P132001PC00 Title: Gene therapy for Pompe Disease Field of the invention The invention relates to the field of gene therapy, in particular to gene delivery vehicles and method of gene therapy for treatment of Pompe Disease. Background of the invention Pompe Disease, also known as acid maltase deficiency or glycogen storage disease type II, is an autosomal recessive metabolic disorder. It is caused by an accumulation of glycogen in the lysosome due to a deficiency of the lysosomal acid α-glucosidase enzyme. The build-up of glycogen occurs throughout the body and causes progressive skeletal muscle weakness (myopathy) and affects various body tissues, particularly in skeletal muscles, liver and, in the most severe classic infantile form also the heart and the nervous system. Symptoms arise from muscle weakness and wasting. Classic infantile patients who have complete enzyme deficiency present shortly after birth and become completely quadriplegic within 8 months. The natural course of Pompe’s disease is invalidating by progressive loss of mobility and respiratory function and is lethal for severely affected infants in the first year of life. Older children and adults with residual activity show a more protracted course of disease and may become wheelchair bound, dependent on artificial ventilation and die from respiratory failure ranging from early childhood to late adulthood. In Pompe Disease, the protein α-D-glucoside glucohydrolase or, in short, acid α-glucosidase (GAA, EC 3.2.1.20, also known as acid maltase), which is a lysosomal hydrolase, is defective. The protein is an enzyme that normally degrades the α-1,4 and α-1,6 linkages in glycogen, maltose and isomaltose and is required for the degradation of 1–3% of cellular glycogen. The deficiency of this enzyme results in the accumulation of structurally normal glycogen in lysosomes and cytoplasm in affected individuals. Excessive glycogen storage within lysosomes may interrupt normal functioning of other organelles and lead to cellular injury. A defective acid α-glucosidase protein, or reduced amount or activity of acid α- glucosidase protein, is the result of mutations (or variants) within the Glucosidase, alpha, acid (GAA) gene. The GAA gene is located on the long arm of chromosome 17 at 17q25.2-q25.3 (base pairs 80,101,556 to 80,119,879 in GRCh38.p10). Severe mutations that completely abrogate GAA enzyme activity cause a classic infantile disease course with hypertrophic cardiomyopathy, general skeletal muscle weakness, and respiratory failure and result in death within 1 years of life. Milder mutations leave partial GAA enzyme activity which results in a milder phenotype with onset varying from childhood to adult. In general, a higher residual enzyme activity in primary fibroblasts is associated with later onset of Pompe Disease. Some of the GAA mutations in Pompe Disease patients may lead to alternative splicing and thereby to absent or a reduced amount or activity of α-glucosidase protein. One of the most common mutations in Pompe Disease is the IVS1 mutation, c.-32-13T>G, a transversion (T to G) mutation which occurs among infants, children, juveniles and adults with this disorder (Huie ML, et al., 1994. Hum Mol Genet. 3(12):2231-6). In childhood and adult Pompe Disease, 90% of the patients in the Caucasian population are affected by the common c.32-13T>G (IVS1) variant that results in aberrant splicing of exon 2, such that exon 2 is partially or completely skipped. Absence of exon 2 from the mRNA results in absence of the normal AUG translation start site of the protein, which results in mRNA decay and failure to generate GAA protein. Enzyme replacement therapy (ERT) has been developed for Pompe Disease, in which recombinant human GAA protein is administered intravenously. This treatment is aimed to increase the intracellular level of α-glucosidase activity in affected cells and tissues and thereby reduce or prevent glycogen accumulation and eventually symptoms of the disease. The treatment can rescue the lives of classic infantile patients and delay disease progression of later onset patients, but the effects are heterogeneous. Also, it appears that there is a gradual decrease of the effect of added enzyme, and doses needs to be increased over time to maintain normal glycogen levels. ERT has been used for treatment of infantile (infantile-onset or ‘classic infantile’), childhood (delayed-onset) and adult (late onset) Pompe patients. Targeting exogenous GAA protein to the main target tissues and cells is, however, a challenge. For example 15-40% of the body is composed of skeletal muscle and for the treatment to be effective each individual cell in the body needs to reached and loaded with exogenous GAA protein. In addition, ERT has limitations because it does not pass the blood brain barrier, i.e. due to lack of enzyme penetration into the central nervous system (CNS). The cells must take up the enzyme via endocytosis, which seems most efficient when receptors on the cell surface such as the mannose 6-phosphate/IGFII receptor are targeted. The mannose 6-phosphate/IGFII receptor recognizes various ligands such as mannose 6-phosphate, IGFII and Gluc-NAC. Finally, ERT is limited by immunogenicity against the recombinant GAA enzyme, in particular in cross-reactive immunological material (CRIM)-negative patients suffering from Pompe Disease characterized by a complete absence of GAA enzyme. In addition, ERT requires life-long administration, does not provide cure, is not effective in all patients because it gives an heterogeneous response, and is extremely expensive. For ERT, several attempts have been made with an insulin-like growth factor II (IGFII; also referred to as IGF2) based tag fused to GAA in an expression vector, allowing for improved cellular uptake by targeting the IGFII binding domain of the mannose 6-phosphate/IGFII receptor. In addition, Maga et al. (J Biol Chem. 2013 Jan 18;288(3):1428-38.) describe a fusion protein between IGF2 and GAA amino acids 70-952 for ERT. Modified IGFII, e.g. with a deletion of amino acids 30-40 (IGFIIdel) or containing mutations to remove furin cleavage sites and insulin receptor binding have also been described. For instance, the use of an IGFIIdel tag for GAA is described in WO 2009/137721 in an expression vector with the aim to produce a fusion protein for ERT. Hematopoietic stem cell gene therapy is a promising form of gene therapy. It offers therapeutic efficacy in a wide range of tissues following a single intervention and has recently been approved for the lysosomal storage disorder (LSD) metachromatic leukodystrophy (MLD). Developments are underway for other disorders, including Pompe Disease. Several constructs for hematopoietic stem cell lentiviral gene therapy (HSC-LGT) have been described. WO 2008/136670, Van Til et al. (Blood. 2010 Jul 1;115(26):5329-37) and Wagemaker et al. (Mol Ther Methods Clin Dev.2020 May 4;17:1014-1025) describe lentiviral constructs containing the GAA gene for transducing murine hematopoietic stem cells. Recently, Dogan et al. (https://doi.org/10.1101/2021.12.28.474352) described several constructs for hematopoietic stem cell gene therapy using constructs (see figure S1 of Dogan et la. 2021), among which untagged codon optimized GAA (GAAco) and GAA lacking the signal peptide tagged with several IGFII and modified IGFII tags. However, several questions remain to be answered: First, it is unknown how the IGFII tag with a deletion of aa 30-40 performs in the context of lentiviral gene therapy. It was expected that this version will not pass the blood brain barrier. The reason for this idea is that the present inventors previously found unexpected efficiency of IGFII-tagged GAA in lentiviral gene therapy for treating the central nervous system in mice with Pompe Disease (Liang et al unpublished). The anticipated mechanism is that IGFII has also affinity for the insulin receptor, which in contrast to the mannose 6-phosphate receptor is expressed at the blood brain barrier. The insulin receptor is therefore expected to be responsible for the improved efficacy of IGFII-GAA in treating the brain in lentiviral gene therapy. It is known that deleting aa 30-40 of IGFII removes the insulin receptor binding domain. Hence, it is expected that this epitope tag with a deletion of aa 30-40 will fail to mediate improved treatment of the brain. It is also unknown how the aa30- 40 deletion in the IGFII epitope tag will affect efficacy in other target tissues such as heart and skeletal muscle. Second, in all IGFII tagged GAA versions developed so far, a truncated form of the GAA protein has been used (aa 70-952 of GAA). This has potential consequences for the immunogenic properties as explained hereafter. In ERT, the 110 kD form of GAA is used (corresponding to aa 57-952). This implies that immune tolerance induced by lentiviral gene therapy will only be established against the aa 70-952 GAA product, leaving aa 28-69 potentially unprotected from immune responses induced by subsequently administered ERT. Hence, there remains a need in the art for gene therapy strategies for Pompe Disease which provide improved treatment and reduced immunogenicity. Summary of the invention It is an object of the present invention to overcome one or more problems that are associated with the above described therapies, in particular gene therapies, for treatment of Pompe Disease. It is a further object provide nucleic acid molecules, gene therapy vectors and viral particles for gene therapy of Pompe Disease. In a first aspect, the invention therefore provides a nucleic acid molecule comprising a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human acid alpha glucosidase (GAA) and a human insulin-like growth factor II (IGFII) gene sequence located 5’ of the nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA. In preferred embodiments, the invention provides a nucleic acid molecule comprising a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and encoding amino acids 70-952 of human GAA, and a human IGFII gene sequence located 5’ of the nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and encoding amino acids 70-952 of human GAA. In preferred embodiments, the invention provides a provides a nucleic acid molecule comprising a nucleotide sequence encoding amino acids 28-952 of human acid alpha glucosidase (GAA) and a human insulin-like growth factor II (IGFII) gene sequence located 5’ of the nucleotide sequence encoding amino acids 28-952 of human GAA. In a further aspect, the invention provides a viral particle comprising a nucleic acid molecule according to the invention. In a further aspect, the invention provides a fusion protein encoded by the nucleic acid molecule according to the invention. In a further aspect, the invention provides a fusion protein comprising amino acids 28-952 of human acid alpha glucosidase (GAA), or comprising an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and comprising amino acids 70-952 of human GAA, fused to a human insulin- like growth factor II (IGFII) amino acid sequence, optionally separated by a linking sequence, preferably wherein the human IGFII amino acid sequence is as defined herein. In a further aspect, the invention provides a fusion protein comprising an amino acid sequence having at least 90% sequence identity with amino acids 28- factor II (IGFII) amino acid sequence, optionally separated by a linking sequence, preferably wherein the human IGFII amino acid sequence is as defined herein. In a further aspect, the invention provides a nucleic acid sequence encoding the fusion peptide according to the invention. In a further aspect, the invention provides a cell population, preferably comprising hematopoietic stem cells (HSC), provided with a nucleic acid molecule or viral particle according to the invention. In a further aspect, the invention provides a method for treating Pompe Disease comprising administering the nucleic acid molecule, viral particle, fusion protein or cell population according to the invention to an individual in need thereof. In a further aspect, the invention provides a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention for use in a method for treating Pompe Disease. In a further aspect, the invention provides a use of a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for the treatment of Pompe Disease. In a further aspect, the invention provides a method for central immune tolerance induction in an individual suffering from Pompe Disease, the method comprising administering the nucleic acid molecule, viral particle, fusion protein or cell population according to the invention to said individual. In a further aspect, the invention provides a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention for use in a method for central immune tolerance induction in an individual suffering from Pompe Disease. In a further aspect, the invention provides a use of a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for central immune tolerance induction in an individual suffering from Pompe Disease. In a further aspect, the invention provides a method for preventing or halting loss of IQ in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease, comprising administering the nucleic acid molecule, viral particle, fusion protein or cell population according to the invention to the individual. In a further aspect, the invention provides a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention for use in a method for preventing or halting loss of IQ in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease. In a further aspect, the invention provides a use of a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for preventing or halting loss of IQ in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease. In a further aspect, the invention provides a method for treating brain, peripheral nervous system, smooth muscle and/or hearing defects in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease, comprising administering the nucleic acid molecule, viral particle, fusion protein or cell population according to the invention to the individual. In a further aspect, the invention provides a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention for use in a method for treating brain, peripheral nervous system, smooth muscle, and/or hearing defects in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease. In a further aspect, the invention provides a use of a nucleic acid molecule, viral particle, fusion protein or cell population, in particular HSC, according to the invention in a preparation of a medicament for treating brain, peripheral nervous system, smooth muscle, and/or hearing defects in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease. Detailed description As used herein, "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb “to consist” may be replaced by “to consist essentially of” meaning that a compound or adjunct compound as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention. The articles “a” and “an” are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, “an element” means one element or more than one element. The word “approximately” or “about” when used in association with a numerical value (approximately 10, about 10) preferably means that the value may be the given value of 10 more or less 1% of the value. The use of the alternative (e.g., "or") should be understood to mean either one, both, or any combination thereof of the alternatives. As used herein, a nucleic acid molecule of the invention comprises a chain of nucleotides of any length, preferably DNA and/or RNA. In other embodiments a nucleic acid molecule or nucleic acid sequence of the invention comprises other kinds of nucleic acid structures such as for instance a DNA/RNA helix, peptide nucleic acid (PNA), locked nucleic acid (LNA) and/or a ribozyme. Hence, the term “nucleotide sequence” also encompasses a chain comprising non-natural nucleotides, modified nucleotides and/or non-nucleotide building blocks which exhibit the same function as natural nucleotides. The term nucleic acid molecule includes recombinant and synthetic nucleic acid molecules as well as nucleic acid molecules which are isolated, e.g. in part, from a natural source. In preferred embodiments of the present invention a nucleic acid molecule is DNA or RNA. It may be single stranded or double stranded. A skilled person is well capable of preparing nucleic acid molecules and vector of the invention, for instance using standard molecular cloning techniques as for instance described in Sambrook, J. and Russell, W., Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor (2001), which is incorporated herein by reference. In amino acid sequences as defined or recited herein amino acids are denoted by single-letter symbols. These single-letter symbols and three-letter symbols are well known to the person skilled in the art and have the following meaning: A (Ala) is alanine, C (Cys) is cysteine, D (Asp) is aspartic acid, E (Glu) is glutamic acid, F (Phe) is phenylalanine, G (Gly) is glycine, H (His) is histidine, I (Ile) is isoleucine, K (Lys) is lysine, L (Leu) is leucine, M (Met) is methionine, N (Asn) is asparagine, P (Pro) is proline, Q (Gln) is glutamine, R (Arg) is arginine, S (Ser) is serine, T (Thr) is threonine, V (Val) is valine, W (Trp) is tryptophan, Y (Tyr) is tyrosine. As used herein with respect to an amino acid sequence of a peptide, protein or fusion protein, the terms “N- terminal” and “C-terminal” refer to relative positions in the amino acid sequence toward the N-terminus and the C-terminus, respectively. “N- terminus” and “C-terminus” refer to the extreme amino and carboxyl ends of the polypeptide, respectively. “Immediately N-terminal” and “immediately C-terminal” refers to a position of a first amino acid sequence relative to a second amino acid sequence where the first and second amino acid sequences are covalently bound to provide a contiguous amino acid sequence. The percentage of identity of an amino acid sequence or nucleic acid sequence, or the term “% sequence identity”, is defined herein as the percentage of residues of the full length of an amino acid sequence or nucleic acid sequence that is identical with the residues in a reference amino acid sequence or nucleic acid sequence after aligning the two sequences and introducing gaps, if necessary, to achieve the maximum percent identity. Methods and computer programs for the alignment are well known in the art, for example "Align 2". Programs for determining nucleotide sequence identity are also well known in the art, for example, the BESTFIT, FASTA and GAP programs. These programs are readily utilized with the default parameters recommended by the manufacturer. As used herein, the term “individual” encompasses humans. Preferably, a subject is a human, in particular a human suffering from Pompe Disease. In some embodiments, the individual is a child, e.g. up to 18 years of age. In other embodiments, the individual is an adult, e.g. from 18 year of age. The term "therapeutically effective amount," as used herein, refers to an amount of an agent or composition being administered sufficient to relieve one or more of the symptoms of the disease or condition being treated to some extent. This can be a reduction or alleviation of symptoms, reduction or alleviation of causes of the disease or condition or any other desired therapeutic effect. The term “treatment” refers to inhibiting the disease or condition, i.e., halting or reducing its development or at least one clinical symptom of the disease or disorder, and/or to relieving symptoms of the disease or condition. In some embodiments, treatment may be administered after one or more symptoms have developed. In other embodiments, treatment may be administered in the absence of symptoms. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example to prevent or delay their recurrence. As demonstrated in the Examples herein, the present inventors have obtained very promising results using IGFII epitope tagged GAA cDNA in the mouse. The strategy used was shown to give full correction of glycogen accumulation in heart, skeletal muscles, and brain. In particular, the full correction was obtained at exceptionally low vector copy number (VCN). For clinical use it is important to have an efficacy at a VCN (i.e. the number of lentiviral integrations in the DNA of the transplanted cells) of less than 5 copies per cell/genome. In the examples (see figure 7) it is demonstrated that with a lentiviral vector of the invention VCNs in bone marrow at which full correction of the Pompe Disease phenotype in mice was achieved for the most relevant tissues with low VCN, in particular the VCN is between 2-5, calculated using a standard curve made with 3T3 cells that were transduced with a low dose of lentiviruses (method 1). The standard curve relied on assumptions that the low lentiviral dose was close to a VCN of 1. However, more recent work has more accurately determined vector copy number. To calculate the VCNs using method 2, a lentiviral transfer sequence (pCCL.MND.GAAco) was used as a template to obtain the plasmid standard reference curve with known vector copies per ul of solution. Using primers for the viral sequence PSI and the reference sequence albumin, the copy number of the sample were determined by comparing the CT cycles of the samples to those of the plasmid standard. It was found that using method 2, the obtained VCNs in bone marrow are 4 to 6 times lower than those measured with method 1 (ranging from 0,7 to 2,4), and that these levels are able to completely normalize glycogen levels in skeletal muscle, heart, and brain. With this strategy the present inventors have thus developed a lentiviral vector that is suitable for clinical use. The use of a GAA nucleotide sequence encoding amino acids 28-952 or a sequence having at least 90% identity therewith prevents anti-GAA antibody formation. In particular, the use of the GAA preprotein encoding aa 28-952 in lentiviral gene therapy prevents the formation of anti-GAA antibodies to all forms of GAA, including the full length GAA (FL-GAA), i.e. the GAA preproprotein consisting of amino acids 28-952 as shown in figure 1A, to the active forms of GAA and to potential intermediate forms and by-products. This is essential in order to combine HSC gene therapy with GAA ERT because in ERT, the 110 kD form of GAA is used (corresponding to aa 57-952). As demonstrated in the examples, the present inventors found that treatment with a method according to the present invention results in central immune tolerance to the transgene GAA product as well to recombinant human GAA (ERT). In particular, full central immune tolerance is achieved using the GAA cDNA sequence encoding amino acids 28-952 or a sequence having at least 90% identity thereto, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and encoding amino acids 70-952 of GAA, more in particular encoding amino acids 28-952 of human GAA, comprised within a nucleic acid molecule or vector of the invention, i.e. to all forms of GAA, including the full length GAA, i.e. the GAA preproprotein consisting of amino acids 28-952 as shown in figure 1A, to the active forms of GAA and to potential intermediate forms and by-products. Immune tolerance to the transgene product is crucial to avoid a cytotoxic T cell response that would eliminate transduced HSC from the patient, and/or to avoid antibody formation that could neutralize the activity of the transgene product. Additionally, full immune tolerance is advantageous to combine HSC gene therapy with ERT, in which the 110 kD form of GAA is used (corresponding to aa 57-952) is used, as indicated above. With the central immune tolerances to the transgene product, central immune tolerance to recombinant human GAA is achieved, which is of high importance to allow treatment of patients with ERT with recombinant GAA enzyme following HSC gene therapy without the risk of immune reactions raised to the recombinant human GAA used in ERT, e.g. in patients in which the HSC gene therapy showed insufficient efficacy. Before the present invention, any known gene therapy strategy was associated with this risk because in all (epitope tagged) lentiviral versions of GAA so far, a truncated form of the GAA cDNA has been used (aa 70- 952 of GAA). Immune tolerance induced by previously known lentiviral gene therapy constructs will only be established against the aa 70-952 GAA product, leaving aa 28-69 potentially unprotected from immune responses induced by subsequently administered ERT. The advantage of lentiviral gene therapy with respect to its immune tolerance induction properties would therefore not fully apply to subsequently administered ERT. This could pose a risk for developing anti-GAA antibodies that could neutralize the efficacy of ERT, when combined with previously known lentiviral gene therapy. Central immune tolerance acts via the thymus, which is the organ where T cells are selected and go into apoptosis when they recognize self-antigens. If central immune tolerance is established, it provides lifelong protection against an immunogenic reaction against the antigen. Central immune tolerance contrasts with peripheral immune tolerance. For example, AAV gene therapy directed towards the liver can give peripheral immune tolerance. Peripheral immune tolerance acts via the liver and the formation of regulatory T cells, and which immune tolerance decreases after a certain period of time. As described herein before, before the present invention the IGFII tag has been fused to a truncated form of GAA, namely aa 70-952, applied as ERT or as lentiviral gene therapy. GAA aa 70-952 represents an already partially processed form of GAA. However, in ERT, an aa 57-952 GAA protein is used. This implies that lentiviral gene therapy employing an aa 70-952 GAA transgene will only induce immune tolerance to epitopes within the 70-952 aa GAA protein, but not to epitopes within the aa 57-69 GAA protein. Here the present inventors include an IGFII-GAA aa 28-952 fused gene into a lentiviral vector to achieve central immune tolerance to the complete sequence of GAA, including the transgene product and to ERT. In a first aspect, the invention therefore provides a nucleic acid molecule comprising a nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human acid alpha glucosidase (GAA) and a human insulin-like growth factor II (IGFII) gene sequence located 5’ of the nucleotide sequence encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA. Also provided is a nucleic acid molecule comprising a nucleotide sequence encoding amino acids 28-952 of human acid alpha glucosidase (GAA), or encoding an amino acid sequence having at least 90% sequence identity with amino acids 28- 69 of human GAA and encoding amino acids 70-952 of human GAA, and a human insulin-like growth factor II (IGFII) gene sequence located 5’ of the nucleotide sequence encoding amino acids 28-952 of human GAA, or encoding the amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and encoding amino acids 70-952 of human GAA. Also provided is a nucleic acid molecule comprising a nucleotide sequence encoding amino acids 28-952 of human acid alpha glucosidase (GAA) and a human insulin-like growth factor II (IGFII) gene sequence located 5’ of the nucleotide sequence encoding amino acids 28-952 of human GAA. The human GAA amino acid sequence encoded by the human GAA gene is shown in figure 1A. This sequence contains a signal peptide (amino acids 1-27) and a 110 kD preproprotein (amino acids 57-952) which is proteolytically further processed to generate multiple intermediate forms and the mature, active 76 kD and 70 kD forms of the GAA enzyme. The human GAA cDNA sequence, including the sequence encoding the signal peptide and the sequence encoding the preproprotein, is shown in figure 1B. A nucleic acid molecule of the invention comprises a nucleotide sequence encoding amino acids 28-952 of human GAA, or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and encoding amino acids 70-952 of GAA, more in particular encoding amino acids 28-952 of human GAA. This means that amino acids 1-27, the GAA signal peptide, are lacking. Nucleotides encoding one or more of the amino acids 1-27 of GAA as depicted in figure 1A are thus lacking in the nucleic acid molecule of the invention. Hence, a nucleotide sequence encoding amino acids 1-27 of GAA as depicted in figure 1A is lacking. Preferably, a nucleotide sequence encoding amino acids 1-27 of GAA as depicted in figure 1A or any part thereof encoding at least 15 consecutive amino acids is absent in a nucleic acid molecule of the invention. Said amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, preferably comprises 90% sequence identity with at least amino acids 28-69 of human GAA as shown in figure 1A. In preferred embodiments, a nucleic acid molecule of the invention comprises a nucleotide sequence encoding amino acids 28-952 of human GAA, or an amino acid sequence having at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, sequence identity with amino acids 28-952 of human GAA, or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA. In preferred embodiments, the variation in amino acid sequence is only in amino acids 28-69. I.e. in preferred embodiments, the nucleic acid molecule encodes an amino acid sequence having at least 90%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, sequence identity with amino acids 28-69 of human GAA and encodes amino acids 70-952 of human GAA. In one preferred embodiment, the nucleotide sequence encoding amino acids 28-952 of GAA comprises or consists of nucleotides 239-3013 of the human GAA cDNA as shown in figure 1B. However, the GAA nucleotide sequence may also be a codon-optimized sequence of the wild-type GAA amino acid sequence. Hence, in other preferred embodiments, the nucleotide sequence encoding amino acids 28-952 of GAA comprises or consists of a codon-optimized sequence of nucleotides 239-3013 of the human GAA cDNA as shown in figure 1B. Codon optimization of nucleotide sequences encoding proteins is a well-known and commonly used technique in the art and a skilled person is well capable of preparing and selecting suitable codon optimized sequences. Suitable codon optimized GAA nucleotide sequences is described in Stok et al., 2020 (Molecular Therapy - Methods & Clinical Development 17: 1014-1025). A nucleic acid molecule of the invention comprises a human insulin-like growth factor II (IGFII) gene sequence. Figure 2 shows the sequence of human mature IGFII, including its signal peptide. IGFII is synthesized as a pro-protein containing 180 amino acids which is processed ultimately into a 67-amino acid bioactive IGFII protein, which is referred to as mature IGFII. Firstly, a signal peptide of 24 amino acids is removed from the N terminus, generating pro-IGFII (156 amino acids), followed by cleavage of pro-IGFII into a 104-amino acid protein product [IGFII(1-104)]. Subsequent endoproteolyzation generates IGFII(1-87) and the mature IGFII protein consisting of 67 amino acids. In preferred embodiments, the IGFII gene sequence comprises a nucleotide sequence encoding the human IGFII signal peptide, indicated as amino acids -24 to -1 in figure 2 (MGIPMGKSMLVLLTFLAFASCCIA), or a sequence having at least 90% sequence identity therewith. Preferably, the IGFII gene sequence comprises a nucleotide sequence encoding the human IGFII signal peptide, indicated as amino acids -24 to -1 in figure 2. In further preferred embodiments, the IGFII gene sequence encodes an amino acid sequence which has at least 70% sequence identity with human, mature IGFII, the sequence of which is shown in figure 2, and the human IGFII signal peptide (amino acids -24 to -1), or a sequence having at least 90% sequence identity therewith. In preferred embodiments, the IGFII gene sequence encodes an amino acid sequence which has at least 75% sequence identity with human mature IGFII and the human IGFII signal peptide (amino acids -24 to -1), or a sequence having at least 90% sequence identity therewith. In some embodiments, the IGFII gene sequence encodes an amino acid sequence which has at least 80% sequence identity with human mature IGFII and the human IGFII signal peptide (amino acids -24 to -1), or a sequence having at least 90% sequence identity therewith. In other preferred embodiments, the IGFII gene sequence encodes an amino acid sequence which has at least 83% sequence identity with human mature IGFII and the human IGFII signal peptide (amino acids -24 to -1), more preferably at least 85% sequence identity, more preferably at least 89% sequence identity with human mature IGFII and the human IGFII signal peptide (amino acids -24 to -1), or a sequence having at least 90% sequence identity therewith. In some preferred embodiments, the IGFII gene sequence comprises a nucleotide sequence encoding the IGFII signal peptide and amino acids 1 and 8-67 of IGFII, as shown in figure 2. In some embodiments, the IGFII gene sequence comprises a nucleotide sequence encoding the IGFII signal peptide and amino acids 1-67 of IGFII, as shown in figure 2. In other preferred embodiments, the IGFII sequence encodes an IGFII amino acid sequence which has a mutation that reduces binding affinity for the insulin receptor as compared to the wild-type human IGF- II. In some preferred embodiments, the human IGFII gene sequence comprises a mutation within the nucleotide region encoding amino acids 30-40 of IGFII, preferably a deletion within the nucleotide region encoding amino acids 30-40 of IGFII. This region of the IGFII sequence comprises the insulin receptor binding domain. Hence, the IGFII sequence preferably is mutated such that binding of the fusion protein to the insulin receptor is reduced with at least 50% or abolished. In preferred embodiments, the IGFII gene sequence comprises a deletion of the nucleotides encoding at least amino acids 30-40, 31-40, 32-40, 33-40, 34-40, 35-40, 36-40, 37-40, 30-39, 31-39, 32-39, 33-39, 34-39, 35-39, 36-39, 30-38, 31-38, 32-38, 33-38, 34-38, 35-38, 36-38, 30-37, 31-37, 32-37, 33-37, 34-37, 35-37, 30-36, 31-36, 32-36, 33-36, 34-36, 30-35, 31-35, 32-35, 33-35, 30-34, 31-34, 30-34, 30-33, 31-33 or 30-32 of human mature IGFII as shown in figure 2. In preferred embodiments, the IGFII gene sequence comprises a deletion of the nucleotides encoding amino acids 30-40 of human mature IGFII. Hence, in preferred embodiments, the IGFII gene sequence comprises a nucleotide sequence encoding the human IGFII signal peptide consisting of amino acids -24 to -1 and encoding amino acids 1, 8-29 and 41- 67 of mature IGFII, as shown in figure 2. Further suitable IGFII mutants with reduced insulin receptor binding are described in WO 2009/137721, which is incorporated herein by reference. In some preferred embodiments, the IGFII gene sequence consists of a nucleotide sequence encoding the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1 and 8-67 of IGFII, as shown in figure 2. In some preferred embodiments, the IGFII gene sequence consists of a nucleotide sequence encoding the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1 and 8-29 and 41-67 of mature IGFII, as shown in figure 2. The use of a vector comprising such IGFII sequence with a deletion of or within the nucleotide sequence encoding the insulin binding receptor, preferably leaves binding to the IGFII/mannose 6 phosphate receptor (IGFIIR/M6PR) intact. As demonstrated in the examples, the present inventors show that effectivity of treatment while using such IGFII sequence comprising a deletion within the nucleotide sequence encoding the insulin receptor binding domain (“IGF2del.GAAco” construct) results in a higher efficacy in skeletal muscle as compared to the use of a vector comprising an IGFII sequence with intact insulin receptor binding domain. As demonstrated in figure 7, IGF2del.GAAco (construct 3) was more efficient compared to IGF2.GAAco in clearing glycogen content in tibialis anterior and quadriceps femoris. The examples herein further show that with a vector comprising such IGFII sequence with a deletion of or within the nucleotide sequence encoding the insulin binding receptor efficacy in the brain is also achieved. This is surprising, as the insulin receptor was believed to be important for crossing the blood brain barrier, as the insulin receptor is expressed at the blood brain barrier, while M6P/IGFIIR is not. It was therefore believed that, use of a vector comprising an IGFII gene sequence with a deletion of or within the nucleotide sequence encoding the insulin binding receptor domain would not be efficacious in the brain, similarly as untagged GAA. However, despite this absence of insulin receptor binding properties of the IGFIIdeletion-GAA fusion protein, efficacy in improvement of glycogen levels in the brain was achieved. The fact that it still works in the brain is therefore surprising and points to another mechanism than anticipated. In addition, it was found that the IGFII gene sequence with a deletion of or within the nucleotide sequence encoding the insulin binding receptor domain improved safety with respect to glucose metabolism, which is of clinical relevance. The IGFII gene sequence is located 5’ of the nucleotide sequence encoding amino acids 28-952 of human GAA or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28- 69 of GAA and encoding amino acids 70-952 of GAA, more in particular encoding amino acids 28-952 of human GAA, in a nucleic acid molecule or vector of the invention, specifically a gene therapy vector, more specifically a lentiviral gene therapy vector. Expression of nucleic acid sequences of the invention results in a fusion protein comprising a human IGFII epitope tag and a human GAA amino acid sequence, in particular of amino acids 28-952 of human acid alpha glucosidase (GAA), or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and an amino acid sequence comprising amino acids 70-952 of GAA, more in particular amino acids 28-952 of human GAA. With the 5’ orientation of the IGFII gene sequence a fusion protein is expressed wherein the IGFII epitope tag is attached N-terminally to the GAA sequence, optionally with a linking sequence between the IGFII epitope tag and the GAA sequence. In preferred embodiments, a nucleic acid molecule of the invention comprises a linking sequence located between the human IGFII gene sequence and the nucleotide sequence encoding amino acids 28-952 of human acid alpha glucosidase (GAA), or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and encoding amino acids 70-952 of human GAA, more in particular encoding amino acids 28-952 of human GAA. In preferred embodiments, the linking sequence is a nucleotide sequence that encodes an amino acid sequence of 2 – 20 amino acids, preferably of 2 – 10 amino acids, more preferably of 2 – 5 amino acids, such as 2, 3 or 4 amino acids. In preferred embodiments, the linking sequence is a nucleotide sequence that encodes an amino acid sequence of 3 amino acids. A preferred, but non- limiting linking sequence is a nucleotide sequence that encodes the amino acid sequence GAP. A nucleic acid molecule of the invention may further comprise one or more regulatory sequences to direct expression of a nucleotide sequence, including a promoter, an enhancer, a transcription termination signal, a polyadenylation sequence. In preferred embodiments a nucleic acid molecule of the invention comprises a promoter operably linked to the human IGFII gene sequence and nucleotides 28- 952 of human GAA, or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and encoding amino acids 70-952 of GAA, more in particular encoding amino acids 28-952 of human GAA. A used herein “operably linked” means that a nucleotide sequence is functionally associated with one or more other nucleotide sequences. For instance, the promoter nucleotide sequence is functionally associated with the human IGFII gene sequence and nucleotides 28-952 of human GAA, or an amino acid sequence having at least 90% sequence identity therewith, in particular encoding an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and encoding amino acids 70-952 of GAA, more in particular encoding amino acids 28-952 of human GAA, such that the promoter sequence influences or directs the expression of the other nucleotide sequences. Various promoters, including inducible promoters, may be used to direct expression of nucleotide sequences included in a nucleic acid molecule of the invention, including viral promoter. Suitable promoters include a SV40 promoter, a Rous Sarcoma Virus (RSV) promoter, a cytomegalovirus (CMV) promoter and a MND promoter or derivatives of any of these promoters. In the case of Pompe Disease glycogen accumulation and symptoms in several organs need to be corrected (heart, skeletal and smooth muscle, peripheral nervous system and brain) and the peripheral nervous system (see below). Therefore, in preferred embodiments the promoter is a ubiquitous promoter rather than a cell type specific promoter. In preferred embodiments the promoter is an MND promoter or derivatives thereof, such as the MND promoter with a 174bp deletion at the 5’ end. MND promoter is described in Robbins et al (Proc. Natl. Acad. Sci. USA 1994, Vol. 95, pp.10182–10187) and Astrakhan et al (Blood.2012; 119(19): 4395–4407), which are incorporated herein by reference. In preferred embodiments, a nucleic acid molecule of the invention is or is part of a vector. In preferred embodiments, the nucleic acid molecule of the invention is a gene therapy vector. Also provided by the invention is therefore a vector, preferably a gene therapy vector comprising a nucleic acid molecule of the invention. The gene therapy vector is preferably a vector that is suitable for ex vivo transduction of haematopoietic stem cells. The vector can be a viral or non-viral vector. Non-limiting examples of suitable expression vectors include retroviral, adenoviral, adeno-associated and herpes simplex viral vectors, non-viral vectors and engineered vectors. The vector, in particular gene therapy vector, preferably is a viral vector. Said viral vector preferably is a recombinant adeno-associated viral vector, a herpes simplex virus-based vector, or a lentivirus-based vector such as a human immunodeficiency virus-based vector. Said viral vector further preferably is a retroviral-based vector such as a lentivirus-based vector such as a human immunodeficiency virus-based vector, or a gamma-retrovirus-based vector. Retroviruses can be packaged in a suitable complementing cell that provides Group Antigens polyprotein (Gag)-Polymerase (Pol) and/or Envelop (Env) proteins. Suitable packaging cells are human embryonic kidney derived 293T or 293 cells, Phoenix cells (Swift et al., 2001. Curr Protoc Immunol, Chapter 10: Unit 1017C), PG13 cells (Loew et al., 2010. Gene Therapy 17: 272–280) and Flp293A cells (Schucht et al., 2006. Mol Ther 14: 285-92). Methods for the generation of such non- viral expression vectors are well known in the art. Non-viral expression vectors include nude DNA, and nucleic acids packaged into synthetic or engineered compositions such as liposomes, polymers, nanoparticles and molecular conjugates. Methods for the generation of such non- viral expression vectors are well known in the art. As an alternative, a nucleic acid molecule used in accordance with the invention may be provided to a subject by gene editing technology, including CRISPR/Cas, zinc-finger nucleases, and transcription activator-like effector nucleases-TALEN, in order to insert the receptor transgenes into specific loci with or without an exogenous promoter. Preferred genomic loci include the AAVS1 locus and the PD-1 locus, as is known to a skilled person. In preferred embodiments the vector, in particular gene therapy vector is a lentiviral vector. In particularly preferred embodiments, the nucleic acid molecule or vector of the invention is a gene delivery vehicle of lentiviral origin. Typically, the term “gene delivery vehicle of lentiviral origin” refers to a gene delivery of any lentiviral origin. Gene delivery vehicles of lentiviral origin are all vehicles comprising genetic material and/or proteinaceous material derived from lentiviruses. Typically the most important features of such vehicles are the integration of their genetic material into the genome of a target cell and their capability to transduce stem cells. These elements are deemed essential in a functional manner, meaning that the sequences need not be identical to lentiviral sequences as long as the essential functions are present. The methods of the invention are however especially suitable for recombinant lentiviral particles, which have most if not all of the replication and reproduction features of a lentivirus, typically in combination with a producer cell having some complementing elements. Normally the lentiviral particles making up the gene delivery vehicle are replication defective on their own. In a preferred embodiment, the used “gene delivery vehicle of lentiviral origin” is a “gene delivery vehicle of HIV lentiviral origin” and even more preferred are HIV-1 derived self-inactivating lentiviral vectors. The invention also provides a viral particle comprising a nucleic acid molecule according to the invention, preferably a lentiviral particle. Methods and means (such as producer cells) for producing the desired lentiviral particles are well known in the art. Examples of preferred producer cells are 293T cells that are co-transfected with VSV-G (Vesicular stomatitis virus- G- protein envelope). Other pseudotypes used in this setting are RD114 (Feline- immunodeficiency virus). In preferred embodiments of the invention, a nucleic acid molecule or vector of the invention is for use in transducing cells, in particular HSC, preferably ex vivo transducing cells, in particular HSC. In one aspect, the invention therefore provides a method for transducing hematopoietic stem cells (HSC) with, a nucleic acid molecule or vector, preferably a gene delivery vehicle of lentiviral origin, according to the invention comprising contacting HSC with said with a relatively low amount of transducing units per cell of said gene delivery vehicle, In preferred embodiments, said HSC are human, more preferably isolated from an individual suffering from Pompe Disease. As used herein, the term “transduction” refers to the stable transfer of genetic material from a viral particle to a hematopoietic stem cell genome. Hematopoietic stem cells (HSC) are stem cells and the early precursor cells which give rise to all the blood cell types that include both the myeloid (monocytes and macrophages, neutrophils, basophils, eosinophils, erythrocytes, megakaryocytes/platelets and some dendritic cells) and lymphoid lineages (T-cells, B-cells, NK-cells, some dendritic cells). The hematopoietic tissue has cells with long term and short term regeneration capacities and committed multipotent, oligopotent and unipotent progenitors. HSC can be obtained from different sources and are, for example, found in the bone marrow of humans, which includes femurs, hip, ribs, sternum, and other bones. Cells can be obtained directly by removal from the hip using a needle and syringe, or from the blood following pre-treatment with cytokines, such as G-CSF (granulocyte colony stimulating factor), that induces cells to be released from the bone marrow compartment into the blood (mobilized peripheral blood). In preferred embodiments, autologous HSC are transduced with a nucleic acid molecule or vector of the invention. In such embodiments, HSC are preferably isolated from an individual suffering from Pompe Disease, in particular the individual suffering from Pompe Disease to be treated, transduced with a nucleic acid molecule or vector of the invention ex vivo. After transducing, the transduced HSC are preferably returned to the individual. The invention also includes compositions obtainable by the methods of the invention. Thus included are compositions comprising HSC transduced with a nucleic acid molecule or vector, preferably a gene delivery vehicle of lentiviral origin, of the invention. The invention further provides a composition comprising a viral particle, preferably, lentiviral particles, transduced with a nucleic acid molecule or vector of the invention. Preferable, said lentiviral particles are gene delivery vehicles and capable of transducing HSC and/or progenitor cells. The invention further provides a cell population comprising hematopoietic stem cells (HSC) provided with a nucleic acid molecule, vector or viral particle according to the invention. In preferred embodiments, the cell population or HSC is/are transduced with a nucleic acid molecule, vector or viral particle according to the invention. The cell population or HSC is/are further preferably capable of expression a fusion protein comprising a human IGFII protein and amino acids 28- 952 of human GAA, or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, in particular an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of GAA and an amino acid sequence comprising amino acids 70-952 of GAA, more in particular amino acids 28-952 of human GAA. Said human IGFII protein preferably comprises an amino acid sequence which has at least 75% sequence identity with human IGFII, more preferably at least 80% sequence identity with human IGFII, as shown in figure 2. In other preferred embodiments, the IGFII gene sequence encodes an amino acid sequence which has at least 83% sequence identity with human IGFII, more preferably at least 85% sequence identity, more preferably at least 90% sequence identity, more preferably at least 95% sequence identity with human IGFII, as shown in figure 2. A composition or HSC according to, or used in accordance with, the invention can be administered to an individual by a variety of routes, preferably by parenteral administration. Parenteral administration can include, for example, intraarticular, intramuscular, intravenous, intraventricular, intraarterial or intrathecal administration. In preferred embodiments, a composition or HSC of the invention may be administered to an individual via infusion or injection, in particular in hospital via infusion or via injection by a healthcare professional. Compositions of the invention preferably comprise at least one pharmaceutically acceptable carrier, diluent and/or excipient. By "pharmaceutically acceptable" it is meant that the carrier, diluent or excipient must be compatible with the other ingredients of the composition and preferably not deleterious, e.g. toxic, to the recipient thereof. In general, any pharmaceutically suitable additive which does not interfere with the function of the active compounds can be used. A composition including the at least one pharmaceutically acceptable carrier, diluent and/or excipient according to the invention is preferably suitable for human use. A composition or HSC for intravenous administration may for example be aqueous or non-aqueous sterile solutions of the HSC of the invention, for instance solutions in sterile isotonic aqueous buffer. Where necessary, the intravenous compositions may include for instance one or more buffers, solubilizing agents, stabilizing agents and/or a local anesthetic to ease the pain at the site of the injection. Expression of nucleic acid sequences of the invention results in a fusion protein comprising a human IGFII amino acid sequence and a human GAA amino acid sequence, in particular of amino acids 28-952 of human acid alpha glucosidase (GAA), or an amino acid sequence having at least 90% sequence identity with amino acids 28-952 of human GAA, preferably an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and an amino acid sequence comprising amino acids 70-952 of human GAA, more preferably amino acids 28-952 of human GAA. Also provided is therefore a fusion protein encoded by the nucleic acid molecule according to the invention. Further provided is a fusion protein comprising amino acids 28-952 of human GAA, or an amino acid sequence having at least 90% sequence identity with amino acids 28-69 of human GAA and an amino acid sequence comprising amino acids 70- 952 of human GAA, fused to a human IGFII amino acid sequence, optionally separated by a linking sequence. In preferred embodiments, the fusion protein comprises amino acids 28-952 of human GAA. In further preferred embodiments, the human IGFII amino acid sequence in a fusion protein of the invention is an amino acid sequence encoded by the IGFII gene sequence as defined herein above. In preferred embodiments, the human IGFII amino acid sequence comprises the human IGFII signal peptide (amino acids -24 to -1 in figure 2: MGIPMGKSMLVLLTFLAFASCCIA). In preferred embodiments, the human IGFII amino acid sequence comprises the human IGFII signal peptide and an amino acid sequence which has at least 70% sequence identity with human, mature IGFII. In further preferred embodiments, the IGFII amino acid sequence comprises the human IGFII signal peptide and amino acids 1 and 8-67 of human IGFII, as shown in figure 2. In further preferred embodiments, the IGFII amino acid sequence comprises the IGFII signal peptide and amino acids 1 and 8-67 of IGFII, as shown in figure 2. In further embodiments, the IGFII amino acid sequence comprises the IGFII signal peptide and amino acids 1-67 of IGFII, as shown in figure 2. In further preferred embodiments, the IGFII amino acid sequence comprises the IGFII signal peptide and human mature IGFII comprising a mutation within amino acids 30-40 of IGFII, preferably a deletion within amino acids 30-40 of IGFII. In further preferred embodiments, the IGFII amino acid sequence comprises the IGFII signal peptide and human mature IGFII comprising a deletion of amino acids 30-40, 31-40, 32-40, 33-40, 34-40, 35-40, 36-40, 37-40, 30-39, 31-39, 32-39, 33- 39, 34-39, 35-39, 36-39, 30-38, 31-38, 32-38, 33-38, 34-38, 35-38, 36-38, 30-37, 31- 37, 32-37, 33-37, 34-37, 35-37, 30-36, 31-36, 32-36, 33-36, 34-36, 30-35, 31-35, 32- 35, 33-35, 30-34, 31-34, 30-34, 30-33, 31-33 or 30-32 of human IGFII as shown in figure 2. In preferred embodiments, the IGFII amino acid sequence comprises a deletion of amino acids 30-40 of IGFII. Hence, in preferred embodiments, the IGFII amino acid sequence comprises the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1, 8-29 and 41-67 of mature IGFII, as shown in figure 2. Further suitable IGFII mutants with reduced insulin receptor binding are described in WO 2009/137721, which is incorporated herein by reference. In some preferred embodiments, the IGFII amino acid sequence consists of the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1 and 8-67 of IGFII, as shown in figure 2. In some preferred embodiments, the IGFII amino acid sequence consists of the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1 and 8-29 and 41-67 of mature IGFII, as shown in figure 2. The fusion protein preferably comprises a linking sequence as defined herein between the IGFII amino acid sequence and the GAA amino acid sequence. The linking sequence preferably consists of 2-10 amino acids, more preferably of 2-5 amino acids, such as 2, 3 or 4 amino acids. In preferred embodiments, the linking sequence is an amino acid sequence of 3 amino acids. A preferred, but non-limiting linking sequence is the amino acid sequence GAP. Also provided is a nucleic acid sequence encoding the fusion peptide according to the invention. After transplantation of HSC transduced with a nucleic acid molecule of the invention the cells express the fusion protein in vivo. This fusion protein contain an IGFII-tagged GAA preproprotein, contrary to known IGFII-tagged GAA fusion proteins expressed after HSC transduction and transplantation. As demonstrated in the Examples herein, the present inventors have demonstrated that HEK293T cells stably transduced with a nucleic acid molecule of the invention were capable of expressing the preproprotein and processing it to the active 76 kDa form of the GAA protein (see Figure 5 A and B). It was further demonstrated that GAA ^-/- myotubes provided with conditioned medium containing the IGFII.FL-GAAco protein show uptake and activity of the protein (Figures 5 C-E). The present invention for the first time show that it is possible to direct expression of the full length GAA preproprotein (aa 28-952) using the IGFII signal peptide. This is surprising, because epitope tagging of proteins is known in the art for their ability to interfere with the function of these proteins. This is especially the case when important functions of the protein are located at the N-or C-termini, as is the case with the nucleic acid molecules and vectors of the present invention. In the case of the GAA protein, the following functions needed to be preserved in the epitope tagged version: 1) cellular secretion, 2) intracellular processing, 3) glycogen hydrolysing activity. So far, IGFII tagging of GAA has only been tested for an already partially processed GAA protein, which is the aa70-952 GAA protein. In the present invention, it is shown that the full length GAA protein can successfully be epitope tagged with the IGFII tag at the C terminus. This was a priory not obvious, for example see Figure 8, wherein it is shown that epitope tagging using an ApoE2 tag with full length GAA preproprotein (aa 28-952) and a signal peptide of either IGFII or GAA did not result in active GAA protein in the cells or secreted active GAA protein. Before the present invention it was unknown whether or not this combination of nucleotide sequences included in a gene therapy vector results in correct mRNA and protein expression, secretion, and intracellular processing into the 95kD intermediate form (i.e. the GAA preproprotein) and the 76kD and 70kD active forms of GAA in vivo. This requires, inter alia, proteolytically processing of the fusion protein to generate the active form of the GAA enzyme. The present inventors have shown for the first time that this processing is correctly executed if the preproprotein is coupled to an IGFII tag. The invention also provides uses of the nucleic acid molecules, vectors, fusion proteins, compositions and cell populations, in particular HSC populations, particularly in the treatment of Pompe Disease. In one aspect, the invention therefore provides a method for treating Pompe Disease comprising administering a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention to an individual in need thereof. Also provided is a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention for use in a method for treating Pompe Disease. Also provided is the use of a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for the treatment of Pompe Disease. Typically the use of a composition comprising lentiviral particles involves the transduction of HSC such as bone marrow cells, umbilical cord blood cells or mobilized peripheral blood stem cells. Such transduced cells are preferably prepared ex vivo and are also part of the present invention. Thus the invention provides a composition for the treatment of Pompe Disease, comprising a plurality HSC transduced with a composition of lentiviral vector or particles according to the invention. In yet another embodiment, the invention provides the use of a composition as described above in the preparation of a medicament for the treatment of a Pompe Disease. In one aspect, the invention provides a method for treating Pompe Disease comprising administering the cell population comprising a cell population, in particular HSC, according to the invention to an individual in need thereof. Also provided is a method for treating Pompe Disease comprising administering to an individual in need thereof a cell population, in particular HSC, that are transduced ex vivo with a nucleic acid molecule, a vector or viral particles, preferably a lentiviral vector or lentiviral particles, according to the invention. Also provided is a cell population, preferably HSC, transduced with a nucleic acid molecule or vector according to the invention for use in a method for the treatment of Pompe Disease in an individual. In preferred embodiments, the cells, in particular HSC, have been isolated from the individual and have been transduced ex vivo with a nucleic acid molecule or vector of the invention. I.e. in preferred embodiments individuals are treated with autologous transduced HSC. Hence, in preferred embodiments, a method of treatment of the invention comprises removing HSC from the individual, providing said HSC with a nucleic acid molecule, vector or viral particle according to the invention, preferably lentiviral vector or lentiviral particles, and administering said HSC provided with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. In preferred embodiments, a method or use comprises transducing said HSC with the nucleic acid molecule, vector or viral particle according to the invention, preferably a lentiviral vector or lentiviral particles, and administering said HSC transduced with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. However, allogenic HSC may also be used in the methods and uses of the invention. As described herein above, the present inventors found that with the method and uses of the invention central immune tolerance for GAA is achieved. Central immune tolerance against GAA, in particular full central immune tolerance to all forms of GAA, is in particular important for Pompe Disease patients who are characterized by a complete lack of GAA enzyme activity. In particular Pompe Disease patients suffering from classic infantile Pompe Disease are characterized by a complete lack of GAA enzyme activity. Pompe Disease patients who still have some residual GAA protein production and activity are indicated as cross-reactive immunological material (CRIM)-positive while those patients with a total absence of that protein are indicated as CRIM negative. Hence, in some preferred embodiments the individual is an individual suffering from classic infantile Pompe Disease. In other preferred embodiments the individual is an individual suffering from cross-reactive immunological material (CRIM)-negative classic infantile Pompe Disease. Also provided is a method for central immune tolerance induction in an individual suffering from Pompe Disease, the method comprising administering a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention to said individual. Also provided is a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention for use in a method for central immune tolerance induction in an individual suffering from Pompe Disease. Also provided is a use of a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for central immune tolerance induction in an individual suffering from Pompe Disease. As described herein above, the present inventors have surprisingly found that the use of an IGFII sequence which has a mutation that reduces binding affinity for the insulin receptor as compared to the wild-type human mature IGF-II results in a higher efficacy in skeletal muscle as compared to the use of a vector comprising an IGFII sequence with intact insulin receptor binding domain. At the same time, efficacy in brain and heart was maintained, although not to the same extent, lower with such IGFII sequence which has a mutation that reduces binding affinity for the insulin receptor as compared to the wild-type human mature IGF- II. Hence, the nucleic acid molecules, constructs, vectors, fusion proteins and cell populations, in particular HSC, that include an IGFII sequence with such mutation is in particular suitable for Pompe Disease patients that do not suffer from brain and/or heart pathology. These are Pompe Disease patients that have some residual GAA enzyme activity. Such patients are further characterized by the absence of a hypertrophic cardiomyopathy. Classic infantile patients do have a hypertrophic cardiomyopathy, and therefore all other patients are labelled non-classic infantile. Hence, patients that have residual GAA enzyme activity are in particular patients suffering from non-classic infantile Pompe Disease. Hence, in preferred embodiments, a method is provided for the treatment of an individual suffering from Pompe Disease who has residual GAA enzyme activity, in particular an individual suffering from non-classic infantile Pompe Disease, comprising administering a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention to an individual, wherein said nucleic acid molecule is a nucleic acid molecule according to the invention wherein the IGFII gene sequence comprises a mutation within the nucleotide region encoding amino acids 30-40 of IGFII, preferably comprises a deletion within the nucleotide region encoding amino acids 30-40 of IGFII, said fusion protein encoded by said nucleic acid molecule or said cell population, in particular HSC, is provided with said nucleic acid molecule. In preferred embodiments, the IGFII gene sequence comprises a deletion of the nucleotides encoding amino acids 30-40 of IGFII. In further preferred embodiments, the IGFII gene sequence consists of a nucleotide sequence encoding the human IGFII signal peptide consisting of amino acids -24 to -1 and amino acids 1, 8-29 and 41-67 of IGFII, as shown in figure 2. As described herein above, the use of the GAA sequence encoding amino acids 28-952 in accordance with the present invention prevents the formation of anti- GAA antibodies to all forms of GAA, including the full length GAA, i.e. the GAA preproprotein consisting of amino acids 28-952, to the active forms of GAA and to potential intermediate forms and by-products. The methods and uses of the invention are therefor particularly suitable for treatment of patients that are known to develop anti-GAA antibodies. Classic infantile Pompe Disease patients and/or CRIM-negative patients are characterized by the absence of GAA protein and are known to develop high antibody titers to ERT that renders the treatment ineffective. Hence, in preferred embodiments of any method or use of the invention, the individual that is treated is an individual suffering from classic infantile Pompe Disease and/or an individual suffering from CRIM-negative classic infantile Pompe Disease. In further preferred embodiments the individual is an individual suffering from CRIM-positive (CRIM+) classic infantile Pompe Disease. In further preferred embodiments the individual is an individual suffering from non-classic infantile Pompe Disease. In further preferred embodiments the individual is an individual suffering from late onset Pompe Disease. In further preferred embodiments the individual is an individual suffering from Pompe Disease with affected brain. In further preferred embodiments the individual is an individual suffering from Pompe Disease with affected peripheral nervous system, affected smooth muscle and/or deafness. In further preferred embodiments the individual is an individual suffering from Pompe Disease that is insufficiently responsive to GAA enzyme replacement therapy. In preferred embodiments an individual is treated in accordance with the invention is an individual who has not developed anti-GAA antibodies. As described herein above, such antibodies could neutralize the activity of the transgene product or of ERT. Examples of such individuals are individuals that have not been treated with ERT previously, i.e. before being treated in accordance with the invention, and individuals who have been treated with ERT previously, i.e. before being treated in accordance with the invention, but that also received immune suppression (e.g. with rituximab) so that no anti-GAA antibodies have been formed yet. Hence, in some preferred embodiments, the individual treated in accordance with the invention has not previously been treated with GAA enzyme replacement therapy. In preferred embodiments, central immune tolerance is induced. In other preferred embodiments, the individual treated in accordance with the invention has previously been treated with GAA enzyme replacement therapy and preferably with immune suppression treatment, e.g. with rituximab. In other preferred embodiments central immune tolerance is induced in individuals who have been treated with ERT previously, i.e. before being treated in accordance with the invention, and who have developed anti-GAA antibodies due to such ERT treatment. In preferred embodiments, central immune tolerance is induced. The present inventors have demonstrated that the methods of the invention result in high efficacy in the brain, in particular high efficacy in the brain with low VCN. Also provided is therefore a method for preventing or halting loss of IQ in an individual suffering from Pompe Disease, comprising administering a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention to the individual. Also provided is a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention for use in a method for preventing or halting loss of IQ in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease. Also provided is a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention in the preparation of a medicament for preventing or halting loss of IQ in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease. In preferred embodiment, said individual is an individual suffering from Pompe Disease with affected brain. Such methods are particularly suitable for Pompe Disease patients who suffer from brain pathology, which are in particular patients with classic infantile Pompe Disease. Hence, in preferred embodiments, the individual is suffering from classic infantile Pompe Disease. In preferred embodiments, the HSC have been isolated from the individual and have been transduced ex vivo with a nucleic acid molecule or vector of the invention. I.e. in preferred embodiments individuals are treated with autologous transduced HSC. Hence, in preferred embodiments, a method of treatment of the invention comprises removing HSC from the individual, providing said HSC with a nucleic acid molecule, vector or viral particle according to the invention, preferably lentiviral vector or lentiviral particles, and administering said HSC provided with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. In preferred embodiments, a method or use comprises transducing said HSC with the nucleic acid molecule, vector or viral particle according to the invention, preferably a lentiviral vector or lentiviral particles, and administering said HSC transduced with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. However, allogenic HSC may also be used in the methods and uses of the invention. The method and uses of the invention are further particularly suitable for treating defects in several organs that are affected by Pompe Disease, in addition to the main affected organs, muscle, brain and heart, based on the high penetration of the gene therapy and high efficacy demonstrated. Such organs and symptoms include the peripheral nervous system and smooth muscle and hearing defects. Also provided is therefore a method for treating brain, peripheral nervous system, smooth muscle and/or hearing defects in an individual suffering from Pompe Disease comprising administering a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention to the individual. Also provided is a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention for use in a method for treating brain, peripheral nervous system, smooth muscle, and/or hearing defects in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease. Also provided is a use of a nucleic acid molecule, fusion protein or cell population, in particular HSC, according to the invention in a preparation of a medicament for treating brain, peripheral nervous system, smooth muscle, and/or hearing defects in an individual suffering from Pompe Disease, in particular classic infantile Pompe Disease. In preferred embodiments, said individual is an individual suffering from Pompe Disease with affected peripheral nervous system, affected smooth muscle and/or deafness. Such methods are particularly suitable for Pompe Disease patients who suffer from pathology in the peripheral nervous system and smooth muscle and from hearing defects, which are in particular patients with classic infantile Pompe Disease. Hence, in preferred embodiments, the individual is suffering from classic infantile Pompe Disease. In preferred embodiments, the HSC have been isolated from the individual and have been transduced ex vivo with a nucleic acid molecule or vector of the invention. I.e. in preferred embodiments individuals are treated with autologous transduced HSC. Hence, in preferred embodiments, a method of treatment of the invention comprises removing HSC from the individual, providing said HSC with a nucleic acid molecule, vector or viral particle according to the invention, preferably lentiviral vector or lentiviral particles, and administering said HSC provided with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. In preferred embodiments, a method or use comprises transducing said HSC with the nucleic acid molecule, vector or viral particle according to the invention, preferably a lentiviral vector or lentiviral particles, and administering said HSC transduced with said nucleic acid molecule, vector or viral particle, preferably lentiviral vector or lentiviral particles, to said individual. However, allogenic HSC may also be used in the methods and uses of the invention. In preferred embodiments, a method or use of the invention comprises providing the individual with myeloablative treatment prior to administering treatment, in particular transduced HSC, according to the invention. Myeloablative treatment is also referred to in the art as myeloablative conditioning or myeloablative preconditioning. The term refers to treatment, such as chemotherapy or irradiation that eliminate hematopoietic cells of the individual treated. Preferably, most (e.g. more than 80% of) hematopoietic cells are eliminated. In addition, reduced preconditioning regimens may be applied. Myeloablative treatment is preferably performed by chemotherapy. Myeloablative treatment of human individuals is well known in the art and suitable chemotherapeutics are well known and can be selected by a person skilled in the art. Such agents are for instance used for allogeneic stem cell transplantation. Suitable, but non-limiting examples of such myeloablative agents are busulfan, melphalan, treosulfan fludarabine, cyclophosphamide, and combinations thereof. In preferred embodiments, the myeloablative treatment is with an agent selected from the group consisting of busulfan, treosulfan, fludarabine and combinations thereof. In further preferred embodiments, the treatment, in particular HSC transplantation, in accordance with the present invention is combined with GAA enzyme replacement therapy (ERT). In preferred embodiment, the enzyme used in ERT is an acid alpha- glucosidase (GAA) enzyme, optionally in combination with or fused to a chaperone, an agent or a peptide that facilitates passage across the blood brain barrier. Optionally said enzyme is a modification, variant or fragment of GAA that has glucosidase activity, in particular that is capable of degrading the α-1,4 and α-1,6 linkages in glycogen, maltose and isomaltose, optionally in combination with or fused to a chaperone or an agent that facilitates passage across the blood brain barrier. Hence, as used herein said GAA enzyme in GAA enzyme replacement therapy is preferably comprises an acid alpha-glucosidase (GAA) enzyme or a modification, variant or fragment thereof that has glucosidase activity, in particular that is capable of degrading the α-1,4 and α-1,6 linkages in glycogen, maltose and isomaltose, optionally in combination with or fused to a chaperone or an agent that facilitates passage across the blood brain barrier. Suitable GAA enzymes include an enzyme selected from the group consisting of Myozyme,, Lumizyme, neo-GAA (carbohydrate (M6P groups) modified forms of alpha glucosidase-alpha), ATB200 (Amicus Therapeutics), BMN-701 (BioMarin: Gilt GAA for Pompe Disease, in which rhGAA is fused with an IGF-II peptide), recombinant human GAA (rhGAA), rgGGAA (Oxyrane: recombinant human acid alpha- glucosidase produced in genetically modified yeast cells and enriched in mannose 6-phosphate content), rhGAA modified by conjugation, for example to mannose-6- phosphate groups or to IGF-II peptides. Said enzyme is preferably selected from the group consisting of a recombinant human GAA, Myozyme, Lumizyme, neoGAA, Gilt GAA (BMN-701), or rhGGAA. In some embodiments, the individual is treated with ERT prior to treatment, in particular HSC transplantation, in accordance with the invention. In such cases, ERT for instance serves to improve the condition of the patient prior to treatment, in particular HSC transplantation, in accordance with the invention. In some preferred embodiment, the individual is treated with an immune suppressive agent prior to or concomitant with ERT. Immune suppressive agents are well known in the art and suitable immune suppressive agent are well known and can be selected by a person skilled in the art. As used herein an immune suppressive agent refers to an agent is capable of suppressing immune reaction in an individual. In preferred embodiments, B cells are suppressed. In preferred embodiments, the immune suppressive agent is selected from the group consisting of a B cell depletion agent, such as an anti-CD20 antibody, a T cell depletion agent, such as an anti-CD3 antibody (such as OKT3, muronomab) or an anti T cell receptor antibody (such as Muromonab-CD3), an anti-IL-2 receptor antibody (such as basiliximab and daclizumab), azathioprine, a calcineurin inhibitor, a corticosteroid, cyclosporine, methotrexate, IVIG, mercaptopurine, mycophenolate mofetil, and combinations thereof. In further preferred embodiments the immune suppressive agent is a B cell depletory agent, such as an anti-CD20 antibody, in particular rituximab. As used herein, a B cell depletion agent is an agent that reduces the amount of B cells in the individual that is treated with the agent. It has been found by the present inventors that treatment with an immune suppressing agent reduces or prevents the formation of anti-GAA antibodies, which is associated with GAA enzyme replacement treatment. Therefore such treatment optimizes combination treatment with ERT and treatment, in particular HSC transplantation, in accordance with the invention. In particular, Pompe Disease patients that are characterized by a completed absence of the GAA enzyme are susceptible to the development of anti-GAA antibodies. Such patients are also referred to as cross-reactive immunological material (CRIM)-negative patients and are by definition classic infantile Pompe Disease patients. Also CRIM positive patients can develop anti-GAA antibodies. CRIM positive patients may be either be classic infantile patients (expressing GAA protein with zero enzymatic activity), or late onset patients (expressing GAA protein with some residual GAA enzyme activity; onset of symptoms varies between the age of 0 to 70 years). Hence, in preferred embodiments of a method or use of the invention wherein an individual is treated with ERT prior to treatment, in particular HSC transplantation, and with an immune suppressive agent prior to or concomitant with ERT, said individual is an individual suffering from classic infantile Pompe Disease, in particular an individual suffering from cross-reactive immunological material (CRIM)-negative classic infantile Pompe Disease. In some embodiments, the individual is treated with ERT during and/or subsequent to treatment, such as HSC transplantation, in accordance with the invention. In some embodiments, the individual is treated with ERT both prior to and during and/or subsequent to treatment, such as HSC transplantation, in accordance with the invention. In some embodiments, the individual is not treated with ERT but only with treatment, in particular HSC transplantation, in accordance with the invention. Features may be described herein as part of the same or separate aspects or embodiments of the present invention for the purpose of clarity and a concise description. It will be appreciated by the skilled person that the scope of the invention may include embodiments having combinations of all or some of the features described herein as part of the same or separate embodiments. The invention will be explained in more detail in the following, non-limiting examples. Brief description of the drawings Figure 1: GAA sequences. A. Human GAA amino acid sequence (NP_000143.2; GenPept). B. Human GAA mRNA sequence (NM_001079803.3; GenBank). Figure 2: Human IGFII amino acid sequence (based on P01344; UniProt). Figure 3: Overview of constructs. Schematic overview of the normal processing of GAA and IGFII constructs 1, 2, 3 and 4. Abbreviations used: GAAco - codon optimized acid alpha glucosidase (GAA); IGF2 - Insulin like growth factor 2; SpG – Signal peptide GAA; SpI – Signal peptide IGF2; GAP – amino acids glycine alanine proline. Numbering refers to amino acids. A) Normal processing of GAA into the final 76 and 70 kDa form. B) Normal processing of IGF2 into mature IGF2. C) Overview of natural human GAA, myozyme, reveglucosidase alfa as published and the constructs used here. Construct 1 consists of the complete amino acid (aa) sequence of human GAA, including the signal peptide (aa 1-27). In construct 2, an IGF2 peptide consisting of aa 1 and 8-67 of mature human IGF2 is fused to a truncated form of GAA (aa70-952), preceded by the human IGF2 signal peptide (indicated as aa -24 to -1). Construct 3 is similar to construct 2, but lacks aa 30-40 of mature human IGF2. In construct 4, the truncated version of GAA as present in construct 2 and 3 is replaced by the full length GAA sequence excluding the GAA signal peptide (aa 28-952). Figure 4: Uptake of GAAco, IGF2.GAAco and IGF2del.GAAco proteins in GAA ^-/- myotubes. Conditioned medium containing the proteins GAAco, IGF2.GAAco and IGF2del.GAAco were produced by incubating stably transduced HEK293T cells with cell culture medium for 24 hours. After this period, medium was harvested and enzyme activity was assessed. The medium was diluted to an enzyme concentration of 600 or 300nmol/hr/ml, which was then incubated in triplo on differentiated GAA ^-/- mouse myotubes for 24 hours to assess the uptake of the proteins by 4MU assays or western blot analysis using a GAA antibody. A) GAA protein levels in medium after 24 hours incubation on GAA ^-/- myotubes. B) GAA protein levels in GAA ^-/- myotubes after uptake. A similar amount of total protein was loaded for all samples as determined by a BCA assay. C) Percentage of GAA uptake for the different GAA proteins. GAA protein levels were determined by western blot analysis in input medium before uptake (not shown) as well as in GAA ^-/- myotubes after uptake (B). Please note that loading in B was adjusted for total protein levels and therefore do not exactly match with the percentage of uptake as shown in C. Data is indicated as mean ± SD. n=3. D) Western blot analysis of serial dilutions (3, 6 and 12x) made of input medium to asses specific activity (F). E) Western blot analysis of serial dilutions (1, 2 and 4x) from GAA ^-/- myotubes after incubation with the conditioned medium containing one of the three proteins. Triplos were pooled before dilution. F, G) Specific activity in medium (F) and cells after uptake (G) was assessed by expressing enzyme activity (nmol/hr/ml) against the protein level determined by western blot analysis (D, E) in the same serial dilutions as described in D and E. Figure 5: Uptake GAAco, IGF2.GAAco and IGF2.FL-GAAco proteins in GAA ^-/- myotubes. Conditioned medium containing the proteins GAAco, IGF2.GAAco and IGF2.FL-GAAco were produced by incubating stably transduced HEK293T cells with cell culture medium for 24 hours. After this period, medium was harvested and enzyme activity and protein levels were assessed by 4MU assays and western blot analysis using a GAA antibody. The medium was diluted to an enzyme concentration of 800, 400 or 200nmol/hr/ml, which was then incubated in duplo on differentiated GAA ^-/- mouse myotubes for 24 hours to assess the uptake of the proteins. A) GAA protein levels in medium after incubation with GAA ^-/- myotubes. B) GAA protein levels in GAA ^-/- myotubes after incubation with conditioned medium (800 nmol/hr/ml). A similar amount of total protein was loaded for all samples as determined by BCA assay. C) Percentage of GAA uptake for the different GAA proteins. GAA protein levels were determined by western blot analysis in input medium before uptake (not shown) as well as in GAA-/- myotubes after uptake (B). Please note that loading in B was adjusted for total protein levels and therefore do not exactly match with the percentage of uptake as shown in C. Data is indicated as mean ± SD. n=2. D, E) Specific activity in medium was assessed by expressing enzyme activity (nmol/hr/ml) against the protein level determined by western blot analysis (E) in the serial dilutions of the input medium (3x, 6x and 12x). Figure 6: Competition with IGF2 during uptake of lentiviral expressed GAA proteins in GAA ^-/- myotubes. Conditioned media containing the proteins GAAco, IGF2.GAAco, IGF2del.GAAco (A, B) and IGF2.FL-GAAco (C, D) were prepared as described before. Uptake experiments were performed using conditioned medium containing the indicated proteins at an input concentration of 600 nmol/hr/ml in the presence or absence of IGF2 (2.5 µg/ml; 0.37 µM). After 24 hours, cells were harvested and the enzyme activity in cells was assessed (A) as well as the percentage of uptake which is expressed as a percentage relatively to the ‘no IGF2’ condition (B). Data are indicated as mean ± SD. Statistics indicate the difference per construct in the absence or presence of IGF2. ****P ≤ 0,0001 by one-way ANOVA with Tukey multiple comparison testing. ns, not significant. n=3. Figure 7: In vivo glycogen content after treatment using different vectors. Six months after lentiviral gene therapy with one of the constructs, mice were starved overnight and tissues were harvested. Glycogen content was measured in the skeletal muscles tibialis anterior (A) and quadriceps femoris (B), heart (C) and cerebrum (D). Correlation between vector copy number (VCN) and glycogen content (ug/mg) is shown by plotting VCN in bone marrow against glycogen content in tibialis anterior (E), quadriceps femoris (F), heart (G) and cerebrum (H). Data are indicated as mean ± SD. Statistics indicate the difference compared to untreated KO mice or as indicated. * P ≤ 0.05, ** P ≤ 0,01, ** P ≤ 0,001, ****P ≤ 0,0001 by one-way ANOVA with Tukey multiple comparison testing. ns, not significant. n=9 except for the GFP group(n=8). Figure 8: Overview of constructs for which epitope tagging interfered with the function of GAA. Schematic overview of constructs 5-9. Abbreviations used: GAAco - codon optimized acid alpha glucosidase (GAA); IGF2 - Insulin like growth factor 2; SpG – Signal peptide GAA; SpI – Signal peptide IGF2; S – amino acids glycine alanine proline (GAP), L – flexible linker, ApoE2 - Apolipoprotein E2. Numbering refers to amino acids. Construct 5 consists of the complete amino acid (aa) sequence of human GAA, excluding the signal peptide (aa 1-27). This sequence is N-terminally fused to a sequence consisting of 2x ApoE2 peptide fused to the aa 1-27 signal peptide of GAA. Construct 6 is similar to construct 5, but here the signal peptide of IGF2 is used instead of the signal peptide of GAA. Construct 7 is similar to construct 5, but the signal peptide and ApoE2 sequence are separated by a 3 amino acid spacer (GAP). In construct 8 and 9, either GAA or IGF2.GAA is C- terminally tagged to a sequence consisting of 2x an ApoE2 peptide. Figure 9: Transient transfection of HEK293T cells with construct 5-7. HEK293T cells were transient transfected with construct 1, 2 and 5-7. A control was included where the same procedure was performed without DNA. After 24 hours, medium was refreshed and t the next day cells and medium were harvested for analysis. A) GAA protein levels in cells after transient transfection. Protein patterns indicate normal processing of all proteins. B) GAA protein levels in medium after 24 hours incubation on transient transfected HEK293T cells. No GAA protein could be observer for construct 5-7. C, D) Enzyme activity in medium (C) and cells (D) indicate that even though the processing inside the cells appears to be normal, no active enzyme can be observed inside the cells, and neither in the medium indicating no secretion of the protein. Figure 10: Transient transfection of HEK293T cells with construct 8-9. HEK293T cells were transient transfected with construct 1, 2, 8 and 9. A control was included where the same procedure was performed without DNA. After 24 hours, medium was refreshed and t the next day cells and medium were harvested for analysis. A) GAA protein levels in cells after transient transfection. Protein patterns indicate an abnormal processing of construct 8 and 9. B) GAA protein levels in medium after 24 hours incubation on transient transfected HEK293T cells. No GAA protein could be observer for construct 8 and 9. C, D) Enzyme activity in medium (C) and cells (D) indicate that the protein produced by construct 8 and 9 are not active. Figure 11: Protein expression and enzyme activity in thymus. Thymi of mice were assessed for transgene expression to assess the potential involvement of central immune tolerance induction. Groups include mice receiving lentiviral GAA (LV-SF-GAA) with or without subsequent ERT injections. LV-SF-GAAco treated mice that received weekly PBS injections were included to evaluate the effect of gene therapy alone. Age-matched untreated Gaa ^-/- and wildtype mice served as controls. (A) Schematic representation of the experimental setup of mice receiving gene therapy in combination with ERT at the indicated intervals. (B) Western blot analysis of human GAA and GAPDH at different total protein amounts (µg) as indicated (2.5 µg not shown in WT mice). (C) Western blot quantification of human GAA relative to GAPDH expression, normalized to the GAA expression of LV-SF- GAA in combination with ERT at a 6-week interval. (D) GAA enzyme activity measured using the 4-methylumbelliferone (4-MU) assay, normalized for total protein levels. (E, F) Vector copy number (VCN) in thymus (E) and bone marrow (F) as described above. Data are represented as means ± SEM; n = 3 per group, tissue of the same mice were used for VCN, western blot and enzyme activity analysis. Asterisks indicate comparison to LV-SF-GAAco treated mice with subsequent ERT injections after a 4-week interval. *p <0.05; ** p <0.01; *** p <0.001; ns, not significant. Figure 12: Schematic representation of the lentiviral vectors. The figure shows self-inactivating (SIN) lentiviral vectors expressing codon optimized GAA (GAAco) driven by different internal promoters. (A) pRRL.PPT.SF.GAAco.bPRE4*.SIN (referred as LV-SF) contains the spleen focus- forming virus (SF) promoter. (B) pRRL.PPT.MND.GAAco.bPRE4*.SIN (referred as LV-MND) contains the murine leukemia virus-derived MND promoter (C) pRRL.PPT.MND_short.GAAco.bPRE4*.SIN (referred as LV-MND-S) contains the above MND promoter with a 174bp deletion at the 5’ end. (D) The MND promoter was derived from 3’ LTR of myeloproliferative sarcoma virus (MPSV). The difference between the MND and MND-S promoter is a 174bp upstream fragment including sequences encoding the gp70 envelope protein, the primary binding site (PBS) and the beginning of 3’ LTR of MPSV. LTR indicates long terminal repeat; RSV, enhancer and promoter from the U3 region of Rous sarcoma virus; SD, splice donor site; Ψ, packaging signal; RRE, rev response element; SA, splice acceptor site; cPPT, central polypurine tract; bPRE4*, a modified woodchuck posttranslational regulatory element devoid of the Woodchuck hepatitis X-protein sequence and ATG sites deleted; ΔU3, deletion in the U3 region of 3’ LTR to create SIN vector. Figure 14: Prevention of antibody formation and promotion of glycogen clearance in the brain after lentiviral gene therapy with IGF2.GAAco or IGF2.FL-GAAco in Gaa ^-/- mice. One month after lentiviral gene therapy with IGF2.GAAco (construct 2), IGF2-FL.GAAco (construct 4) or GFP (mock control), mice received up to 10 injection of ERT with rhGAAThree GFP mice only received 4 injections of ERT in order to prevent an anaphylactic shock due to high antibody titers. One week after the last injection, at the age of 6 months, mice were starved overnight and tissue was harvested for analysis. Vector copy number (A) and chimerism (B) were determined in bone marrow samples. To assess treatment efficiency, enzyme activity (C) and glycogen content (D) were measured in the brain. Data are indicated as mean ± SD. * P ≤ 0.05, ** P ≤ 0,01, ** P ≤ 0,001, ****P ≤ 0,0001 by one-way ANOVA with Tukey multiple comparison testing. ns, not significant. n=6 for all groups. Examples Materials and methods Uptake experiment in GAA-/- mouse myotubes HEK293T cells were grown in Ham’s F-10 medium (Lonza) supplemented with 10% fetal bovine serum (FBS, Biowest) and 1% penicillin-streptomycin (PS, Gibco) and transduced with GAAco, IGFII.GAAco, IGFIIdel.GAAco or IGFII.FL-GAAco. For production of conditioned media, HEK293T producer cells were grown at 90% confluency in Ham’s F-10 medium supplemented with 10% FBS, 1% penicillin- streptomycin, and 3mM PIPES (Sigma). After 24 hours, cells and media were collected. Conditioned medium containing secreted IGF2.GAA or GAA was filtered (0.22 μm filter, Millipore) and used for uptake assays. Where indicated, conditioned medium was supplemented with IGF2 (Cell Sciences, #MU100) for competitive inhibition. Uptake experiments were performed on primary myoblasts isolated from Gaa ^-/- mice as previously described. ⁵⁷ Myoblasts were cultured in growth medium (1% PS and 20% FBS (Biowest) in Ham’s F-10 medium (Lonza) to 90% confluency on extracellular matrix-coated plates (ECM, Sigma, 5%) and differentiated into myotubes in differentiation medium (1% PS and 2% horse serum (Gibco) in high- glucose Dulbecco's modified Eagle's medium (DMEM, Lonza)) at 37°C with 5% CO2. Enzyme activity was determined in conditioned medium collected from HEK 293T cells (described above), and GAA protein with an activity between 200 and 800 nmol/hr/ml (as indicated in figures) was incubated on myotubes for 24 hrs. Media and cells were harvested after 24 hours and GAA enzyme assay and Western blotting were performed. Animals and Procedures All animal procedures in this study conformed to Dutch law for the protection and use of animals for scientific procedures and were approved by the Animal Experiments Committee (DEC) in the Netherlands. Immunocompetent Gaa ^-/- knockout mice in an FVB/N background were used for all experiments (Bijvoet et al. 1998, Hum Mol Genet 7: 53-62). Gaa ^-/- mice are completely deficient of GAA enzymatic activity and were generated as previously described (Bijvoet et al.1998, Hum Mol Genet 7: 53-62). Age-matched FVB/N mice were purchased from Charles River (Wilmington, MA) as wildtype controls. All mice were housed under specific pathogen-free (SPF) conditions in the Animal Experimental Center at the Erasmus MC (EDC) according to standard procedures, which included a 12-hour light-dark cycle and ad libitum diet. Mice were deprived of food 15 hours pre-sacrifice to deplete cytoplasmic glycogen (Bijvoet et al. 1999. Hum Mol Genet 8: 2145-2153). Subsequently, mice were anesthetized with ketamine (10%, Alfasan, Woerden, the Netherlands) and Sedator (1mg/ml, Eurovet, Bladel, the Netherlands) and sacrificed by intracardiac perfusion with 50 ml phosphate buffered saline (PBS) to remove blood. Relevant tissues which included cerebrum, heart, tibialis anterior, quadriceps femoris, bone marrow and thymus were harvested, snap-frozen in liquid nitrogen and stored at -80 ^C until further analysis. Lentiviral vector construction and production Codon-optimized human GAA (GAAco; GenScript, Piscataway, NJ) or IGF2.GAAco was cloned into the third generation self-inactivating (SIN) lentiviral vector pCLL.PPT.MND.RAG1.WPRE.SIN (pCCL.MND.coRAG1, kindly provided by Dr. Frank Staal) by replacing the RAG1 gene using BamHI and SalI restriction sites to generate pCLL.PPT.MND.GAAco.WPRE.SIN (GAAco) (Stok et al., 2020. Molecular Therapy - Methods & Clinical Development 17: 1014-1025). A codon-optimized insulin-like growth factor 2 (IGF2) cassette (GenScript, Piscataway, NJ) was subcloned into the GAAco backbone after double digestion using BamHI and SgrAI. The resultant lentiviral vector pCLL.PPT.MND.IGF2co.GAAco.WPRE.SIN (MND.IGF2co.GAAco) encodes the IGF2 signal peptide, residues 1 and 8-67 of human IGF2, a three amino acid spacer, and residues 70-952 of codon-optimized human GAA (Figure 3A) (as described in Maga et al.2013 (J Biol Chem. 2013 Jan 18;288(3):1428-38)). In addition, IGF2del.GAA and IGF2.FL-GAA were constructed via Gibson assembly using overhang primers into the MND.IGF2.GAAco backbone. MND.IGF2del.GAAco was constructed using the following primers: ggaatcgtcgaggaatgctgttttc (fw primer) and cagcattcctcgacgattccagaaaagtagaagccgcggtcc (reverse primer) resulting in a lentiviral vector pCLL.PPT.MND.IGF2del.GAAco.WPRE.SIN (MND.IGF2del.GAAco) encoding the IGF2 signal peptide, residues 1 and 8-29 and 41-67 of human IGF2, a three amino acid spacer, and residues 70-952 of codon- optimized human GAA (Figure 3A). MND.IGF2.FL-GAA was constructed using the MND.IGF2.GAAco construct as a template for the vector and the MND.GAAco as a template for the insert using the following primers: tcttcctgggacctgagccc (vector forward), tcgtgcagcaggatgtgccctggggctccttcggacttgg (vector reverse), gggcacatcctgctgcacg (insert forward) and gcccccagtagggtggcata (insert reverse) resulting in a lentiviral vector pRRL.PPT.MND.IGF2.FL-GAAco.bPRE4*.SIN (MND.IGF2.FL-GAAco) encoding the IGF2 signal peptide, residues 1 and 8-67 of human IGF2, a three amino acid spacer, and residues 28-952 of codon-optimized human GAA (Figure 3A). Transgene expression was driven by the MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted) promoter. For promoter comparison studies, MND or MND-S promoters have been cloned into the lentiviral vector pRRL.PPT.SF.GAAco.bPRE4*.SIN (LV-SF, Figure 12A, previously described previously by van Til et al. (Blood. 2010 Jul 1;115(26):5329-37). The LV-SF harbors an internal spleen focusing-forming virus (SF) promoter (SF). The SF promoter was then substituted by the Moloney murine leukemia virus-derived MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev primer-binding site substituted) promoter (MND) (Cartier N. et al.; Science. 2009;326(5954):818-823) (kindly provided by Dr. Laure Caccavelli) and its modified version with a 174bp deletion upstream (MND-Short; MND-S) (kindly provided by Dr. FTJ Staal) respectively, through XhoI/AgeI restriction sites, thus generating, pRRL.PPT.MND.GAAco.bPRE4*.SIN (LV-MND, Figure 12C) and pRRL.PPT.MND-S.GAAco.bPRE4*.SIN (LV-MND-S, Figure 12B). The difference between the MND and MND-S promoters is depicted in Figure 12D. Lentivirus was generated in HEK 293T cells by calcium phosphate transfection with the third generation lentiviral vector packaging plasmids pMDL-g/pRRE, pMD2-VSVg, and pRSV-Rev (Dull et al. 1998 J. Virol. 72, 8463; Zufferey et al. 1998 J. Virol. 72, 9873–9880). Virus concentration was performed by ultracentrifugation (Beckman, SW32Ti rotor) at 20,000 rpm for 2 hours at 4°C and titration was performed in HeLa cells by quantitative polymerase chain reaction (qPCR) with primers targeting the U3 and Psi sequences of HIV. A standard curve was prepared using transduced HeLa with on average 1 copy of integrated lentiviral vector per genome. Final titers were determined as the average VCNs multiplied by the cell number and fold dilution. Lentiviral hematopoietic stem cell transduction and transplantation procedures Bone marrow cells were extracted from the tibiae and femora of 8-week-old male Gaa ^-/- donor mice and enriched through lineage depletion (Lin-) using the Mouse Hematopoietic Progenitor Cell Enrichment Set (BD Sciences, San Jose, CA). After enrichment, Lin- cells were seeded in 6-well plates at a density of 10 ⁶ cells/ml in StemSpan medium, supplemented with the following growth factors: recombinant murine thrombopoietin (10 ng/ml), recombinant murine stem cell factor (100 ng/ml) and recombinant mouse FMS-like tyrosine kinase 3 murine ligand (50 ng/ml).The following day, cells were transduced overnight with concentrated lentiviruses pCCL.MND.GAAco, pCCL.MND.IGF2.GAAco, pCCL.MND.IGF2del.GAAco, pCCL.MND.IGF2.FL-GAAco or pCCL.MND.GFP at multiplicity of infection 5 (MOI 5), and incubated at 37°C with 5% CO2. After 24 hours, 1x10 ⁶ transduced Lin- cells were transplanted intravenously through the tail vein into 8-week-old female Gaa ^-/- recipients, previously subjected to 6 Gy sublethal total body irradiation using the Gammacell 40 irradiator (Atomic Energy of Canada LTD., Ontario, Canada). GAA enzymatic activity and glycogen content assays Tissue aliquots were homogenized completely in 300 μl Milli-Q water (Merck, Millipore) supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, Roche) using 5 mm stainless steel beads (Qiagen) in the TissueLyser II (Qiagen, Venlo, the Netherlands) for 5 minutes at 30 Hz. Debris was pelleted by centrifugation at 10,000 rpm for 5 minutes and the supernatant was used for GAA enzymatic activity and glycogen content measurements. GAA enzymatic activity was determined in a fluorimetric assay using 4-methylumbelliferyl-α-D-glucoside (Sigma-Aldrich, St. Luis, MO) as substrate, as previously described (Okumiya et al. 2006. Mol Genet Metab 88: 22-28). Glycogen content was quantified by the amount of glucose released from glycogen after conversion by amyloglucosidase and amylase (Roche Diagnostics, Basel, Switzerland) as previously detailed (Bijvoet et al. 1999. Hum Mol Genet 8: 2145-2153). Both GAA enzymatic activity and glycogen content were normalized to total protein levels determined with the Pierce BCA Protein Assay Kit (Thermo Scientific, Waltham, MA). Western blotting Protein extracts from cells were obtained in lysis buffer (100 mM NaCl, 50 mM Tris (pH 7.5), 1% Triton X-100) or milliQ water supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, Roche). Tissue samples were obtained as indicated before. Protein concentration was determined using a Pierce ^TM BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. A similar total protein amount was used for the different conditions within the same blot. Samples were denaturated with 5x Laemmli sample buffer (62.5 mM Tris-HCL pH 6.8, 2% SDS, 25% glycerol, 0.01% bromophenol blue, 5% β- mercaptoethanol) and heated at 95˚C for 5 minutes. Protein exacts were separated by SDS-PAGE on a 4-15% polyacrylamide gel (Criterion TGX, Bio-Rad). Proteins were transferred to nitrocellulose blotting membranes (GE Healthcare) and blocked with Odyssey blocking buffer (TBS) or 5% non-fat milk powder in PBS and probed by overnight incubation at 4°C with rabbit anti-GAA (1:1000, Abcam, clone EPR4716(2)) and mouse anti-GAPDH (1:1000, Millipore) in blocking buffer.Proteins of interest were detected with IRDye 800 CW and IRDye 680 RD secondary antibodies (1:10000; LI-COR Biosciences, Lincoln, NE) and were imaged using the Odyssey Infrared Imaging System (LI-COR Biosciences, Lincoln, NE). Protein content was quantified using Fiji and used to normalize for total protein. Treatment of Gaa ^-/- mice with recombinant human GAA Depending on the experimental design, enzyme replacement therapy (ERT) was applied following lentiviral gene therapy. GAA lentivirus (LV-SF-GAAco) and control lentivirus (LV-SF-GFP) treated mice were divided into two groups: one group receiving ERT (marked as “+ ERT” in figures) with recombinant human acid ^-glucosidase (rhGAA, Myozyme, Genzyme corporation, Cambridge, MA) intravenously at doses of either 20 mg/kg or 100 mg/kg; while the other group was subjected to phosphate-buffered saline (PBS) alone (marked as “-ERT” in figures). Plasma was collected at baseline and every other week during the course of ERT to monitor antibody titers. Mice were sacrificed 1 week after the last injection to evaluate the therapeutic effect. Results The native full length human GAA sequence (van Til et al. 2010. Blood 115: 5329-5337), including the endogenous GAA signal peptide (spG), has previously been codon optimized, resulting in construct 1 (Stok et al., 2020. Molecular Therapy - Methods & Clinical Development 17: 1014-1025). An IGF2 peptide including the IGF2 signal peptide (spI) was fused to the N-terminus of a truncated version of GAA (aa 70-952; this truncated version also lacks the GAA signal peptide), resulting in construct 2. This IGF2-GAA fusion protein has been described previously by Maga et al. 2013 (J Biol Chem. 2013 Jan 18;288(3):1428- 38), and here has been tested in a lentivirus. In the present invention, two variations of construct 2 were made and tested in a lentivirus: 1) the insulin receptor binding site (aa 30-40) was deleted as shown previously in patent US20120213762A1 (construct 3; IGF2.del.GAAco); or 2) the truncated version of GAAco (a.a 70-952) was replaced by the full length sequence of GAA, excluding its signal peptide (a.a.28-952; construct 4 IGF2.FL- GAAco). A schematic overview of the normal processing of GAA and IGF2 as well as the used constructs are shown in Figure 3. Construct 1-3 An uptake experiment in GAA ^-/- mouse myotubes was performed using conditioned media containing the protein GAAco (construct 1), IGF2.GAAco (construct 2) or IGF2del.GAAco (construct 3) with an enzyme activity of 600 or 300 nmol/hr/ml. In the medium, GAA proteins are present as 110 kD precursors to which the epitope tags are attached as indicated (Fig. 4A). After cellular uptake, proteolytic cleavage at both the N and C termini processes the precursor 110kD forms to the intermediate 95 kD form and finally to the mature 76 kD GAA form, resulting in removal of the epitope tag. Western blot analysis of GAA protein levels in GAA ^-/- myotubes after uptake shows normal processing of the 110 kD form to the 95 kD and 76 kD forms of GAA (Fig. 4B). The percentage of uptake was calculated by dividing the amount of GAA enzyme in the myotubes after cellular uptake by the amount of GAA protein in the input medium, both assessed by western blot. For both input concentrations, IGF2.GAAco was taken up most efficiently, while IGF2del.GAAco showed an uptake which was higher than GAAco but lower than IGF2.GAAco (Fig. 4C). To determine specific activity, serial dilutions were prepared of medium or cell extracts after uptake. GAA protein levels were determined by western blot (Fig. 4D, E) and GAA enzyme activity was measured using a 4-methylumbelliferone (4-MU) assay. It can be seen in Fig.4F that the specific activity of IGF2del.GAAco in the medium is lower compared to the specific activity of GAAco and IGF2.GAAco, most likely caused by interference of the epitope tag with the enzyme activity. Fig.4G shows that after removal of the epitope tag and processing to the active form in cells, the specific activities derived from all constructs are similar. Assays were performed as described above. Uptake was performed using conditioned medium containing the proteins GAAco (construct 1), IGF2.GAAco (construct 2) and IGF2.FL-GAA (construct 4). For all three proteins, GAA enzyme activity of 800, 400 and 200nmol/hr/ml was used. Western blot analysis of medium and GAA ^-/- myotubes after 24 hour incubation show a normal pattern of processing (Fig.5A, B). The percentage of uptake was calculated as described above (Fig. 5C). The percentages of GAAco and IGF2.GAAco were higher in this experiment compared with the previous experiment due to different experimental conditions (different cell numbers, plates and total volume of media). It can be observed that the uptake of IGF2.FL-GAAco was almost half of that of IGF2.GAAco, however it still shows an improved uptake relative to GAAco. Specific activity was assessed by expressing protein levels using western blot (Fig. 5D) and enzyme activity (expressed as nmol/hr/ml) using serial dilutions of input medium (Fig.5E). A similar specific activity was observed for all three proteins, indicating that replacing the truncated version of GAAco for the full length version is not intervening with its activity. Because the IGF2.FL-GAA protein was correctly processed to the active 76 kDa form, it was not necessary to assess the specific activity in cells. In addition, a competition experiment was performed to see whether the uptake of the proteins is indeed mediated via the IGF2-binding site of the mannose-6-phosphate receptor/insulin-like growth factor 2 receptor, and whether the modifications we made are not interfering with this binding. To this end, another uptake experiment was performed in the presence or absence of excess IGF2. As expected, the uptake of GAAco (construct 1) was not inhibited by the presence of IGF2 (Fig.6A, B). However, uptake of both IGF2.GAAco (construct 2) and IGF2del.GAAco (construct 3) were inhibited by IGF2 to ~4-8% of input. IGF2.FL-GAAco (construct 4) was inhibited to ~22% of input by IGF2. Please note that all these proteins are expected to be also dependent on uptake via mannose 6- phosphate residues that bind to the same M6P/IGF2 receptor but with lower affinity compared to IGF2, explaining why there is no complete inhibition by IGF2 excess. In vivo experiments IGF2del.GAAco GAA ^-/- mice were treated with gene therapy at two months of age using a lentivirus containing one of the constructs GAAco, IGF2.GAAco or IGF2del.GAAco under subtherapeutic conditions (6 Gy irradiation preconditioning, 1x10 ^{^6} cells, MOI 5 as determined in van Til et al. (Blood.2010 Jul 1;115(26):5329-37) to be able to detect different efficacies compared to IGF2.GAAco. Mice treated with a vector expressing GFP (mock) or untreated GAA ^-/- or untreated wildtype (WT) mice were used as control. After 6 months, mice were starved overnight, sacrificed and tissues were harvested for analysis. Glycogen content was determined in tibialis anterior (Fig.7A), quadriceps femoris (Fig. 7B), heart (Fig. 7C) and cerebrum (Fig. 7D). GAAco (construct 1) was able to decrease the glycogen content in quadriceps and heart to some extend compared to untreated KO levels, but did not reduce glycogen levels in the cerebrum. IGF2.GAAco (construct 2) was more efficient in clearing the glycogen content in all tissues compared to GAAco and also reduced glycogen content in the cerebrum. IGF2del.GAAco (construct 3) was more efficient compared to IGF2.GAAco in clearing glycogen content in tibialis anterior and quadriceps femoris, but was less efficient than IGF2.GAAco in heart and cerebrum. The same conclusion was reached when glycogen content was expressed against vector copy number (VCN), in which a possible bias based on the efficiency of transduction or integration was excluded (Fig. 7E-H). In vivo experiments IGF2.FL-GAAco To assess the efficacy of IGF2.FL-GAAco, Gaa ^-/- mice were treated with lentiviral gene therapy with the vectors for IGF2.GAAco, IGF2.FL.GAAco or GFP at 10 weeks of age (9 Gy irradiation preconditioning, 1x10 ^{^6} cells, MOI 5). Mice treated with a vector expressing GFP served as controls for the effects of the transplantation procedure. Four weeks after transplantation, the mice received weekly ERT injections with recombinant human GAA (rhGAA; Myozyme; 20 mg/kg). Upon injections, GFP-treated Gaa ^-/- mice developed anti-GAA antibody titers. ERT injections were not continued when GAA antibody titers reached 300 or higher to prevent anaphylactic shock in these mice. Three out of 6 mice therefore only received 4 injections of ERT, while the other three received all 10 injections. One week after the last injection, at 6 months of age, the mice were starved overnight and tissues were collected for analysis. VCN and chimerism were determined in bone marrow, which did not show clear differences between the groups (Figure 14A, B). The therapeutic effect of the lentiviral gene therapy could not be assessed in peripheral tissues because all mice received ERT treatment, which would bias the results. Treatment efficiency could be assessed in the brain since ERT cannot cross the blood-brain barrier. GAA enzyme activity (Fig. 14C) and glycogen content (Fig. 14D) were measured in the brain of lentiviral gene therapy treated mice as a readout of treatment efficiency. IGF2.GAAco (construct 2) showed a slightly higher enzyme activity in the brain compared to IGF2.FL- GAAco (construct 4) treated mice (Fig. 14C). In line, lentiviral gene therapy with IGF2.GAAco (construct 2) resulted in an almost complete correction of the glycogen content in the brain (Fig. 14D). IGF2.FL-GAAco, on the other hand, also showed a major decrease in glycogen content compared to GFP-treated mice, but was slightly less efficient than IGF2.GAAco. Epitope tagging resulting in interference with the function of GAA In contrast to the results shown above, not all our tagging strategies resulted in an active enzyme. One of the constructs we tried to produce was GAA N- terminally tagged with ApoE2. Since the sequence of ApoE2 used does not have a signal peptide itself, the signal peptide of GAA or IGF2 was fused to ApoE2 (schematic overview in figure 8). Even though normal processing occurred inside HEK293T cells after transient transfection (Fig. 9a), no protein was secreted (Fig. 9b). In addition, no active protein could be observed either in the medium or inside the cells (Fig. 9C, D). In addition, ApoE2 was tagged C-terminally to GAA separated by a three amino acid spacer (GAP) or a flexible linker (L-(GGGGS)x4). Even though both constructs resulted in the production of the protein, the processing pattern shows an extra band above the 76 kDa form which is not observed in the original constructs (Fig. 10A, C) and the proteins produced did not show any enzymatic acitivity (Fig.10E). However, the production of the protein inside cells did not result in protein secretion into the medium (Fig. 10B, D). Central immune tolerance via the expression of GAA in the thymus In previous studies, we and others pointed to the potential of lentiviral gene therapy to induce immune tolerance to rhGAA (van Til et al. 2020. Blood 115: 5329-5337; Stok et al., 2020. Molecular Therapy - Methods & Clinical Development 17: 1014-1025; Douillard-Guilloux et al. 2009. J Gene Med 11: 279-287). To test whether HSC-mediated lentiviral gene therapy could induce central immune tolerance, we tested whether GAA transgene was expressed in the thymus. Central immune tolerance to endogenous proteins is established in the thymus via negative selection of T cells that are able to interact with endogenous antigens to distinguish self from foreign antigens. Endogenous expression of proteins in the thymus is therefore a prerequisite for the establishment of immune tolerance for these proteins. We assessed GAA protein expression and enzyme activity in the thymus of lentiviral GAA (LV-SF-GAAco) treated mice, that did or did not receive additional ERT treatment (Fig. 11A). Western blot analysis (Fig. 11B, C) and enzyme activity assays (Fig. 11D) indicated the presence of human GAA in the thymus of mice treated with lentiviral GAA. No significant differences in either GAA protein level or GAA enzyme activity could be observed in mice treated with or without 10 additional ERT injections starting 6 weeks after gene therapy with lentiviral GAA (Fig. 11C, D). Reducing the interval between gene therapy and ERT to 1 week, which was not sufficient to establish a complete immune tolerance, resulted in a 4-fold reduction of GAA levels and activity. No human GAA protein was detected in the thymus of control lentivirus (LV-SF-GFP) treated mice after 2 injections of ERT, and also not in untreated KO mice or WT mice (Fig.11C, D). VCNs in the thymus and bone marrow (Fig.11E, F; both a VCN of 6 copies per genome) indicated successful engraftment of GAA-corrected cells into both tissues, suggesting that the observed GAA expression in the thymus resulted from the migration of GAA-corrected HSCs from the bone marrow into the thymus. Together, these data suggest that the immune tolerance obtained via lentiviral gene therapy is a result of transgene expression in the thymus, inducing central tolerance against GAA. Promoter comparisons Figure 13 shows the results of the comparison of lentiviral constructs with different promoters, the SF promoter, the MND promoter and a shorter version of the MND promoter with a 174bp deletion at the 5’ end (MND-S). See figure 12 for the different self-inactivating (SIN) lentiviral vectors expressing codon optimized GAA (GAAco) driven by different internal promoters. Figures 13E and 13F show that the efficiency in muscles and brain is comparable when the original MND promoter and MND-S are used. The enzyme activity levels in BM are also comparable when normalized by VCN (figures 13C and 13D). Both the original MND promoter and MNC-S promoter are working as efficient as the SF promoter (figures 13C-F).