG. 22 contains a line plot showing that the BRCA1 RPE cells used in experiments are hypersensitive to olaparib.

FIG. 23 contains a line plot showing that the BRCA1 RPE cells used in experiments are sensitive to novobiocin.

DETAILED DESCRIPTION

In one general aspect, the present disclosure provides a method of treating cancer, the method comprising administering to a subject (e.g., in need thereof) a therapeutically effective amount of a compound of Formula (I) as described herein, or a pharmaceutically acceptable salt thereof. In some embodiments, the cancer is homologous recombination (HR)-deficient.

The HR-deficiency in a cancer can be characterized by a lack of a functional homologous recombination (HR) DNA repair pathway, and can be correlated with mutation or alteration of one or more HR-associated genes, such as BRCA1, BRCA2, RAD50, RAD54, RAD51B, RED51C, RAD51D, CtlP (Choline Transporter-Like Protein), PALB2 (Partner and Localizer of BRCA2), XRCC2 (X-ray repair complementing defective repair in Chinese hamster cells 2), RECQL4 (RecQ Protein- Like 4), BLM (Bloom syndrome, RecQ helicase-like), WRN (Wemer syndrome, RecQ helicase-like), Nbsl (Nibrin), and genes encoding Fanconi anemia (FA) proteins or FA-like genes. Examples of FA and FA-like genes include FANCA/C/D2/E//F//GL, FANCA, FANCB, FANCC, FANCD1 (BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (BRIP1), FANCL, FANCM, FANCN (PALB2), FANCP (SLX4), FANCS (BRCA1), RAD51C, and XPF. Other suitable examples of HR-associated genes include RECA, ARID1A, ATM, CHEKl/2, FAM175A, HDAC2, ERCC3, MRE11A, CDK12, CDKN1A/B/C, BAP1, MLL2, CDKN2A, NPM1, TP53, ATRX, BARD1, BRCAl/2, BRIP1, MRE11A, NBN,

PTEN, and ATR. In some embodiments, a cancer known to have a mutation in at least one HR-associated gene is an HR-deficient cancer. In some embodiments, the mutation is a pathogenic somatic mutation. In other embodiments, the mutation is germline mutation. In some embodiments, an HR-deficient cancer has at least one mutated HR gene selected from PTEN, BRCA1, BRCA2, and ATM. In some embodiments, the HR-deficient cancer has a pathogenic mutation (not a benign variant) in an HR gene, including a pathogenic mutation in, e.g., the BRCA1,

BRCA2, PALB2, BRIP genes, the other Fanconi Anemia genes, and any one the HR- associated genes described herein. In some embodiments, the pathogenicity of the mutation can be determined by any suitable art-recognized method.

In some embodiments, the cancer is characterized by one or more BRCA mutations. In some aspects of these embodiments, the cancer is characterized by BRCA1 mutation, BRCA2 mutation, or a mutation in both BRCA1 and BRCA2 genes.

Located on chromosome 17, BRCA1 is the first gene identified conferring increased risk for breast and ovarian cancer (Miki et al, Science, 266:66-71 (1994)). The BRCA1 gene (Gene ID: 672) is divided into 24 separate exons. Exons 1 and 4 are noncoding, in that they are not part of the final functional BRCA1 protein product.

The BRCA1 coding region spans roughly 5600 base pairs (bp). Each exon consists of 200-400 bp, except for exon 11, which contains about 3600 bp.

Wooster et al. (Nature 378: 789-792, 1995) identified the BRCA2 gene by positional cloning of a region on chromosome 13ql2-ql3 implicated in Icelandic families with breast cancer. Human BRCA2 (Gene ID: 675) gene contains 27 exons. Similar to BRCA1, BRCA2 gene also has a large exon 11, translational start sites in exon 2, and coding sequences that are AT-rich.

Mutations of BRCA genes associated with cancer (i.e., predisposing the subject to developing cancer) are described, for example, in Friend, S. et al, 1995, Nature Genetics 11: 238, US 2003/0235819, US 6083698, US 7250497, US 5747282, WO 1999028506, US 5837492, WO 2014160876; all of which are incorporated herein by reference. POLO uyregulation in cancer

Without being bound by any particular theory, it is believed that an inverse correlation exists between homologous recombination (HR) deficiency and levels of DNA polymerase q (Roΐq) expression in cancer cells. DNA polymerase q (Roΐq, also referred to as POLQ; Gene ID No. 10721) is a family A DNA polymerase that also functions as a DNA-dependent ATPase (see, e.g., Seki et al. Nucl. Acids Res. (2003) 31 (21): 6117-6126). Since HR-deficient cancers lack afunctional DNArepair pathway, an increase in the expression POLQ in HR-deficient cancer is believed to be compensatory, i.e., increased levels of POLQ regulate genomic stability and survival in these cancers. It is believed that HR-deficient tumors with repair deficiency, which often exhibit replication stress and collapsed replication forks, are hyper-dependent on alternative repair pathways and upregulate POLQ expression as a survival mechanism (See, e.g., Ceccaldi et al, 2015).

For example, POLQ is implicated in a pathway required for the repair of double-stranded DNA breaks, referred to as the error-prone microhomology-mediated end-joining (MMEJ) pathway. POLQ is also a translesion polymerase that is involved in alternative end joining (Alt-EJ) of double-stranded breaks (DSB) (Ceccaldi et al, 2015, Nature 518, 258-262; Mateos-Gomez et al, 2015, Nature 518, 254-257). Knockdown of POLQ was found to enhance cell death in HR-deficient cancers. For example, POLQ deletion in a HR-deficient background, such as Atm-/- or Fancd2-/-, results in marked developmental disadvantage or synthetic embryonic lethality in mice (Ceccaldi et al, 2015, Nature 518, 258-262; Shima et al, 2004, Molecular and cellular biology 24, 10381-10389). In another example, knockdown of POLQ in HR- proficient cells up-regulates HR activity and RAD51 nucleofilament assembly, while knockdown of POLQ in HR-deficient EOCs enhances cell death (See, e.g., Ceccaldi et al, Nature (2015) 518, 7538, 258-262).

In some embodiments, the cancer (e.g., HR-deficient cancer as described herein) has upregulated expression (e.g., overexpression) of POLQ. In some embodiments, POLQ overexpression in the cancer can be at least 2-fold, at least 3- fold, at least 4-fold, at least 5-fold, at least 10-fold, at least 20-fold, at least 50-fold, at least 100-fold, at least 500-fold, or at least 1000-fold greater, relative to POLQ expression in a control tissue (e.g., a non-cancer cells of the same type). POLQ overexpression is a predictive biomarker that the cancer cell is susceptible to killing by a POLQ inhibitor. In some embodiments, the present disclosure provides a method of killing a POLQ-overexpressing cancer cell, the method comprising (i) determining that a cancer cell is overexpressing POLQ, wherein POLQ overexpression is a predictive biomarker that the cancer cell is susceptible to killing by a POLQ inhibitor; and (ii) after (i), contacting the POLQ-overexpressing cancer cell with an effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is an inhibitor of POLQ. That is, the compound of Formula (I) reduces, slows, halts, and/or prevents POLQ activity in a cancer cell (e.g., HR- deficient cancer cell).

POLQ protein is structurally distinct from other polymerases with its three domains. POLQ is a large protein containing an N-term helicase-like ATPase domain, a central linker domain, and a C-term polymerase domain. The N-terminus of POLQ contains a helicase-like ATPase domain. The central domain binds RAD51, displaces RPA proteins from DSBs and antagonizes HR repair in an ATP -hydrolysis dependent manner (Ceccaldi et al, 2015; Mateos-Gomez et al, 2015; Mateos-Gomez et al, 2017). The POLQ C-terminal domain is an error-prone polymerase, which presumably fills in nucleotides during TLS and alt-EJ DNA repair. It has been shown that both the ATPase domain and the polymerase domain are required for POLQ- mediated Alt-EJ (Beagan et al, 2017, PLoS Genet 13, el006813).

In some embodiments, the compound of Formula (I) inhibits polymerase function, ATPase function, or both polymerase function and ATPase function of POLQ. In some embodiments, the compound of Formula (I) disrupts POLQ-DNA interaction or antagonizes ATP. In some embodiments, the compound of formula (I) selectively inhibits (e.g., reduces, slows, halts, and/or prevents) the ATPase activity of POLQ. In some aspects of these embodiments, the compound of Formula (I) selectively inhibits ATPase activity of POLQ and does not inhibit the polymerase activity of POLQ or disrupt POLQ-DNA interactions. In some embodiments, the compound of Formula (I) selectively inhibits ATPase activity of POLQ and does not inhibit other ATPase enzymes in the cancer cell. In some embodiments, the compound of Formula (I) targets and selectively inhibits ATPase domain of POLQ and therefore promotes lethality of cancers, such as HR-deficient cancers, while having little or no effect on healthy cells. In some embodiments, the present disclosure provides a method of inhibiting DNA polymerase q (Roΐq) in a cancer cell, the method comprising contacting the cancer cell with an effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof. In some embodiments, the cancer cell is HR- deficient as described herein. In some embodiments, the cancer cell is contacted in vitro, in vivo, or ex vivo. In some embodiments, POLQ is inhibited in a cancer cell of a patient after the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is administered to the patient in need thereof.

In some embodiments, the present disclosure provides a method of treating cancer characterized by overexpression of DNA polymerase q (Roΐq), the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof. In some aspects of these embodiments, the cancer contains a mutation in at least one gene regulating homologous recombination (HR) (e.g., BRCA 1/2 gene), as described herein. Accordingly, aspects of the disclosure provide a method for treating cancer that is characterized by one or more HR-associated mutations and/or overexpressed POLQ.

Determining or Identifying step

In some embodiments, a method of treating cancer described herein comprises a step of identifying a cancer cell from a subject as a HR-deficient cancer cell. In some embodiments, a method of treating cancer described herein comprises the steps of: a) identifying a subject in need thereof having an HR-deficient cancer (e.g., by al) determining that the cancer contains a mutation or an alteration in a gene regulating homologous recombination (HR) and/or a2) determining that the cancer is overexpressing POLQ); and b) administering to the subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

In any of the above embodiments, the administering of step b) occurs after the determining of step a); or the administering of step b) occurs prior to the determining of step a). In further aspects of these embodiments, the determining of step al) is conducted before the determining of step a2); or the determining of step al) is conducted after the determining of step a2).

In some embodiments, a mutation in a gene regulating homologous recombination, or the overexpression of POLQ, can be determined by any suitable art- recognized methods. In some embodiments, a mutation in a gene regulating homologous recombination, or the overexpression of POLQ can be determined without isolating a cancer cell from a subject. For example, a mutation can be identified by analyzing blood sample of the subject, or a sample of hair, urine, saliva, or feces of the subject for the presence of a cancer biomarker. The term “cancer biomarker”, as used herein, refers to a substance or process that is indicative of the presence of cancer in the body of a subject. A biomarker may be a molecule secreted by a tumor or a specific response of the subject’s body to the presence of a cancer. In other embodiments, a mutation can be identified be isolating a cancer cell from a subject. For example, a cancer cell for analysis of a mutation in an HR-associated gene or levels of expression of POLQ, can be isolated from the subject by surgical means (e.g., laparoscopically). In these embodiments, an HR mutation or a level of POLQ expression is being identified in the cancer cell of the subject.

Any of the methods, reagents, protocols and devices generally known in the art can be used to identify a mutation in a gene regulating HR or an overexpression of POLQ. For example, next generation sequencing, immunohistochemistry, fluorescence microscopy, break apart FISH analysis, Southern bloting, Western bloting, FACS analysis, Northern bloting, ELISA or ELISPOT, antibodies microarrays, or immunohistochemistry, and PCR-based amplification (e.g., RT-PCR and quantitative real-time RT-PCR) techniques can be used to identify the mutation or a POLQ status of cancer. As is well-known in the art, the assays are typically performed, e.g., with at least one labelled nucleic acid probe or at least one labelled antibody or antigen-binding fragment thereof. Assays can utilize other detection methods known in the art for detecting a mutation in a HR-associated gene. Any DNA sequencing platform for somatic mutations can be used. For example, Illumina MiSeq platform (Illumina TruSeq Amplicon Cancer Hotspot panel, 47 gene), or NextSeq (Agilent SureSelect XT, 592 gene selected based on COSMIC database) can be used to identify a mutation in a HR-associated gene. The sample can be a biological sample or a biopsy sample (e.g., a paraffin-embedded biopsy sample) from the patient. In some embodiments, the patient is a patient suspected of having a cancer having a mutation in a HR-associated gene (e.g., BRCAl/2 mutation in breast or ovarian cancer).

Exemplary methods for determining POLQ overexpressing cancers are described, e.g., in EP 2710142, which is incorporated herein by reference in its entirety. Exemplary methods to identify a BRCA mutation in cancer are described, for example, in WO1998043092 and WO 2013124740, both of which are incorporated herein by reference.

Heat shock protein 90 (Hsy90) inhibition

In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is an inhibitor of heat shock protein 90 (Hsp90). That is, the compound of Formula (I) reduces, slows, halts, and/or prevents heat shock protein 90 (Hsp90) activity in a cancer cell (e.g., HR-deficient cancer cell).

Hsp90 (heat shock protein 90) is a protein that weighs about 90 kDa. In mammalian cells, there are two or more genes encoding cytosolic Hsp90 homologues, with the human Hsp90a showing 85% sequence identity to H£r90b. In some embodiments, Hsp90 described in the present disclosure is Hsp90-ai, Hsp90-a2, or Hsp90- isoform. Hsp90 protein consists of four structural domains: highly conserved N-terminal domain (NTD) of about 25 kDa, “charged linker” region, that connects the N-terminus with the middle domain, a middle domain (MD) of about 40 kDa, and a C-terminal domain (CTD) of about 12 kDa.

In addition to assisting in protein folding, protein degradation, and mitigating heat stress, is implicated in stabilizing a number of proteins (chaperones) associated with cancer. Without being bound by a theory, it is believed that inhibition of Hsp90 leads to apoptosis of the cancer cells. It is believed that a number of molecular pathways are implicated in the Hsp90 protein’s role in cancer development and proliferation. In one example, Hsp90 protein is implicated in stabilizing mutant oncogenic proteins such as v-Src, Bcr/Abl, and p53. In another example, Hsp90 is implicated in stabilizing several growth factors and signaling molecules, such as EGFR, PI3K, and AKT, which leads to promotion of growth factor signaling pathways and induction of VEGF, nitric oxide synthase, and the matrix metalloprotease MMP2. This induction promotes angiogenesis and metathesis of the cancerous cells. In yet another example, without wishing to be bound by theory,

Hsp90 stabilizes homologous recombination proteins such as BRCA1 and BRCA2 proteins. These proteins help repair damaged DNAin cancer cells, and are involved in the repair of chromosomal damage with an important role in the error-free repair of DNA double-strand breaks. If the stabilizing function of Hsp90 is disrupted (e.g., by an inhibitor compound of the present application), the damaged DNA is not repaired properly, which ultimately leads to the death of the cancer cell. In sum, many different cancer types and subtypes rely on pathways mediated by the Hsp90 protein for proliferation and tumor development. Hence, inhibitors of Hsp90 protein may be used to treat a wide variety of cancers (e.g., cancers described herein). The cellular function of Hsp90 is independent of the cellular function of POLQ (as discussed above). The Hsp90 and the POLQ proteins repair cellular DNA by completely different molecular mechanisms. Hence, the compounds of the present disclosure are dual inhibitors (Hsp90 and POLQ inhibitors) that simultaneously exert their apoptotic effect on the cancer cells via two independent molecular mechanisms. Advantageously, this leads to increased therapeutic potency of the claimed compounds for treating cancer.

Functionally, the Hsp90 protein contains three domains: the ATP-binding, protein/nucleic acid-binding, and dimerizing domain, each of which play a crucial role in the function of the protein. The region of the protein near the N-terminus has a high-affinity ATP-binding site. The protein/nucleic acid-binding region of Hsp90 is located toward the C-terminus of the amino sequence. The ability of Hsp90 to clamp onto proteins/nucleic acids (by binding the proteins/nucleic acids in the binding region) allows Hsp90 to perform several functions including assisting folding, preventing aggregation, and facilitating transport. Hence, Hsp90 plays a role in the maturation and stabilization of more than 200 protein substrates (Davis, et al, A scaffold merging approach to Hsp90 C-terminal inhibition: synthesis and evaluation of a chimeric library. MedChemComm 2017, 8, 593).

In some embodiments, the compound of Formula (I) inhibits the N-terminal ATP binding/ ATPase function ofHsp90, or the C-terminal protein/nucleic acid binding function of Hsp90. In some embodiments, the compound of Formula (I) selectively inhibits (e.g., reduces, slows, halts, and/or prevents) the protein/nucleic acid-binding function at the C-terminus of Hsp90. In some embodiments, the compound of Formula (I) selectively inhibits C-terminal binding domain of Hsp90 while not inhibiting the N-terminal ATPase domain of Hsp90.

In some embodiments, the present disclosure provides a method of inhibiting a heat shock protein 90 (Hsp90) in a cancer cell, the method comprising contacting the cell with an effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof. In some embodiments, the cancer cell is contacted in vitro. In some embodiments, the cancer cell is contacted in vivo. In some embodiments, the cancer cell in contacted ex vivo. In some embodiments, Hsp90 is inhibited in a cancer cell of a subject after the compound of Formula (I), or a pharmaceutically acceptable salt thereof, is administered to the subject in need thereof.

In some embodiments, the present disclosure provides a method inhibiting a heat shock protein 90 (Hsp90) in a subject (e.g., in need thereof), the method comprising administering to the subject an effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof. In some embodiments, inhibiting a heat shock protein 90 (Hsp90) in a subject results in treating or ameliorating symptoms of a cancer in the subject (e.g., any one of the cancers described herein). In some embodiments, the present disclosure provides a method of treating a cancer, the method comprising inhibiting Hsp90 in the cancer by administering to a subject a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof.

Cancers

Suitable Examples of cancers (e.g., HR-deficient cancers) known to have mutations in HR-associated genes or overexpression of POLQ include gynecologic cancer (e.g., ovarian cancer, breast cancer, fallopian tube cancer, uterine leiomyoma), prostate cancer, non-Hodgkin’s lymphoma, colon cancer, lipoma, basal cell skin carcinoma, squamous cell skin carcinoma, osteosarcoma, acute myelogenous leukemia (AML), and other cancers (See, e.g., Helleday (2010) Carcinigenesis vol.

21, no. 6, pp 955-960; D'Andrea AD. Susceptibility pathways in Fanconi's anemia and breast cancer. 2010 N Engl J Med. 362: 1909-1919).

Genetic susceptibility to breast cancer has been linked to mutations of the BRCA1 and BRCA2 genes. It is postulated that a mutation causes a disruption in the protein, which causes chromosomal instability in BRCA mutated cells thereby predisposing them to neoplastic transformation. Inherited mutations in the BRCA1 and BRCA2 genes account for approximately 7-10% of all breast cancer cases. Women with BRCA mutations have a lifetime risk of breast cancer between 56-87%, and a lifetime risk of ovarian cancer between 27-44%.

In some embodiments, the present disclosure provides a method of treating breast cancer (e.g., HR-deficient breast cancer such as POLQ overexpressing breast cancer). Suitable examples of breast cancer include lobular carcinoma in situ (LCIS), a ductal carcinoma in situ (DCIS), an invasive ductal carcinoma (IDC), inflammatory breast cancer, Paget disease of the nipple, Phyllodes tumor, Angiosarcoma, adenoid cystic carcinoma, low-grade adenosquamous carcinoma, medullary carcinoma, mucinous carcinoma, papillary carcinoma, tubular carcinoma, metaplastic carcinoma, micropapillary carcinoma, mixed carcinoma, and other types of breast cancer, including triple negative (TNBC), HER positive, neoadjuvant HER2 negative, estrogen receptor positive, progesterone receptor positive, HER and estrogen receptor positive, HER and progesterone receptor positive, estrogen and progesterone receptor positive, and HER and estrogen and progesterone receptor positive.

Epithelial ovarian cancer (EOC) is the most lethal gynecologic malignancy and the fifth most lethal cancer type overall in women in the United States (Siegel et al, 2017, CA Cancer J Clin 67, 7-30). Ovarian cancers often present genome instability (Cancer Genome Atlas Research, 2011), with almost half of the ovarian cancers harbor defects in one or more DNA repair pathways, mostly in HR (Bast et al, 2009, Nature reviews Cancer 9, 415-428; Pal et al, 2005, Cancer 104, 2807- 2816). Ovarian cancer cells are initially sensitive to chemotherapeutic drugs such as platinum analogues (carboplatin or cisplatin) but become resistant to these drugs over time (Pignata et al, 2011, Cancer letters 303, 73-83). The extract mechanism of this acquired resistance remains unclear but appears to be multifactorial, including enhanced DNA repair (Shen et al, 2012, Pharmacol Rev 64, 706-721). Therefore, inhibition of the enhanced DNA repair pathway can re-sensitize ovarian cancer cells to platinum analogues.

In some embodiments, the present disclosure provides a method of treating ovarian cancer (e.g., HR-deficient ovarian cancer such as POLQ overexpressing ovarian cancer). Suitable examples of ovarian cancer include epithelial ovarian carcinomas (EOC), maturing teratomas, dysgerminomas, endodermal sinus tumors, granulosa-theca tumors, Sertoli-Leydig cell tumors, primary peritoneal carcinomas, small cell carcinoma of the ovary (SCCO), teratomas of the ovary, sex cord-stromal ovarian cancer, dysgerminoma ovarian germ cell cancer, choriocarcinomas, carcinosarcomas, adenosarcomas, leiomyosarcomas, fibrosarcomas, and Krukenberg tumor.

In some embodiments, the present disclosure provides a method of treating pancreatic cancer (e.g., HR-deficient pancreatic cancer such as POLQ overexpressing pancreatic cancer). Suitable examples of pancreatic cancer include tumors affecting the exocrine gland, exocrine tumors, endocrine tumors, islet cell tumors, neurendocrine tumors, cystic tumours, cancer of the acinar cells, insulinomas, somatostatinomas, gastrinomas, glucagonomas, adenocarcinoma of the pancreas, pancreatoblastoma, sarcomas of the pancreas, adenosquamous carcinomas, colloid carcinomas, hepatoid carcinomas, intraductal papillary mucinous neoplasms, mucinous cystic neoplasms, pancreatic intraepithelial neoplasia, pancreatoblastomas, serous cystadenomas, signet ring cell carcinoma, solid-pseudopapillary neoplasm, and undifferentiated carcinoma with osteoclast-like giant cells,

In some embodiments, the present disclosure provides a method of treating prostate cancer (e.g., HR-deficient prostate cancer such as POLQ overexpressing prostate cancer). Suitable examples of prostate cancer include prostate adenocarcinoma, acinar adenocarcinoma, ductal adenocarcinoma, transitional cell (or urothelial) cancer, squamous cell cancer, small cell prostate cancer, carcinoid, sarcomas, small cell carcinomas, neuroendocrine tumors, and transitional cell carcinomas. In some embodiments, the prostate cancer is advanced prostate cancer with germane to somatic homologous recombination deficiency.

Additional examples of cancers that can be treated using the methods described herein include lung cancer (e.g., bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung); kidney cancer (e.g., nephroblastoma, a.k.a. Wilms’ tumor, renal cell carcinoma); acoustic neuroma; adenocarcinoma; adrenal gland cancer; anal cancer; angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma); appendix cancer; benign monoclonal gammopathy; biliary cancer (e.g., cholangiocarcinoma); bladder cancer; breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast); brain cancer (e.g., meningioma, glioblastomas, glioma (e.g., astrocytoma, oligodendroglioma), medulloblastoma); bronchus cancer; carcinoid tumor; cervical cancer (e.g., cervical adenocarcinoma); choriocarcinoma; chordoma; craniopharyngioma; colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial carcinoma; ependymoma; endotheliosarcoma (e.g., Kaposi’s sarcoma, multiple idiopathic hemorrhagic sarcoma); endometrial cancer (e.g., uterine cancer, uterine sarcoma); esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett’s adenocarcinoma); Ewing’s sarcoma; ocular cancer (e.g., intraocular melanoma, retinoblastoma); familiar hypereosinophilia; gall bladder cancer; gastric cancer (e.g., stomach adenocarcinoma); gastroesophageal cancer, gastrointestinal stromal tumor (GIST); germ cell cancer; head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer)); heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease; hemangioblastoma; hypopharynx cancer; inflammatory myofibroblastic tumors; immunocytic amyloidosis; liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma, hepatobiliary cancer); leiomyosarcoma (LMS); mastocytosis (e.g., systemic mastocytosis); muscle cancer; myelodysplastic syndrome (MDS); mesothelioma; myeloproliferative disorder (MPD) (e.g., polycythemia vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)); neuroblastoma; neurofibroma (e.g., neurofibromatosis (NF) type 1 or type 2, schwannomatosis); neuroendocrine cancer (e.g., gastroenteropancreatic neuroendoctrine tumor (GEP-NET), carcinoid tumor); osteosarcoma (e.g., bone cancer); ovarian cancer (e.g, cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma); papillary adenocarcinoma; pancreatic cancer (e.g, pancreatic andenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors); penile cancer (e.g, Paget’s disease of the penis and scrotum); pinealoma; primitive neuroectodermal tumor (PNT); plasma cell neoplasia; paraneoplastic syndromes; intraepithelial neoplasmlungrectal cancer; rhabdomyosarcoma; salivary gland cancer; skin cancer (e.g, squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)); small bowel cancer (e.g, appendix cancer); soft tissue sarcoma (e.g, malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma); sebaceous gland carcinoma; small intestine cancer; sweat gland carcinoma; synovioma; testicular cancer (e.g, seminoma, testicular embryonal carcinoma); thyroid cancer (e.g, papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer); urethral cancer; vaginal cancer; and vulvar cancer (e.g, Paget’s disease of the vulva). In some embodiments, the cancer is ovarian cancer, bladder cancer, breast cancer, endometrial cancer, prostate cancer or pancreatic cancer.

HR-deficient cells (e.g., BRCAl/2 mutated cells) are hypersensitive to PARP inhibition, since PARP inactivation prevents the repair of DNA single-strand breaks (SSBs), which are subsequently converted to double-strand breaks (DSBs) (Brody, 2005, he New England journal of medicine 353, 949-950; Farmer et al, 2005, Nature 434, 917-921; McCabe et al, 2006, Cancer research 66, 8109-8115). Loss of HR accounts for the genomic instability of cancer cells and for their cellular hyper dependence on alternative poly-ADP ribose polymerase (PARP)-mediated DNA repair mechanisms. PARP expression and activity are significantly up-regulated in certain cancers, suggesting that these cancer cells can rely more than normal cells on the activity of PARP. Thus, agents that inhibit the activity of PARP or reduce the expression level of PARP, collectively referred to herein as “PARP inhibitors (PARPi)”, can be useful cancer therapeutics. Suitable examples of PARPi include iniparib (BSI 201), talazoparib (BMN-673), niraparib, olaparib (AZD-2281, TOPARP-A), rucaparib (AG014699, PF-01367338), veliparib (ABT-888), CEP 9722, MK 4827, BGB-290 and 3-aminobenzamide, 4-amino- 1,8-napthalimide, benzamide, BGP- 15, BYK204165 , 3 ,4-Dihy dro-5- [4-( 1 -piperidiny l)butoxy 1] - 1 (2H)- isoquinolinone, DR2313, 1,5-Isoquinolinediol, MC2050, ME0328, PJ-34 hydrochloride hydrate, and UPF-1069. As used herein, the term “PARP” includes at least PARPI and PARP2. PARPI is the founding member of a large family of poly (ADP -ribose) polymerases with 17 members identified (Ame et ah, Bioessays 26:882-893, 2004). It is the primary enzyme catalyzing the transfer of ADP-ribose units fromNAD+ to target proteins including PARPI itself. Under normal physiologic conditions, PARPI facilitates the repair of DNA base lesions by helping recruit base excision repair proteins XRCC1 and Roίb (Dantzer et al, Methods Enzymol. 409:493- 510, 2006).

In some embodiments, any of the cancers described herein can be PARP inhibitor-resistant. In some embodiments, the present disclosure provides a method of treating a cancer having a de novo or an acquired resistance to a PARP inhibitor, the method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I), or a pharmaceutically acceptable salt thereof, can be administered to the subject in combination with a therapeutically effective amount of an additional anti-cancer agent. In some embodiments, the additional anti-cancer agent is a PARP inhibitor (e.g., olaparib, veliparib, pamiparib (BGB-290), talazoparib (BMN 673), or niraparib). POLQ channels HR repair by antagonizing HR and promoting PARP- dependent error-prone repair. Without wishing to be bound by any particular theory, it is believed that inhibition of POLQ is expected to enhance cell death of PARP inhibitor-resistant cancers. For instance, the PARP enzyme cooperates with POLQ in the process of Alternative End-Joining Repair (Alt-EJ). PARP is required to localize POLQ at the site of the double strand break (DSB) repair. Human tumors can become resistant to PARP inhibitors; however, these tumors can still be sensitive to a POLQ inhibitor if POLQ can localize to the DSB in a PARP-independent manner. Accordingly, aspects of the disclosure provide methods for treating a cancer that is resistant to PARP inhibitor therapy. A cancer that is resistant to a PARP inhibitor means that the cancer does not respond to such inhibitor, for example as evidenced by continued proliferation and increasing tumor growth and burden. In some instances, the cancer can have initially responded to treatment with such inhibitor (referred to herein as a previously administered therapy) but can have grown resistant after a treatment period. In some instances, the cancer can have never responded to treatment with such inhibitor at all. Cancers resistant to PARP inhibitors can be identified using methods known in the art (see, e.g., WO 2014205105, US 8729048; incorporated herein by reference). Suitable examples of cancers resistant to PARP-inhibitors include breast cancer, ovarian cancer, lung cancer, bladder cancer, liver cancer, head and neck cancer, pancreatic cancer, gastrointestinal cancer, and colorectal cancer.

Compounds of Formula (I)

The present disclosure provides compounds useful in treating cancer (e.g., cancer having alterations in genes regulating homologous recombination (HR) repair or HR-deficient cancer, or a POLQ-overexpressing cancer). In some embodiments, such compounds include a compound of Formula (I): or a pharmaceutically acceptable salt thereof, wherein:

R ¹ is Ce-12 aryl, optionally substituted with 1, 2, 3, 4, or 5 substituents independently selected from R ^g ; R ^g is selected from the group consisting of: OH, NO2, CN, halo, Ci-6 alkyl, C2- 6 alkenyl, C2-6 alkynyl, C1-4 haloalkyl, Ci-6alkoxy, Ci-6haloalkoxy, cyano-Ci-3 alkyl, HO-C1-3 alkyl, amino, Ci-6 alkylamino, di(C 1-6 alky l)amino, C6-12 aryl-Ci-3 alkyl, and C6-12 aryloxy;

R ² , R ³ , R ⁴ , and R ⁵ are independently selected from the group consisting of: H, Ci-6 alkyl, C2-6 alkenyl, C2-6 alkynyl, C1-4 haloalkyl, Ci-6alkoxy, and Ci-6 haloalkoxy;

R ⁶ is Ci-6 alkyl, optionally substituted with 1, 2, or 3 substituents indepndently selected from the group consisting of: OR ^al , NR ^al R ^a2 , C(=0)NR ^al R ^a2 , C(0)OR ^al , NR ^al C(=0)NR ^al R ^a2 , and NR ^al C(0)OR ^al ;

R ^al and R ^a2 are independently selected from the group consisting of: H, C1-3 alkyl, and C1-3 haloalkyl; and

R ⁷ and R ⁸ are independently selected from the group consisting of: H and C1-3 alkyl.

Certain embodiments of the compounds of Formula (I) are described below:

In some embodiments, R ¹ is phenyl, optionally substituted with 1, 2, or 3 independently selected R ^g . In some embodiments, R ¹ is phenyl, optionally substituted with one R ^g . In some embodiments, R ¹ is phenyl, optionally substituted with 1 or 2 independently selected R ^g .

In some embodiments, R ^g is selected from the group consisting of: CN, halo, Ci-6 alkyl, C1-4 haloalkyl, Ci-6 alkoxy, di(Ci-6 alkyl)amino, C6-12 aryl-Ci-3 alkyl, and C6-12 aryloxy.

In some embodiments, R ^g is CN. In some embodiments, R ^g is halo (e.g., Cl,

Br, or F). In some embodiments, R ^g is Ci-6 alkyl (e.g., methyl, ethyl, or isopropyl). In some embodiments, R ^g is C1-4 haloalkyl (e.g., trifluoromethyl). In some embodiments, R ^g is Ci-6 alkoxy (e.g., methoxy). In some embodiments, R ^g is di(Ci-6 alkyl)amino (e.g., dimethylamino). In some embodiments, R ^g is C6-12 aryl-Ci-3 alkyl (e.g., benzyl). In some embodiments, R ^g is C6-12 aryloxy (e.g., phenoxy).

In some embodiments, R ¹ is phenyl, optionally substituted with two Ci-6 alkyl. In some embodiments, R ¹ is phenyl, optionally substituted with two halo.

In some embodiments, R ² , R ³ , R ⁴ , and R ⁵ are each independently selected from the group consisting of: H and Ci-6 alkyl. In some embodiments, R ² , R ³ , R ⁴ , and R ⁵ are each independently selected from the group consisting of: H and methyl.

In some embodiments, R ⁵ is Ci-6 alkyl. In some embodiments, R ⁵ is methyl. In some embodiments, R ² , R ³ , and R ⁴ are each H; and R ⁵ is Ci-6 alkyl.

In some embodiments, R ² , R ³ , and R ⁴ are each H; and R ⁵ is methyl.

In some embodiments, R ⁶ is Ci-6 alkyl. In some embodiments, R ⁶ is C1-3 alkyl. In some embodiments, R ⁶ is methyl.

In some embodiments, R ⁵ is Ci-6 alkyl; and R ⁶ is Ci-6 alkyl.

In some embodiments, R ⁵ is methyl; and R ⁶ is methyl.

In some embodiments, R ⁷ and R ⁸ are both H. In some embodiemtns, R ⁷ and R ⁸ are both C1-3 alkyl. In some embodiments, R ⁷ is H; and R ⁸ is C1-3 alkyl. In some embodiments, R ⁷ is C1-3 alkyl; and R ⁸ is H.

In some embodiments, the compound of Formula (I) has Formula (la): or a pharmaceutically acceptable salt thereof.

In some embodiments of Formula (la):

R ¹ is phenyl, optionally substituted with 1, 2, or 3 independently selected R ^g ;

R ^g is selected from the group consisting of: CN, halo, Ci-6 alkyl, Ci-4 haloalkyl, Ci-6 alkoxy, di(Ci-6 alkyl)amino, Ce-n aryl-Ci-3 alkyl, and Ce-u aryloxy;

R ⁵ is Ci-6 alkyl; and

R ⁶ is Ci-6 alkyl.

In some embodiments of Formula (la):

R ¹ is phenyl, optionally substituted with 1 or 2 substituents independently selected from: methyl, ethyl, isopropyl, methoxy, trifluoromethyl, CN, Cl, Br, F, dimethylamino, benzyl, and phenoxy;

R ⁵ is methyl; and R ⁶ is methyl.

In some embodiments, the compound of Formula (I) is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

In some embodiments, the compound of Formula (I) is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

In some embodiments, the compound of Formula (I) is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

In some embodiments, the compound of Formula (I) is selected from the group consisting of: or a pharmaceutically acceptable salt thereof. In some embodiments, the compound of Formula (I) is selected from the group consisting of: or a pharmaceutically acceptable salt thereof.

Compounds of Formula (I), including salts thereof, can be prepared using known organic synthesis techniques and can be synthesized according to any of numerous possible synthetic routes. For example, the compounds described herein can be prepared using methods and procedures similar to those described in Donnelly, A. et al, The Design, Synthesis, and Evaluation of Coumarin Ring Derivatives of the Novobiocin Scaffold that Exhibit Antiproliferative Activity, Journal of Organic Chemistry 2008, 73, 8901-8920, which is incorporated herein by reference in its entirety. A person skilled in the art knows how to select and implement appropriate synthetic protocols, and appreciates that a broad repertoire of synthetic organic reactions is available to be potentially employed in synthesizing compounds provided herein.

Suitable synthetic methods of starting materials, intermediates and products can be identified by reference to the literature, including reference sources such as: Advances in Heterocyclic Chemistry, Vols. 1-107 (Elsevier, 1963-2012); Journal of Heterocyclic Chemistry Vols. 1-49 (Journal of Heterocyclic Chemistry, 1964-2012); Carreira, et al. (Ed.) Science of Synthesis, Vols. 1-48 (2001-2010) and Knowledge Updates KU2010/1-4; 2011/1-4; 2012/1-2 (Thieme, 2001-2012); Katritzky, etal.

(Ed.) Comprehensive Organic Functional Group Transformations , (Pergamon Press, 1996); Katritzky et al. (Ed.); Comprehensive Organic Functional Group Transformations II (Elsevier, 2 ^nd Edition, 2004); Katritzky et al. (Ed.), Comprehensive Heterocyclic Chemistry (Pergamon Press, 1984); Katritzky et al., Comprehensive Heterocyclic Chemistry II, (Pergamon Press, 1996); Smith et a , March's Advanced Organic Chemistry: Reactions, Mechanisms, and Structure, 6 ^th Ed. (Wiley, 2007); Trost et al. (Ed.), Comprehensive Organic Synthesis (Pergamon Press, 1991).

The reactions for preparing the compounds provided herein can be carried out in suitable solvents which can be readily selected by one of skill in the art of organic synthesis. Suitable solvents can be substantially non-reactive with the starting materials (reactants), the intermediates, or products at the temperatures at which the reactions are carried out, e.g., temperatures, which can range from the solvent's freezing temperature to the solvent's boiling temperature. A given reaction can be carried out in one solvent or a mixture of more than one solvent. Depending on the particular reaction step, suitable solvents for a particular reaction step can be selected by the skilled artisan.

Preparation of the compounds provided herein can involve the protection and deprotection of various chemical groups. The need for protection and deprotection, and the selection of appropriate protecting groups, can be readily determined by one skilled in the art. The chemistry of protecting groups can be found, for example, in P. G. M. Wuts and T. W. Greene, Protective Groups in Organic Synthesis, 4 ^th Ed., Wiley & Sons, Inc., New York (2006).

Combination therapies

The compounds of Formula (I) can be used in combination with anti-cancer therapies (e.g., anti-cancer agents, or therapies such as surgery, transplantation or radiotherapy). These anti-cancer therapies can show a synergistic effect in the treatment of cancers described herein (e.g., HR-deficient cancers, cancers resistant to poly (ADP-ribose) polymerase (PARP) inhibitor therapy, POLQ overexpressing cancers, and/or cancers characterized by one or more BRCA mutations and/or reduced expression of Fanconi (Fane) proteins). As used herein, “synergistic” refers to the joint action of agents (e.g., pharmaceutically active agents), that when taken together increase each other's effectiveness. For example, in some embodiments, in an HR- deficient cancer, POLQ-mediates Alt-EJ in the enhanced pathway. Hence, a POLQ inhibitor can re-sensitize HR-deficient cancer (e.g., ovarian cancer) to a PARP inhibitor or a platinum analogue.

In some embodiments, the anti-cancer therapy is selected from the group consisting of surgery, radiation therapy, chemotherapy, gene therapy, DNA therapy, viral therapy, RNA therapy, adjuvant therapy, and immunotherapy.

In some embodiments, the chemotherapy comprises administering to the subject a cytotoxic agent in an amount effective to treat the HR-deficient cancer. In some embodiments, the cytotoxic agent is selected from the group consisting of a platinum agent, mitomycin C, a poly (ADP-ribose) polymerase (PARP) inhibitor (e.g., any one of PARP inhibitors described herein), a radioisotope, a vinca alkaloid, an antitumor alkylating agent, a monoclonal antibody and an antimetabolite. In some embodiments, the cytotoxic agent is an ataxia telangiectasia mutated (ATM) kinase inhibitor.

Suitable examples of platinum agents include cisplatin, carboplatin, oxaliplatin, satraplatin, picoplatin, nedaplatin, triplatin, and lipoplatin.

Suitable examples of cytotoxic radioisotopes include ⁶⁷ Cu, ⁶⁷ Ga, ⁹⁰ Y, ^{1 1} 1. ¹⁷⁷ Lu, ¹⁸⁶ Re, ¹⁸⁸ Re, a-Particle emitter, ²¹¹ At, ²¹³ Bi, ²²⁵ Ac, Auger-electron emitter, ¹²⁵ I, ²¹² Pb, and ^m In.

Suitable examples of antitumor alkylating agents include nitrogen mustards, cyclophosphamide, mechlorethamine or mustine (HN2), uramustine or uracil mustard, melphalan, chlorambucil, ifosfamide, bendamustine, nitrosoureas, carmustine, lomustine, streptozocin, alkyl sulfonates, busulfan, thiotepa, procarbazine, altretamine, triazenes, dacarbazine, mitozolomide, and temozolomide.

Suitable examples of anti-cancer monoclonal antibodies include to necitumumab, dinutuximab, nivolumab, blinatumomab, pembrolizumab, ramucirumab, obinutuzumab, adotrastuzumab emtansine, pertuzumab, brentuximab, ipilimumab, ofatumumab, catumaxomab, bevacizumab, cetuximab, tositumomab-I ¹³¹ , ibritumomab tiuxetan, alemtuzumab, gemtuzumab ozogamicin, trastuzumab, and rituximab.

Suitable examples of vinca alkaloids include vinblastine, vincristine, vindesine, vinorelbine, desoxyvincaminol, vincaminol, vinbumine, vincamajine, vineridine, vinbumine, and vinpocetine.

Suitable examples of antimetabolites include fluorouracil, cladribine, capecitabine, mercaptopurine, pemetrexed, fludarabine, gemcitabine, hydroxyurea, methotrexate, nelarbine, clofarabine, cytarabine, decitabine, pralatrexate, floxuridine, and thioguanine.

In some embodiments, the anti-cancer therapy is an immunotherapy, such as cellular immunotherapy, antibody therapy or cytokine therapy. Without wishing to be bound by any particular theory, POLQ inhibitors are expected to function in many ways similar to PARP inhibitors, and to synergize with immunotherapy. Suitable examples of cellular immunotherapy include dendritic cell therapy and Sipuleucel-T. Suitable examples of antibody therapy include alemtuzumab, ipilimumab, nivolumab, ofatumumab, pembrolizumab, and rituximab. Suitable examples of cytokine therapy include interferons (for example, IFNa, IRNb, IKNg, IFNri) and interleukins. In some embodiments, the immunotherapy comprises one or more immune checkpoint inhibitors. Suitable examples of immune checkpoint proteins include CTLA-4 and its ligands CD80 and CD86, PD-1 with its ligands PD-L1 and PD-L2, and 4-1BB.

Additional examples of anti-cancer therapies include abiraterone acetate ( e.g ., ZYTIGA), ABVD, ABVE, ABVE-PC, AC, AC-T, ADE, ado-trastuzumab emtansine (e.g., KADCYLA), afatinib dimaleate (e.g., GILOTRIF), aldesleukin (e.g., PROLEUKIN), alemtuzumab (e.g., CAMPATH), anastrozole (e.g., ARIMIDEX), arsenic trioxide (e.g., TRISENOX), asparaginase erwinia chrysanthemi (e.g., ERWINAZE), axitinib (e.g, INLYTA), azacitidine (e.g, MYLOSAR, VIDAZA), BEACOPP, belinostat (e.g., BELEODAQ), bendamustine hydrochloride (e.g., TREANDA), BEP, bevacizumab (e.g., AVASTIN), bicalutamide (e.g., CASODEX), bleomycin (e.g., BLENOXANE), blinatumomab (e.g., BLINCYTO), bortezomib (e.g., VELCADE), bosutinib (e.g., BOSULIF), brentuximab vedotin (e.g., ADCETRIS), busulfan (e.g, BUSULFEX, MYLERAN), cabazitaxel (e.g, JEVTANA), cabozantinib-s-malate (e.g., COMETRIQ), CAF, capecitabine (e.g., XELODA), CAPOX, carboplatin (e.g., PARAPLAT, PARAPLATIN), carboplatin- taxol, carfilzomib (e.g., KYPROLIS), carmustine (e.g., BECENUM, BICNU, CARMUBRIS), carmustine implant (e.g., GLIADEL WAFER, GLIADEL), ceritinib (e.g., ZYKADIA), cetuximab (e.g., ERBITUX), chlorambucil (e.g., AMBOCHLORIN, AMBOCLORIN, LEUKERAN, LINFOLIZIN), chlorambucil- prednisone, CHOP, cisplatin (e.g., PLATINOL, PLATINOL-AQ), clofarabine (e.g, CLOFAREX, CLOLAR), CMF, COPP, COPP-ABV, crizotinib (e.g, XALKORI), CVP, cyclophosphamide (e.g, CLAFEN, CYTOXAN, NEOSAR), cytarabine (e.g, CYTOSAR-U, TARABINE PFS), dabrafenib (e.g., TAFINLAR), dacarbazine (e.g., DTIC-DOME), dactinomycin (e.g., COSMEGEN), dasatinib (e.g., SPRYCEL), daunorubicin hydrochloride (e.g., CERUBIDINE), decitabine (e.g, DACOGEN), degarelix, denileukin diftitox (e.g., ONTAK), denosumab (e.g., PROLIA, XGEVA), Dinutuximab (e.g., UNITUXIN), docetaxel (e.g., TAXOTERE), doxorubicin hydrochloride (e.g., ADRIAMYCIN PFS, ADRIAMYCIN RDF), doxorubicin hydrochloride liposome (e.g., DOXIL, DOX-SL, EVACET, LIPODOX), enzalutamide (e.g., XTANDI), epirubicin hydrochloride (e.g., ELLENCE), EPOCH, erlotinib hydrochloride (e.g., TARCEVA), etoposide (e.g., TOPOSAR, VEPESID), etoposide phosphate (e.g, ETOPOPHOS), everolimus (e.g, AFINITOR DISPERZ, AFINITOR), exemestane (e.g., AROMASIN), FEC, fludarabine phosphate (e.g., FLUDARA), fluorouracil (e.g, ADRUCIL, EFUDEX, FLUOROPLEX), FOLFIRI , F OLFIRI-BEV ACIZUM AB , FOLFIRI-CETUXIMAB, FOLFIRINOX, FOLFOX, FU-LV, fulvestrant (e.g., FASLODEX), gefitinib (e.g., IRESSA), gemcitabine hydrochloride (e.g., GEMZAR), gemcitabine-cisplatin, gemcitabine-oxaliplatin, goserelin acetate (e.g., ZOLADEX), Hyper-CVAD, ibritumomab tiuxetan (e.g., ZEVALIN), ibrutinib (e.g, IMBRUVICA), ICE, idelalisib (e.g, ZYDELIG), ifosfamide (e.g., CYFOS, IFEX, IFOSFAMIDUM), imatinib mesylate (e.g., GLEEVEC), imiquimod (e.g., ALDARA), ipilimumab (e.g., YERVOY), irinotecan hydrochloride (e.g., CAMPTOSAR), ixabepilone (e.g., IXEMPRA), lanreotide acetate (e.g., SOMATULINE DEPOT), lapatinib ditosylate (e.g, TYKERB), lenalidomide (e.g., REVLIMID), lenvatinib (e.g, LENVIMA), letrozole (e.g., FEMARA), leucovorin calcium (e.g., WELLCOVORIN), leuprolide acetate (e.g., LUPRON DEPOT, LUPRON DEPOT-3 MONTH, LUPRON DEPOT-4 MONTH, LUPRON DEPOT-PED, LUPRON, VIADUR), liposomal cytarabine (e.g, DEPOCYT), lomustine (e.g., CEENU), mechlorethamine hydrochloride (e.g., MUSTARGEN), megestrol acetate (e.g, MEGACE), mercaptopurine (e.g, PURINETHOL, PURIXAN), methotrexate (e.g, ABITREXATE, FOLEX PFS, FOLEX, METHOTREXATE LPF, MEXATE, MEXATE-AQ), mitomycin c (e.g, MITOZYTREX, MUTAMYCIN), mitoxantrone hydrochloride, MOPP, nelarabine (e.g., ARRANON), nilotinib (e.g., TASIGNA), nivolumab (e.g., OPDIVO), obinutuzumab (e.g., GAZYVA), OEPA, ofatumumab (e.g., ARZERRA), OFF, olaparib (e.g., LYNPARZA), omacetaxine mepesuccinate (e.g., SYNRIBO), OPPA, oxabplatin (e.g., ELOXATIN), pacbtaxel (e.g., TAXOL), pacbtaxel albumin- stabilized nanoparticle formulation (e.g., ABRAXANE), PAD, palbocicbb (e.g., IBRANCE), pamidronate disodium (e.g., AREDIA), panitumumab (e.g., VECTIBIX), panobinostat (e.g., FARYDAK), pazopanib hydrochloride (e.g., VOTRIENT), pegaspargase (e.g., ONCASPAR), peginterferon alfa-2b (e.g., PEG-INTRON), peginterferon alfa-2b (e.g., SYLATRON), pembrolizumab (e.g., KEYTRUDA), pemetrexed disodium (e.g., ALIMTA), pertuzumab (e.g., PERJETA), plerixafor (e.g., MOZOBIL), pomalidomide (e.g., POMALYST), ponatinib hydrochloride (e.g., ICLUSIG), pralatrexate (e.g., FOLOTYN), prednisone, procarbazine hydrochloride (e.g., MATULANE), radium 223 di chloride (e.g., XOFIGO), raloxifene hydrochloride (e.g., EVISTA, KEOXIFENE), ramucirumab (e.g., CYRAMZA), R- CHOP, recombinant HPV bivalent vaccine (e.g., CERVARIX), recombinant human papillomavirus (e.g., HPV) nonavalent vaccine (e.g., GARDASIL 9), recombinant human papillomavirus (e.g., HPV) quadrivalent vaccine (e.g., GARDASIL), recombinant interferon alfa-2b (e.g., INTRON A), regorafenib (e.g., STIVARGA), rituximab (e.g., RITUXAN), romidepsin (e.g., ISTODAX), ruxobtinib phosphate (e.g., JAKAFI), siltuximab (e.g., SYLVANT), sipuleucel-t (e.g., PROVENGE), sorafenib tosylate (e.g., NEXAVAR), STANFORD V, sunitinib malate (e.g., SUTENT), TAC, tamoxifen citrate (e.g, NOLVADEX, NOVALDEX), temozolomide (e.g., METHAZOLASTONE, TEMODAR), temsirolimus (e.g., TORISEL), thalidomide (e.g., SYNOVIR, THALOMID), thiotepa, topotecan hydrochloride (e.g., HYCAMTIN), toremifene (e.g., FARESTON), tositumomab and iodine I 131 tositumomab (e.g., BEXXAR), TPF, trametinib (e.g., MEKINIST), trastuzumab (e.g., HERCEPTIN), VAMP, vandetanib (e.g., CAPRELSA), VEIP, vemurafenib (e.g., ZELBORAF), vinblastine sulfate (e.g., VELBAN, VELSAR), vincristine sulfate (e.g., VINCASAR PFS), vincristine sulfate liposome (e.g., MARQIBO), vinorelbine tartrate (e.g, NAVELBINE), vismodegib (e.g., ERIVEDGE), vorinostat (e.g, ZOLINZA), XELIRI, XELOX, ziv-aflibercept (e.g., ZALTRAP), zoledronic acid ( e.g ZOMETA), or a combination thereof. In certain embodiments, the anti-cancer therapy is selected from the group consisting of epigenetic or transcriptional modulators (e.g., DNA methyltransferase inhibitors, histone deacetylase inhibitors (HD AC inhibitors), lysine methyltransferase inhibitors), antimitotic drugs (e.g., taxanes and vinca alkaloids), hormone receptor modulators (e.g., estrogen receptor modulators and androgen receptor modulators), cell signaling pathway inhibitors, modulators of protein stability (e.g., proteasome inhibitors),

Hsp90 inhibitors, glucocorticoids, all -trans retinoic acids, and other agents that promote differentiation. In certain embodiments, a POLQ inhibitor can be independently administered in combination with an anti-cancer therapy including, e.g., surgery, radiation therapy, transplantation (e.g., stem cell transplantation, bone marrow transplantation), immunotherapy, and chemotherapy. In some embodiments, the anti-cancer therapy is a combination of paclitaxel and olaparib, paclitaxel and carboplatin, olaparib and trabectedin, or carboplatin and niraparib. In some embodiments, the anti-cancer therapy includes rucaparib, olaparib, prexasertib or nivolumab. In some embodiments, the additional anti-cancer agent is a PARP inhibitor. In some embodiments, the PARP inhibitor is selected from olaparib, veliparib, pamiparib (BGB-290), talazoparib (BMN 673), and niraparib.

Pharmaceutical compositions and formulations

The present application also provides pharmaceutical compositions comprising an effective amount of a compound of Formula (I) disclosed herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier. The pharmaceutical composition can also comprise at least one of any one of the additional therapeutic agents described herein. In certain embodiments, the application also provides pharmaceutical compositions and dosage forms comprising any one the additional therapeutic agents described herein (e.g., in a kit). The carrier(s) are “acceptable” in the sense of being compatible with the other ingredients of the formulation and, in the case of a pharmaceutically acceptable carrier, not deleterious to the recipient thereof in an amount used in the medicament.

Pharmaceutically acceptable carriers, adjuvants and vehicles that can be used in the pharmaceutical compositions of the present application include ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol, and wool fat.

The compositions or dosage forms can contain any one of the compounds and therapeutic agents described herein in the range of 0.005% to 100% with the balance made up from the suitable pharmaceutically acceptable excipients. The contemplated compositions can contain 0.001%-100% (e.g., 0.1-95%, 75-85%, or 20-80%) of any one of the compounds and therapeutic agents provided herein, wherein the balance can be made up of any pharmaceutically acceptable excipient described herein, or any combination of these excipients.

Routes of administration and dosage forms

The pharmaceutical compositions of the present application include those suitable for any acceptable route of administration. Acceptable routes of administration include, buccal, cutaneous, endocervical, endosinusial, endotracheal, enteral, epidural, interstitial, intra-abdominal, intra-arterial, intrabronchial, intrabursal, intracerebral, intracistemal, intracoronary, intradermal, intraductal, intraduodenal, intradural, intraepidermal, intraesophageal, intragastric, intragingival, intraileal, intralymphatic, intramedullary, intrameningeal, intramuscular, intranasal, intraovarian, intraperitoneal, intraprostatic, intrapulmonary, intrasinal, intraspinal, intrasynovial, intratesticular, intrathecal, intratubular, intratumoral, intrauterine, intravascular, intravenous, nasal, nasogastric, oral, parenteral, percutaneous, peridural, rectal, respiratory (inhalation), subcutaneous, sublingual, submucosal, topical, transdermal, transmucosal, transtracheal, ureteral, urethral and vaginal.

Compositions and formulations described herein can conveniently be presented in a unit dosage form, e.g., tablets, capsules (e.g., hard or soft gelatin capsules), sustained release capsules, and in liposomes, and can be prepared by any methods well known in the art of pharmacy. See, for example, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins, Baltimore, MD (20th ed. 2000). Such preparative methods include the step of bringing into association with the molecule to be administered ingredients such as the carrier that constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers, liposomes or finely divided solid carriers, or both, and then, if necessary, shaping the product.

In some embodiments, any one of the compounds and therapeutic agents disclosed herein are administered orally. Compositions of the present application suitable for oral administration can be presented as discrete units such as capsules, sachets, granules or tablets each containing a predetermined amount (e.g., effective amount) of the active ingredient; a powder or granules; a solution or a suspension in an aqueous liquid or a non-aqueous liquid; an oil-in-water liquid emulsion; a water-in- oil liquid emulsion; packed in liposomes; or as a bolus, etc. Soft gelatin capsules can be useful for containing such suspensions, which can beneficially increase the rate of compound absorption. In the case of tablets for oral use, carriers that are commonly used include lactose, sucrose, glucose, mannitol, and silicic acid and starches. Other acceptable excipients can include: a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. For oral administration in a capsule form, useful diluents include lactose and dried com starch. When aqueous suspensions are administered orally, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening and/or flavoring and/or coloring agents can be added. Compositions suitable for oral administration include lozenges comprising the ingredients in a flavored basis, usually sucrose and acacia or tragacanth; and pastilles comprising the active ingredient in an inert basis such as gelatin and glycerin, or sucrose and acacia.

Compositions suitable for parenteral administration include aqueous and non- aqueous sterile injection solutions or infusion solutions which can contain antioxidants, buffers, bacteriostats and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which can include suspending agents and thickening agents. The formulations can be presented in unit-dose or multi-dose containers, for example, sealed ampules and vials, and can be stored in a freeze dried (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, saline (e.g., 0.9% saline solution) or 5% dextrose solution, immediately prior to use. Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets. The injection solutions can be in the form, for example, of a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. The sterile injectable preparation can also be a sterile injectable solution or suspension in anon-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that can be employed are mannitol, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil can be employed including synthetic mono- or diglycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their poly oxy ethylated versions. These oil solutions or suspensions can also contain a long-chain alcohol diluent or dispersant.

The pharmaceutical compositions of the present application can be administered in the form of suppositories for rectal administration. These compositions can be prepared by mixing a compound of the present disclosure with a suitable non-irritating excipient, which is solid at room temperature but liquid at the rectal temperature and therefore will melt in the rectum to release the active components. Such materials include cocoa butter, beeswax, and polyethylene glycols.

The pharmaceutical compositions of the present disclosure can be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and can be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilizing or dispersing agents known in the art. See, for example, U.S. Patent No. 6,803,031. Additional formulations and methods for intranasal administration are found in Ilium, L., J Pharm Pharmacol, 56:3-17, 2004 and Ilium, L., Eur J Pharm Sci 11:1-18, 2000.

The topical compositions of the present disclosure can be prepared and used in the form of an aerosol spray, cream, emulsion, solid, liquid, dispersion, foam, oil, gel, hydrogel, lotion, mousse, ointment, powder, patch, pomade, solution, pump spray, stick, towelette, soap, or other forms commonly employed in the art of topical administration and/or cosmetic and skin care formulation. The topical compositions can be in an emulsion form. Topical administration of the pharmaceutical compositions of the present application is especially useful when the desired treatment involves areas or organs readily accessible by topical application. In some embodiments, the topical composition comprises a combination of any one of the compounds and therapeutic agents disclosed herein, and one or more additional ingredients, carriers, excipients, or diluents including absorbents, anti-irritants, anti acne agents, preservatives, antioxidants, coloring agents/pigments, emollients (moisturizers), emulsifiers, film-forming/holding agents, fragrances, leave-on exfoliants, prescription drugs, preservatives, scrub agents, silicones, skin- identical/repairing agents, slip agents, sunscreen actives, surfactants/detergent cleansing agents, penetration enhancers, and thickeners.

The compounds and therapeutic agents of the present disclosure can be incorporated into compositions for coating an implantable medical device, such as prostheses, artificial valves, vascular grafts, stents, or catheters. Suitable coatings and the general preparation of coated implantable devices are known in the art and are exemplified in U.S. Patent Nos. 6,099,562; 5,886,026; and 5,304,121. The coatings are typically biocompatible polymeric materials such as a hydrogel polymer, polydimethylsiloxane, polycaprolactone, polyethylene glycol, polylactic acid, ethylene vinyl acetate, and mixtures thereof. The coatings can optionally be further covered by a suitable topcoat of fluorosilicone, polysaccharides, polyethylene glycol, phospholipids or combinations thereof to impart controlled release characteristics in the composition. Coatings for invasive devices are to be included within the definition of pharmaceutically acceptable carrier, adjuvant or vehicle, as those terms are used herein.

In some embodiments, the present disclosure provides an implantable drug release device impregnated with or containing a compound or a therapeutic agent described herein, or a composition comprising a compound or a therapeutic agent described herein, such that said compound or therapeutic agent is released from said device and is therapeutically active.

Dosages and regimens

In the pharmaceutical compositions of the present disclosure, a therapeutic compound is present in an effective amount (e.g., a therapeutically effective amount).

Effective doses can vary, depending on the diseases treated, the severity of the disease, the route of administration, the sex, age and general health condition of the subject, excipient usage, the possibility of co-usage with other therapeutic treatments such as use of other agents and the judgment of the treating physician.

In some embodiments, an effective amount of a therapeutic compound can range, for example, from about 0.001 mg/kg to about 500 mg/kg (e.g., from about 0.001 mg/kg to about 200 mg/kg; from about 0.01 mg/kg to about 200 mg/kg; from about 0.01 mg/kg to about 150 mg/kg; from about 0.01 mg/kg to about 100 mg/kg; from about 0.01 mg/kg to about 50 mg/kg; from about 0.01 mg/kg to about 10 mg/kg; from about 0.01 mg/kg to about 5 mg/kg; from about 0.01 mg/kg to about 1 mg/kg; from about 0.01 mg/kg to about 0.5 mg/kg; from about 0.01 mg/kg to about 0.1 mg/kg; from about 0. 1 mg/kg to about 200 mg/kg; from about 0. 1 mg/kg to about 150 mg/kg; from about 0. 1 mg/kg to about 100 mg/kg; from about 0.1 mg/kg to about 50 mg/kg; from about 0. 1 mg/kg to about 10 mg/kg; from about 0.1 mg/kg to about 5 mg/kg; from about 0.1 mg/kg to about 2 mg/kg; from about 0.1 mg/kg to about 1 mg/kg; or from about 0.1 mg/kg to about 0.5 mg/kg).

In some embodiments, an effective amount of a therapeutic compound is about 0.1 mg/kg, about 0.5 mg/kg, about 1 mg/kg, about 2 mg/kg, or about 5 mg/kg.

The foregoing dosages can be administered on a daily basis (e.g., as a single dose or as two or more divided doses, e.g., once daily, twice daily, thrice daily) or non-daily basis (e.g., every other day, every two days, every three days, once weekly, twice weekly, once every two weeks, once a month). The compounds and compositions described herein can be administered to the subject in any order. A first therapeutic agent, such as a compound of Formula (I), can be administered prior to or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before or after), or concomitantly with the administration of a second therapeutic agent, such as an anti- cancer therapy described herein, to a subject in need of treatment. Thus, the compound of Formula (I), or a composition containing the compound, can be administered separately, sequentially or simultaneously with the second therapeutic agent, such as a chemotherapeutic agent described herein. When the compound of Formula (I), or a pharmaceutically acceptable salt thereof, and a second or third therapeutic agent are administered to the subject simultaneously, the therapeutic agents can be administered in a single dosage form (e.g., tablet, capsule, or a solution for injection or infusion).

Kits

The present disclosure also includes pharmaceutical kits useful, for example, in the treatment of disorders, diseases and conditions referred to herein, which include one or more containers containing a pharmaceutical composition comprising a therapeutically effective amount of a compound of the present disclosure. Such kits can further include, if desired, one or more of various conventional pharmaceutical kit components, such as, for example, containers with one or more pharmaceutically acceptable carriers, additional containers, etc. Instructions, either as inserts or as labels, indicating quantities of the components to be administered, guidelines for administration, and/or guidelines for mixing the components, can also be included in the kit. The kit can optionally include directions to perform a test to determine a mutation (e.g., HR-associated mutation) in a cancer cell, and/or any of the reagents and device(s) to perform such tests. The kit can optionally include directions to perform a test to determine a POLQ overexpression in a cancer cell, and/or any of the reagents and device(s) to perform such tests. The kit can also optionally include an additional therapeutic agent (e.g., PARP inhibitor or a platinum-based anticancer agent).

Definitions

As used herein, the term "about" means "approximately" (e.g., plus or minus approximately 10% of the indicated value).

As used herein, the term “compound” as used herein is meant to include all stereoisomers, geometric isomers, tautomers, and isotopes of the structures named or depicted. Compounds herein identified by name or structure as one particular tautomeric form are intended to include other tautomeric forms unless otherwise specified. The terms “pharmaceutical” and “pharmaceutically acceptable” are employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.

As used herein, the term “cell” is meant to refer to a cell that is in vitro, ex vivo or in vivo. In some embodiments, an ex vivo cell can be part of a tissue sample excised from an organism such as a mammal. In some embodiments, an in vitro cell can be a cell in a cell culture. In some embodiments, an in vivo cell is a cell living in an organism such as a mammal.

As used herein the term “treating” or “treatment” refers to 1) inhibiting the disease; for example, inhibiting a disease, condition or disorder in an individual who is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., arresting further development of the pathology and/or symptomatology), or 2) ameliorating the disease; for example, ameliorating a disease, condition or disorder in an individual who is experiencing or displaying the pathology or symptomatology of the disease, condition or disorder (i.e., reversing the pathology and/or symptomatology).

As used herein, the term “preventing” or “prevention” of a disease, condition or disorder refers to decreasing the risk of occurrence of the disease, condition or disorder in a subject or group of subjects (e.g., a subject or group of subjects predisposed to or susceptible to the disease, condition or disorder). In some embodiments, preventing a disease, condition or disorder refers to decreasing the possibility of acquiring the disease, condition or disorder and/or its associated symptoms. In some embodiments, preventing a disease, condition or disorder refers to completely or almost completely stopping the disease, condition or disorder from occurring.

As used herein, the term “pharmaceutically acceptable salt” refers to a salt that is formed between an acid and a basic group of the compound, such as an amino functional group, or between a base and an acidic group of the compound, such as a carboxyl functional group. In some embodiments, the compound is a pharmaceutically acceptable acid addition salt. In some embodiments, acids commonly employed to form pharmaceutically acceptable salts of the therapeutic compounds described herein include inorganic acids such as hydrogen bisulfide, hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfuric acid and phosphoric acid, as well as organic acids such as para-toluenesulfonic acid, salicylic acid, tartaric acid, bitartaric acid, ascorbic acid, maleic acid, besylic acid, fumaric acid, gluconic acid, glucuronic acid, formic acid, glutamic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, lactic acid, oxalic acid, para- bromophenylsulfonic acid, carbonic acid, succinic acid, citric acid, benzoic acid and acetic acid, as well as related inorganic and organic acids. Such pharmaceutically acceptable salts thus include sulfate, pyrosulfate, bisulfate, sulfite, bisulfite, phosphate, monohydrogenphosphate, dihydrogenphosphate, metaphosphate, pyrophosphate, chloride, bromide, iodide, acetate, propionate, decanoate, caprylate, acrylate, formate, isobutyrate, caprate, heptanoate, propiolate, oxalate, malonate, succinate, suberate, sebacate, fumarate, maleate, butyne-l,4-dioate, hexyne-l,6-dioate, benzoate, chlorobenzoate, methylbenzoate, dinitrobenzoate, hydroxybenzoate, methoxybenzoate, phthalate, terephthalate, sulfonate, xylene sulfonate, phenylacetate, phenylpropionate, phenylbutyrate, citrate, lactate, b-hydroxybutyrate, glycolate, maleate, tartrate, methanesulfonate, propanesulfonate, naphthalene- 1 -sulfonate, naphthalene-2- sulfonate, mandelate and other salts. In one embodiment, pharmaceutically acceptable acid addition salts include those formed with mineral acids such as hydrochloric acid and hydrobromic acid, and especially those formed with organic acids such as maleic acid.

In some embodiments, bases commonly employed to form pharmaceutically acceptable salts of the therapeutic compounds described herein include hydroxides of alkali metals, including sodium, potassium, and lithium; hydroxides of alkaline earth metals such as calcium and magnesium; hydroxides of other metals, such as aluminum and zinc; ammonia, organic amines such as unsubstituted or hydroxyl- substituted mono-, di-, or tri-alkylamines, dicyclohexylamine; tributyl amine; pyridine; N-methyl, N-ethylamine; diethylamine; triethylamine; mono-, bis-, or tris- (2-OH-(Cl-C6)-alkylamine), such as N,N-dimethyl-N-(2-hydroxyethyl)amine or tri- (2-hydroxyethyl)amine; N-methyl-D-glucamine; morpholine; thiomorpholine; piperidine; pyrrolidine; and amino acids such as arginine, lysine, and the like.

As used herein, “homologous recombination (HR)”, refers to the cellular process of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA. It is most widely used for repairing double-stranded breaks in DNA. Two primary models for how homologous recombination repairs double-strand breaks in DNA are the double-strand break repair (DSBR) pathway (sometimes called the double Holliday junction model) and the synthesis-dependent strand annealing (SDSA) pathway (See, e.g., Sung, P; Klein, H (October 2006). “Mechanism of homologous recombination: mediators and helicases take on regulatory functions”. Nature Reviews Molecular Cell Biology 7 (10): 739- 750, incorporated herein by reference).

As used throughout, the term “subject” or “patient” is intended to include humans and animals that are capable of suffering from or afflicted with a cancer or any disorder involving, directly or indirectly, a cancer. Examples of subjects include mammals, e.g., humans, dogs, cows, horses, pigs, sheep, goats, cats, mice, rabbits, rats, and transgenic non-human animals. In some embodiments, subjects include companion animals, e.g. dogs, cats, rabbits, and rats. In some embodiments, subjects include livestock, e.g., cows, pigs, sheep, goats, and rabbits. In some embodiments, subjects include thoroughbred or show animals, e.g., horses, pigs, cows, and rabbits.

In important embodiments, the subject is a human, e.g., a human having, at risk of having, or potentially capable of having cancer. A “subject in need of treatment” is a subject identified as having cancer. In some embodiments, the subject in need of treatment is identified as having a homologous recombination (HR)-deficient cancer, i.e., the subject has been diagnosed by a physician (e.g., using methods well known in the art; see WO 2014/138101, incorporated herein by reference) as having aHR- deficient cancer. The HR status of the cancer can be determined by, for example, a BRCA 1 -specific CGH classifier (Evers et al. Trends Pharmacol Sci. 2010 Aug;31(8):372-80), an assay that determines the capacity of primary cell cultures to form foci after PARP inhibition (Mukhopadhyay, A. et al. (2010) Clin. Cancer Res.

16, 2344-2351), or determining the methylation status of BRACA1 (and other HR- associated genes) (Evers et al. Trends Pharmacol Sci. 2010 Aug;31(8):372-80). In some embodiments, the HR-deficient cancer is resistant to treatment with a poly (ADP-ribose) polymerase (PARP) inhibitor alone (see, for example, Montoni et al. Front Pharmacol. 2013 Feb 27;4:18). In some embodiments, the subject in need of treatment is a subject identified as having a cancer that is resistant to or at risk of developing resistance to PARP inhibitor therapy using methods well known in the art (see, e.g., WO 2014205105, WO 2015040378, WO 2011153345; incorporated herein by reference). In some embodiments, the PARP inhibitor-resistant cancer is deficient in homologous recombination (i.e., the cancer is characterized by a lack of a functional homologous recombination (HR) DNA repair pathway, and is resistant to PARP inhibitor therapy).

As used herein, “anti-cancer therapy” refers to any agent, composition or medical technique (e.g., surgery, radiation treatment, etc.) useful for the treatment of cancer. For example, an anti-cancer agent can be a small molecule, antibody, peptide or antisense compound. Suitable examples of antisense compounds include interfering RNAs (e.g., dsRNA, siRNA, shRNA, miRNA, and amiRNA) and antisense oligonucleotides (ASO).

The terms “inhibition”, “inhibiting”, “inhibit,” or “inhibitor” refer to the ability of a compound to reduce, slow, halt, and/or prevent activity of a particular biological process in a cell relative to vehicle. In some embodiments, “inhibit”, “block”, “suppress” or “prevent” means that the activity being inhibited, blocked, suppressed, or prevented is reduced by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% as compared to the activity of a control (e.g., activity in the absence of the inhibitor. In some embodiments, “inhibit”, “block”, “suppress” or “prevent” means that the activity of the target of the inhibitor (e.g. the ATPase activity of POLQ) is reduced by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100% as compared to a control (e.g., the ATPase activity of POLQ in the absence of the inhibitor).

An “effective amount” refers to an amount sufficient to elicit the desired biological response, i.e., treating cancer. As will be appreciated by those of ordinary skill in this art, the effective amount of the compounds described herein can vary depending on such factors as the desired biological endpoint, the pharmacokinetics of the compound, the condition being treated, the mode of administration, and the age and health of the subject, and the guidance of the treating physician. An effective amount includes that amount necessary to slow, reduce, inhibit, ameliorate or reverse one or more symptoms associated with cancer. For example, in the treatment of cancer, such terms can refer to a reduction in the size of the tumor.

As used in the present application, the term “Cn-m alkyl”, employed alone or in combination with other terms, refers to a saturated hydrocarbon group that can be straight-chain (linear) or branched, having n to m carbons. Suitable examples of alkyl moieties include chemical groups such as methyl, ethyl, «-propyl, isopropyl, «-butyl, tert- butyl, isobutyl, .sec-butyl: higher homologs such as 2-methyl-l -butyl, «-pentyl, 3- pentyl, «-hexyl, 1 ,2,2-trimethylpropyl, and the like. In some embodiments, the alkyl group contains from 1 to 6 carbon atoms, from 1 to 4 carbon atoms, from 1 to 3 carbon atoms, or 1 to 2 carbon atoms.

As used in the present application, “Cn-m alkenyl” refers to an alkyl group having one or more double carbon-carbon bonds and having n to m carbons. Suitable example alkenyl groups include ethenyl, «-propenyl, isopropenyl, «-butenyl, sec- butenyl, and the like. In some embodiments, the alkenyl moiety contains 2 to 6, 2 to 4, or 2 to 3 carbon atoms.

As used herein, “Cn-m alkynyl” means a straight or branched chain chemical group containing only carbon and hydrogen, containing n to m carbon atoms and containing at least one carbon-carbon triple bond, such as ethynyl, 1-propynyl, 1- butynyl, 2-butynyl, and the like. In various embodiments, alkynyl groups can either be unsubstituted or substituted with one or more substituents. Typically, alkynyl groups will comprise 2 to 9 carbon atoms (for example, 2 to 6 carbon atoms, 2 to 4 carbon atoms, or 2 carbon atoms). The term “Cn-m alkynylene” refers to a divalent alkynyl group.

As used in the present application, the term “Cn-m alkoxy”, employed alone or in combination with other terms, refers to a group of formula -O-Cn-m alkyl. Suitable exemplary alkoxy groups include methoxy, ethoxy, propoxy (for example, «-propoxy and isopropoxy), butoxy (for example, «-butoxy and /er/-butoxy), and the like. In some embodiments, the alkoxy group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

As used in the present application, “halo” refers to a halogen atom such as F, Cl, Br, or I. In some embodiments, a halo is F, Cl, or Br. In other embodiments, halo is F, Cl, or I. In other embodiments, halo is F, I, or, Br.

As used in the present application, the term “Cn-mhaloalkyl”, employed alone or in combination with other terms, refers to an alkyl group having from one halogen atom to 2s+l halogen atoms which can be the same or different, where “s” is the number of carbon atoms in the alkyl group, win the present application the alkyl group has n to m carbon atoms. In some embodiments, the haloalkyl group is fluorinated only. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

As used in the present application, “Cn-mhaloalkoxy” refers to a group of formula -O-haloalkyl having n to m carbon atoms. An example haloalkoxy group is OCF3. In some embodiments, the haloalkoxy group is fluorinated only. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms.

The term “aryl,” employed alone or in combination with other terms, refers to an aromatic hydrocarbon group, which can be monocyclic or polycyclic (for example, having 2, 3 or 4 fused rings). The term “C _n -maryl” refers to an aryl group having from n to m ring carbon atoms. Aryl groups include, for example, phenyl, naphthyl, anthracenyl, phenanthrenyl, indanyl, indenyl and the like. In some embodiments, aryl groups have from 6 to about 20 carbon atoms, from 6 to about 15 carbon atoms, or from 6 to about 10 carbon atoms. In some embodiments, the aryl group is phenyl.

As used in, the term “Cn-m aryloxy”, employed alone or in combination with other terms, refers to a group of formula -O-Cn-m aryl. Suitable exemplary aryloxy groups include phenoxy and naphthoxy.

As used herein, the term “Cn-m alkylamino” refers to a group of formula -NH(alkyl), wherein the alkyl group has n to m carbon atoms. In some embodiments, the alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Suitable examples of alkylamino groups include N-methylamino, N-ethylamino, N- propylamino (e.g., N-(«-propyl)amino andN-isopropylamino), N-butylamino (e.g., N- (/i-butyl)amino and N-(/er/-butyl)amino), and the like.

As used herein, the term “di Cn-m alkylamino” refers to a group of formula -N(alkyl)2, wherein each alkyl group independently has n to m carbon atoms. In some embodiments, each alkyl group has 1 to 6, 1 to 4, or 1 to 3 carbon atoms. Suitable examples of dialkylamino groups include N,N-methylehtylamino, N,N- diethylamino, N,N-propylethylamino, N,N-butylisopropylamino, and the like.

EXAMPLES

Materials and methods

Protein purification

A POLQ fragment (APol) containing the ATPase domain with a RAD51 binding site (amino acids 1 to 987) was cloned into pFastBac-C-Flag and purified from baculovirus-infected SF9 insect cells. The POLQ-pFastBac-C-Flag vector was transformed into DHlObac E. coli, and bacteria were plated on an IPTG and X-Gal containing plates and recombinant bacmid DNA was purified using the Qiagen midiprep kit. POLQ bacmid was transfected into the SF9 cells grown in Grace’s Insect Medium (FBS, penstrep, fungizone, and sparfloxacin) using the Cellfectin II reagent. Baculovirus excreted from the cells and the surrounding media were collected after three days (PI). Then, SF9 cells were grown to 90-100% confluence on 15 cm plates. 150 mΐ of PI virus was added to the plate covered with 25 mL Grace’s Insect Medium. The surrounding media containing P2 virus was collected after 3 days. Then, SF9 cells were grown in 1 L spinner flasks at a volume of 500 mL and a density of 1.5-2 million cells/mL. At the concentration of 1.5-2 million cells/mL, 20 mL of P2 virus is added to the 500ml culture. In spinner flask culture Grace’s media were supplemented with Pluronic F68 (thermofisher) to limit shearing. 3 days after infection cells were spun down and frozen with liquid nitrogen. Cells were lysed in 500 mM NaCl lysis buffer (500 mM NaCl, 0.01 % NP40, 0.2 mM EDTA, 20% Glycerol, 1 mM DTT, 0.2 mM PMSF, 20 mM Tris [pH 7.6]) supplemented with Halt protease inhibitor cocktail (Thermo Scientific) and Calpain I inhibitor (Roche). The cell lysis was incubated with M2 Flag beads (Sigma) for 3 hours at 4C on a spinning wheel. The M2 Flag beads were washed 3 times lysis buffer and POLQ protein was then eluted in lysis buffer supplemented with 0.2 mg/ml of Flag peptide (Sigma). The protein was concentrated in lysis buffer using 10 kDa centrifugal filters (Amicon).

The protein was then quantified by staining intensity on Coomassie. Purified protein was flash-frozen in small aliquots in liquid nitrogen and stored at -80°C.

ADP-Glo ATPase assay

ATPase activity of a POLQ (APol) was studied using the ADP-Glo kinase assay (Promega). A 10 mΐ mix containing 10 nM of POLQ-APol protein, 600 nM of 30mer single-stranded DNA substrate, 40 mM Tris-HCl buffer (pH 7.6), 20 mM MgC12, 0.1 mg/ml BSA, and 1 mM DTT was added to each reaction well in a black 384 well plate (Coming). Then, 100 nL of a chemical inhibitor or negative control (DMSO) was added to each well. 3 mΐ of 433.33 mM purified ATP (from ADP-Glo kit) or reagent buffer (No ATP positive control) was then added to each reaction well. DMSO wells represented 0% inhibition while no-ATP wells represented 100% inhibition. Plates were covered with an aluminum seal, stacked, and incubated at room temperature overnight (~16 hours). The plates were stored in a humid, plastic box to decrease evaporation. The following day, 6.5 mΐ of ADP-Glo reagent (from kit) was added to each reaction well to remove unhydrolyzed ATP. After 1 hour incubation, 13 mΐ of Kinase detection reagent was then added to the wells, and plates were incubated for another hour. Finally, ATP hydrolysis was quantified via luminescence values determined by a plate reader.

CellTiter-Glo (CTG) cell viability assay

The CellTiter-Glo luminescent cell viability assay kit (Promega) was used to measure cell viability after drug treatment. The CellTiter-Glo kit determines the number of viable cells in culture based on quantitation of the ATP present, an indicator of metabolically active cells. 500 to 1000 cells per well were seeded in a 96- well plate in 100 pL media volume. 24 hours later, cells were treated with indicated drugs by adding 100 pL medium with 2* concentrated drug of desired final concentration. Cells were cultured in drug containing medium for 6 days, by then cell viability was determined by measuring the luminescent signal, following the manufacturer’s instructions. Survival fraction of drug-treated cells was normalized to DMSO-treated control. Survival, IC50, and statistics were determined by using the GraphPad Prism software.

³² P-based ATPase activity assay

POLQ protein (APol, aa 1-987) was pre-incubated with inhibitors and ssDNA for 30 minutes (min) in reaction buffer (20 mM HEPES-KOH (pH 7.6), 100 mM KC1, 5 mM MgC12, 0.25 pg/pl BSA, 0.05 mM EDTA, 0.5 mM DTT, 3% glycerol, and 0.01% NP-40). The substrate ATP (500 pM cold ATP and 1 pCi of [g- ³² R]-ATR as a tracer) was added to start reactions. The total volume of the reactions was 20 pi. Aliquots (2 pi) of the reactions were removed and immediately dotted to a dry PEI- cellulose plate (Sigma) at indicated time points. The samples were resolved by thin- layer chromatography (TLC) in 4.5% formic acid supplied with 0.5 M lithium chloride. TLC plate was then air-dried and exposed to a phosphor screen for visualization of radioactivity by a Personal Molecular Imager (PMI) System (Bio- Rad). Quantification of the [g- ³² R]-ATR and the released inorganic phosphate ( ³² Pi) was performed using Quantity One software. After background subtraction, the fraction of hydrolyzed ATP was calculated.

Thermal Stability Assays ( TSA )

HEK293T cells overexpressing eGFP-POLQ were lysed in IP buffer (ThermoFisher Scientific, #87788) with PMSF, protease and phosphatase inhibitors. 50 pL of cell lysate was aliquoted to each tube and NVB or DMSO was added. The mixture was incubated for 15 min at room temperature, heated at indicated temperature (37 °C to 55 °C) for 3 min, and then at room temperature again for another 5 min. Next, the mixture was centrifuged at 20,000 g for 15 minutes. The supernatant was taken for Western blot analysis.

GFP reporter-based DNA repair assays

U20S cells containing the DR-GFP (for HR) and EJ-2 (for Alt-EJ) repair substrates were gifts from Dr. Jeremy Stark at Beckman Research Institute of the City of Hope (Bennardo et al, 2008). To measure the repair efficiency, 1*10 ⁵ cells were plated in each well of a 12-well plate. Indicated compounds or DMSO were added to the medium for 24 hours, and cells were infected with Adenoviruses expressing the I- Scel enzyme. Two days after transfection, cells were trypsinized and GFP-positive cells were quantified by flow cytometry (Beckman Coulter).

Cell culture and transfection

Human cells were maintained in culture media (DME-HG/F-12 for WT and knock outs RPEl cells; RMPI for MDA-MB-436; DMEM for U20S) supplemented with 10% FBS and 1% penicillin-streptomycin. Full length POLQ was cloned by Gibson assembly in pCAG-GFP (Plasmid #11150) and co-transfected with Super PiggyBac Transposase Expression Vector (#PB210PA-1, System Biosciences) using Lipofectamine LTX with Plus Reagent in RPE-P53.

RAD51 and yH2AX focus formation assay

2.5 x 10 ⁵ U20S cells were seeded in a 35 mm MatTek dish in the morning of day 1. In the afternoon, NVB was added to the medium at indicated concentrations.

24 hours later, cells were treated with 5 Gy of irradiation. 4 hours after irradiation, cells were extracted and fixed with 1% PFA, 0.5% methanol, and 0.5% TritonX-100 in PBS for 20 min at room temperature on a shaker. Fixed cells were washed with PBS twice and blocked with BTG buffer (1 mg/mL BSA, 0.5% TritonX-100, and 3% of goat serum, 1 mM EDTA) for 1 hour. Cells were then incubated with rabbit Rad51 (D4B10) antibody (Cell Signaling Technology, #8875) and mouse gH2AC antibody (Millipore) in BTG buffer. After wash with PBS three time, cells were incubated with Alexa-488 or Alexa-594 conjugated secondary antibodies (Life Technologies) in BTG buffer for 1 hour. The dishes were washed with BTG buffer once and PBS twice, and mounted with mounting solution with DAPI for immunofluorescence microscopy. Images of random fields were taken under 63x oil lens.

Clonosenic survival assay

Cells were seeded, at 2 different concentrations, into each well of a 6-well plate (100 and 200 cells for WT RPEl; 500 and 1000 cells for HR-deficient cells). Next day, cells were treated with indicated of inhibitors. Cells were allowed to grow in drug-containing medium for 12 to 14 days. Cells were fixed and stained with 0.2% crystal violet in methanol for 30 min (Crystal Violet solution, Sigma HT90132), and rinsed with distilled water three times. The stained dishes were air-dried, and the number of colonies (>50 cells) was counted in each well.

Gene knockouts

BRCA1 and BRCA2 knockouts were generated in RPE-1 cells knockout for TP53 (RPE-P53). TP53 knockout was generated by co-transfection of Cas9 (pSpCas9(BB)-2A-GFP addgene #48138) (PX458) and TP53 sgRNA vectors (gRNA cloning vector Plasmid addgene #41824) by Lipofectamine LTX with Plus Reagent (ThermoFisher). Single colonies were screened by western blotting. RPE1-P53 BRCA2 cells were obtained by co-transfection of Cas9 and two sgRNA vectors targeting introns flanking exon 2 of BRCA2 gene. After subcloning in 96 wells plate, single colonies were screened by PCR. Briefly, DNA was extracted by adding 30 pi of a 50 mM NAOH solution per well after which the plate was put at 95 °C for 10 minutes. Then, 2.5 mΐ of 1M Tris-HCL PH 7.5 was added per well and 2 mΐ of this extracted DNA was used to performed screening PCR (Terra PCR Direct Polymerase, Takara Clontech). Clones were selected for the presence of deletion PCR band and/or absence of 5’ and 3’ junction PCR band. SgRNA sequences are the following (Tp53: GGCAGCTACGGTTTCCGTC; BRCA2-2: GGTAAAACTCAGAAGCGC; BRCA2- 3: GCAACACTGTGACGTACT). PCR primers sequences used for genotyping are the following (Deletion PCR: seqBRCA2-For:

GCT GTATTCC GAAGAC ATGCT GAT GG; seqBRCA2-Rev: TTGTTCCTACTGCTAGTCAAGGG), (5’ Junction PCR: seqBRCA2-For + exon2- Rev: TACCTACGATATTCCTCCAATGCTT), (3’ Junction PCR: seqBRCA2-Rev + exon2-F or: AAGC ATTGGAGGAATATCGTAGGTA).

Laser microirradiation

RPE1-P53 overexpressing eGFP-POLQ were plated in m-Dish 35 mm (Ibidi). The day after, DMSO, Rucaparib (1 mM) or Novobiocin (200 mM) were added on the cells for 24 hours. Microirradiations were performed with two photons laser (800 nm) on an inverted Laser Scanning Confocal Microscope with Spectral Detection and Multi-photon Laser (LSM880NLO/Mai Tai Laser - Zeiss/Spectra Physics) with Airyscan module. Images were then analyzed with Fiji and statistical analysis were performed using Prism7.

Compounds and inhibitors.

PARP inhibitors Olaparib and Rucaparib (Selleckchem) were dissolved in DMSO and kept in small aliquots at -20 °C. Novobiocin (NVB) (Sigma) was dissolved in DMSO snap freeze by addition of liquid nitrogen in one-shot aliquots and stored at -80 °C. The remaining compounds were synthesized by methods known in the art, such as those disclosed in U.S. Patent No. 10,030,006, the contents of which are incorporated herein by reference in their entirety.

Example 1 - exemplified compounds are specific POLQ inhibitors

The effect of the exemplified compounds on the survival of HR-deficient cells was determined (See Figures 1-9). Compound 1 efficiently inhibited PolO ATPase activity, confirming its specificity towards the enzyme. The compounds more effectively killed BRCA1 versus WT RPEl cells in luminescence-based cell viability assays and clonogenic assays. The compounds also more effectively killed BRCA1 -mutated cancer cell lines (MDA-MB-436 and UWB1) than their WT counterparts (MDA-MB-436 + BRCA1 and UWB1 + BRCA1), demonstrating that the compounds create a synthetic lethality with HR. ICso demonstrated that compounds 1, 8, and 9 were 200 times more potent than NVB (a control compound) in killing BRCAl RPEl cells (see Table 1).

Table 1

In addition, compound 1 kills UWB1 (BRCA1 mutated) more efficiently than BRCA1 -complemented UWB1 cells (See Figure 6). Additional results of testing compound 1, including results of ATPase activity assay and clonogenic survival assay in BRCA1-KO PRE cells, are shown in Figures 15-19. IC50 for the selected compounds against WT and BRCA1-KO cells (Retinal pigment cells, RPE1) are shown in Table 2.

Table 2

POLQ inhibition and BRCA1 selectivity data for the exemplified compounds is provided in Table 3.

Table 3

¹ A: POLQ inhibition

² B: selectivity for BRCAl-KO

³ C: client protein degradation (degradation of BRCA1) (Y = compound is an active inhibitor of Hsp90, i.e., the compound is dual inhibitor of Hsp90 and POLQ; N = compound is selective inhibitor of POLQ).

Results of testing compounds 25-27 in WT and BRCA1-KO RPE cells using CTG Glo assay (see Materials and Methods), including IC50 values for compounds 25-27 against these cells, are shown in Figures 20A-21. These results confirm the findings described in the present disclosure that the POLQ inhibitors can selectively kill tumors cells which have a defect in Homologous Recombination Repair, such as cells with a knockout of the BRCA1 gene. Figures 22 and 23 provide results of the cell line confirmation and confirm that BRC A l RPE1 cells are sensitive to NVB and hypersensitive to olaparib.

Anti-proliferative IC50 (mM) for the exemplified compounds for the selected cancer cell types are shown in Table 4.

Table 4

A ¹ : MCF7 B ² : SKBR3 C ³ : HCT-116 D ⁴ : PC-3 E ⁵ : A-549 F ⁶ : MDA1986 G ⁷ : JMAR H ⁸ : B16F10 I ⁹ : SKMEL28 J ¹⁰ : MDAMB468LN K ¹¹ : MDAMB231

Anti-Proliferation Assays: Cells were maintained in a 1 : 1 mixture of advanced DMEM/F12 (Gibco) supplemented with nonessential amino acids, L-glutamine (2 mM), streptomycin (500 pg/mL), penicillin (100 units/mL), and 10% FBS. Cells were grown to confluence in a humidified atmosphere (37 °C, 5% CCh), seeded (2000/well, 100 pL) in 96-well plates, and allowed to attach overnight. Compound or GDA at varying concentrations in DMSO (1% DMSO final concentration) was added.

Western Blot Analyses: MCF-7 cells were cultured as described above and treated with various concentrations of drug, GDA in DMSO (1% DMSO final concentration), or vehicle (DMSO) for 24 h. Cells were harvested in cold PBS and lysed in RIPA lysis buffer containing 1 mM PMSF, 2 mM sodium orthovanadate, and protease inhibitors on ice for 1 h. Lysates were clarified at 14,000 g for 10 min at 4 °C. Protein concentrations were determined by using the Pierce BCA protein assay kit per the manufacturer’s instructions. Equal amounts of protein (20 pg) were electrophoresed under reducing conditions, transferred to a nitrocellulose membrane, and immunoblotted with the corresponding specific antibodies. Membranes were incubated with an appropriate horseradish peroxidase-labeled secondary antibody, developed with a chemiluminescent substrate, and visualized.

Additional assay details are described in Alison C. Donnelly et al, The Design, Synthesis, and Evaluation of Coumarin Ring Derivatives of the Novobiocin Scaffold that Exhibit Antiproliferative Activity, J. Org. Chem., 2008, 73(22), 8901- 8920, which is incorporated herein by reference in its entirety.

Example 2 - Hsp90 activity of exemplified compounds

NVB was reported to function as a HSP90 inhibitor, through direct interaction with the protein (Marcu, et al. (2000). JBiol Chem 275, 37181-37186), although the cellular activity is poor (anti-proliferative IC50 in SKBR3 cells for novobiocin is about 700 mM).

SKBR3 and MCF7 anti-proliferative activities, and western blots of MCF7 lysates for compounds 1, 6, 9, 13, and 16 are shown in figures 10-14. OTHER EMBODIMENTS

It is to be understood that while the present application has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the present application, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.