Field of the Invention The present invention relates to compositions that are useful in agrochemical, veterinary or pharmaceutical fields. In particular, the invention relates to polypeptides and nucleotide sequences that encode polypeptides that are useful in the identification or development of compounds with activity as pesticides or as pharmaceuticals.

Background of the Invention Membrane-bound matrix metalloproteinase ("MMP") proteins play an important role in embryonic development, reproduction, morphogenesises, tissue remodeling, cell proliferation, differentiation and apoptosis (Hideaki Nagase and J. Frederick Woessner, Jr. , J. of Biological Chemistry, Vol. 274, No. 31, pp. 21491-21494 (1999); N. Borkakoti, Progress in Biophysics & Molecular Biology, 70, pp. 73-94 (1998) ; Johnson et al., Current Opinion in Chemical Biology, 2, pp. 466-471 (1998); Massova et al. , The FASEB Journal, Vol. 12, pp. 1075-1095 (Sept. 1998); Sato et al. , F. K. Schattauer Verlagsgesellschaft mbH (Stuttgart), 78 (1), pp. 497-500 (1997); Motoharu Seiki, APMIS, 107, pp. 137-43 (1999); Myriam Polette and Philippe Birembaut, The International Journal of Biochemistry & Cell Biology, 30, pp. 1195-1202 (1998); Murphy et al. , APMIS, 107, pp. 38-44 (1999); Hideaki Nagase, Cell Research, 8, pp. 179-186 (1998); Hideaki Nagase, Biol. Chem. , Vol. 378, pp.

151-160 (March/April 1997); S. A. Watson and G. Tierney, BioDrugs, 9 (4), pp. 325-335 (1998) ; Isaac et al. , Abstract, PMID No. : 10961940 (2000); Feder et al. , Abstract, PMID No.: 10585653 (1999); Kramerova et al. , Abstract, PMID No.: 11076767 (2000);. As such, there is a desire to develop ways to target these proteins as a means of identifying biologically active compounds (Leung et al. , J. Med. Chem. , 43 (3), pp. 303-341 (2000); Martin et al. , Bioorg. Med. Chem. Lett. , 9 (19), pp. 2887-2892 (1999); Drummond et al., Ann. N. Y. Acad. Sci. , 878 (19), pp. 228-235 (1999); Pratt et al. , Bioorg. Med. Chem.

Lett. , 8 (11), pp. 1359-1364 (1998); M. Montana and A. Baxter, Current Opinion in Drug Discovery and Development, 3 (4), pp. 353-361 (2000); Whittaker et al. , Chem. Rev. , 99, pp. 2735-2776 (1999); De et al. , Ann. N. Y. Acad. Sci. , 878, pp. 40-60 (1999); Watson et al. , Cancer Res. , 55 (16), pp. 3629-3633 (1995); Griesch et al., Abstract, PMID No.:

10802237 (2000), Wedde et al., Abstract, PMID No.: 9738891 (1998); Mosolov et al., Abstract, PMID No.: 9661786 (1998); A. Zolkiewska, Abstract, PMID No.: 10527632 (1999); Dunten et al., Abstract, PMID No.: 11316871 (1998); Mark Whittaker and Andrew Ayscough, Celltransmissions, Vol. 17, No. 1, pp. 3-11; and Drew et al., Biochimica et Biophysica Acta, 1477, pp. 267-283 (2000)).

Membrane-bound matrix metalloproteinase proteins have been expressed and cloned from E. coli and various eukaryotic organisms, for example, mammals, Caenorhabditis elegans, A. thaliana, Drosophila melanogaster, Kuzbanian, Rhodnius prolixus, Galleria mellonella, Xenopus laevis, Cynips pyrrhogaster, Hemicentrotus pulcherrimus, and Paracentrotus lividus (Feder et al.; Yu et al., Abstract, PMID No.: 10769238 (2000); Griesch et al.; A. Zolkiewska; Fambrough et al., Abstract, PMID No.: 8917574 (1996); Kramerova et al.; Wedde et al. ; Watson et al.; Mark Whittaker and Andrew Ayscough; Drew et al.; Llano et al. , J. of Biological Chemistry, Vol. 275, No. 46, pp. 35978-35985 (2000); Godenschwege et al. , European J. of Cell Biology, 79, pp. 495- 501 (2000); Butler et al., Methods in Molecular Biology, Vol. 151, pp. 239-255 (1999); Pathak et al., Protein Expression and Purification, 14, pp. 283-288 (1998); Ye et al., Biochemistry, 31, pp. 11231-11235 (1992); Will et al. , J. of Biological Chemistry, Vol.

271, No. 29, pp. 17119-17123 (1996); and Duanqing Pei and Stephen J. Weiss, J. of Biological Chemistry, Vol. 271, No. 15, pp. 9135-9140 (1996) ). However, most of these proteins tend to involve humans, rats, rabbits, and mice or simple invertebrate organisms, rather than more complex invertebrate organisms, such as those from the order of Hemiptera, including, but not limited to, the organism Aphis gossypii. As a result, there is a need for MMP proteins that are non-human, and involve more complex invertebrate species, such as invertebrate organisms from the order of Henaiptera, more particular the organism Aphis gossypii.

Methods for measuring the ability of a compound to act on a MMP are known to one skilled in the art. For example, one of ordinary skill in the art would know that quantitation of cleavage products, chromatographic detection of substrate products, and fluorescence measurements can be used to test for biological activity. For example, see Bicket et al. , Analyt. Biochem. , 212, pp. 58-64 (1993); Knight et al. , FEBS, Vol. 296, No.

3, pp. 263-266 (1992); and Netzel-Arnett et al. , Analyt. Biochem. , 195, pp. 86-92 (1991).

However, most of these methods tend to screen for pharmacologically active compounds

rather than msecticidally active compounds. In addition, most of these methods involve mammalian or simple invertebrate organisms, such as, Drosophila melanogaster, rather than more complex invertebrate organisms, such as organisms of the order of Hemiptera, in particular the invertebrate organism Aphis gossypii. As a result, there is a need for a method for measuring the ability of a compound to act on a MMP protein of complex invertebrate organisms.

Summary of the Invention The present invention relates to nucleotide sequences that encode polypeptides that are useful in the identification or development of compounds with activity as pesticides or as pharmaceuticals. The present invention also relates to polypeptide sequences that are useful in the identification or development of compounds with activity as pesticides or as pharmaceuticals. These nucleotide sequences and polypeptide sequences, will also be referred to herein as"nucleotide sequences of the invention"and"polypeptide sequences of the invention", respectively.

Another aspect of the invention relates to the use of the nucleotide sequences of the invention, preferably in the form of a suitable genetic construct as described below, in the transformation of host cells or host organisms, for example for the expression of the amino acid sequences of the invention. The invention also relates to host cells or host organisms that have been transformed with the nucleotide sequences of the invention including those that can express the amino acid sequences of the invention.

In still another aspect, the invention relates to methods for the identification and/or development of compounds that can modulate and/or inhibit the biological activity of the amino acid sequences of the invention, in which the abovementioned nucleotide sequences, amino acid sequences, genetic constructs, host cells or host organisms may be used. Such methods, which will usually be in the form of an assay or screen, will also be further described below.

In a further aspect, the invention relates to methods of controlling insect populations by inhibiting activity or expression of their membrane-bound matrix metalloproteinase protein Such methods, which will usually be in the form of an assay or screen, will also be further described below.

Definitions

Collectively,'the hu'cleic acids of the present invention will be referred to herein as "nucleic acids of the invention". Also, where appropriate in the context of the further description of the invention below, the terms"nucleotide sequence of the invention"and "nucleic acid of the invention"may be considered essentially equivalent and essentially interchangeable.

Also, for the purposes of the present invention, a nucleic acid is considered to be " (in) essentially isolated (form)"-for example, from its native biological source-when it has been separated from at least one other nucleic acid molecule and sequence with which it is usually associated. Similarly, a polypeptide is considered to be" (in) essentially isolated (form)"-for example, from its native biological source-when it has been effectively separated from other polypeptide molecules with which it is normally assocaited with. In particular, a nucleic acid or polypeptide is considered"essentially isolated"when it has been purified at least 2-fold, in particular at least 10-fold, more in particular at least 100-fold, and up to 1000-fold or more.

Detailed Description of the Invention The present invention was established from the finding that the amino acid sequences of the invention can be used as (potential)"target (s)" for in vitro or in vivo interaction with chemical compounds and other factors (with the term"target"having its usual meaning in the art, provide for example the definition given in WO 98/06737).

Consequently, compounds or factors that have been identified as interacting with the amino acid sequences of the invention (e. g. by the methods as described herein below) may be useful as active agents in the agrochemical, veterinary or pharmaceutical fields.

In one embodiment, the invention relates to a nucleic acid, preferably in (essentially) isolated form, which nucleic acid comprises a nucleotide sequence of the invention, and in particular the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 and SEQ ID NO: 3. The nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, preferably SEQ ID NO: 1, was derived or isolated from the Aphis gossypii organism, in the manner as further described in the Experimental Part below.

Generally, the nucleotide sequences of the invention, when in the form of a nucleic acid, may be DNA or RNA, and may be single stranded or double stranded. For example, the nucleotide sequences of the invention may be genomic DNA, cDNA or synthetic DNA (such as DNA with a codon usage that has been specifically adapted for expression in the

intended host cell or host organism, which may for instance be designed using suitable computer programs such as Oligo-6 available from National Biosciences, Inc. (Plymouth, MN) and Consensus-Degenerate Hybrid Oligonucleotide Primers Software (CODEHOP) from Henikoff et al. (Nucleic Acids Research, 26,70, 1628-1635, 1998) available on line through the Fred Hutchinson Cancer Research Center.

Yet another embodiment relates to a double stranded RNA molecule directed against a nucleotide sequence of the invention (one strand of which will usually comprise at least part of a nucleotide sequence of the invention). The invention also relates to genetic constructs that can be used to provide such double stranded RNA molecules (e. g. by suitable expression in a host cell or host organism, or for example in a bacterial strain such as E. coli). For such constructs, reference is made to Maniatis et al., Molecular Cloning, a Laboratory Manual (Cold Spring Harbor Press, 1989).

In a broader sense, the term"nucleotide sequence of the invention"also comprises: - parts or fragments of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, preferably SEQ ID NO: 1 ; - (natural or synthetic) mutants, variants, alleles, analogs, orthologs (herein below collectively referred to as"mutants") of the nucleotide sequence of SEQ ID NO : 1, SEQ ID NO: 2 or SEQ ID NO: 3, as further described below.

- parts or fragments of such (natural or synthetic) mutants; - nucleotide fusions of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO. 2 or SEQ ID NO: 3 (or a part or fragment thereof) with at least one further nucleotide sequence ; - nucleotide fusions of (natural or synthetic) mutants (or a part or fragment thereof) with at least one further nucleotide sequence; in which such mutants, parts, fragments or fusions are preferably as further described below.

Preferably, a nucleotide sequence of the invention will have a length of at least 400 nucleotides, preferably at least 1,000 nucleotides, more preferably at least 1,600 nucleotides; and up to a length of at most 3,500 nucleotides, preferably at most 3,000 nucleotides, more preferably at most, 2,600 nucleotides.

Examples of parts or fragments of the nucleotide sequence of SEQ ID NO : 1, SEQ ID NO : 2 or SEQ ID NO : 3, preferably SEQ ID NO : 1 ; or a part or fragment of a (natural or synthetic) mutant thereof include, but are not limited to, 5'or 3'truncated nucleotide sequences, or sequences with an introduced in frame startcodon or stopcodon. Also, two or more such parts or fragments of one or more nucleotide sequences of the invention may be suitably combined (e. g. ligated in frame) to provide a further nucleotide sequence of the invention.

Preferably, any such parts or fragments will be such that they comprise at least one continuous stretch of at least 100 nucleotides, preferably at least 250 nucleotides, more preferably at least 500 nucleotides, even more preferably more than 1,000 nucleotides, of the nucleotide sequence of SEQ ID NO : 1, SEQ ID NO : 2 or SEQ ID NO : 3, preferably SEQ ID NO : 1.

Also, it is expected that-based upon the disclosure herein-the skilled person will be able to identify, derive or isolate natural"mutants" (as mentioned above) of the nucleotide sequence of SEQ ID NO : 1, SEQ ID NO : 2 or SEQ ID NO : 3, preferably SEQ ID NO : 1, from (other individuals of) the same species (for example from an individual of a different strain or line, including but not limited to mutant strains or lines). It is also expected that-based upon the disclosure herein-the skilled person will be able to provide or derive synthetic mutants (as defined hereinabove) of the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO : 2 or SEQ ID NO : 3, preferably SEQ ID NO : 1.

In one specific embodiment, the mutant is such that it encodes the nucleotide sequence of SEQ ID NO : 1 or a part or fragment thereof.

Preferably, any mutants as described herein will have one or more, and preferably all, of the structural characteristics or conserved features referred to below for the nucleotide sequences of SEQ ID NO : 1, SEQ ID NO : 2 and SEQ ID NO : 3.

In particular, any mutants, parts or fragments as described herein may be such that they at least encode the active or catalytic site of the corresponding amino acid sequence of the invention and a binding domain of the corresponding amino acid sequence of the invention.

Also, any mutants, parts or fragments as described herein will preferably have a degree of"sequence identity", at the nucleotide level, with the nucleotide sequence of SEQ ID NO : 1, SEQ ID NO : 2 or SEQ ID NO : 3, preferably SEQ ID NO : 1, of at least

'75%, prtë'Sèrtay"at lèast biS ore preferably at least 85%, and in particular more than 90%, and up to 95% or more.

Also, preferably, any mutants, parts or fragments of the nucleotide sequence of the invention will be such that they encode an amino acid sequence which has a degree of "sequence identity", at the amino acid level, with the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5, preferably SEQ ID NO: 4, of at least 50%, preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, and in particular more than 90% and up to 95% or more, in which the percentage of"sequence identity"is calculated as described below.

For this purpose, the percentage of"sequence identity"between a given nucleotide sequence and the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 may be calculated by dividing the number of nucleotides in the given nucleotide sequence that are identical to the nucleotide at the corresponding position in the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 by the total number of nucleotides in the given nucleotide sequence and multiplying by 100%, in which each deletion, insertion, substitution or addition of a nucleotide-compared to the sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3-is considered as a difference at a single nucleotide position.

Alternatively, computer programs for determining sequence identity are publicly available. A preferred computer program for determining sequence identity is the program in Geneworks v 2.5 (Intelligenetics Inc, Mountain View CA), which uses a progressive alignment procedure similar to FASTA. Preferably the parameters used with the Geneworks program are: cost to open gap = 50, lengthen gap = 100, minimum diagonal length = 4, maximum diagonal offset =125. Other computer program methods to determine identity between two sequences include, but are not limited to, GCG program package (Devereux, J. , et al., Nucleic Acids Research 12 (1) : 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, S. F. et al. , J. Molec. Biol. 215: 403-410 (1990) ) and VectorNTI (InforMax Inc. , Bethesda, MD). The BLAST X program is publicly available from NCBI (blast@ncbi. nlm. nih. gov) and other sources (BLAST Manual, Altschul et al., NCBI NLM NIH, Bethesda, MD 20894 ; Altschul et al. , J. Mol. Biol. 215: 403-410 (1990) ), Vector NTI Suite Version 6 available from Informax Inc. North Bethesda, MD.

Also, in a preferred aspect, any mutants, parts or fragments as described herein will encode proteins or polypeptides having biological activity that is essentially similar to the

biological activity''ncscriBed'above for the sequences of SEQ ID NO: 1, SEQ 1D NU : 2 and SEQ ID NO: 3, preferably SEQ ID NO: 1, i. e. to a degree of at least 50%, preferably at least 75%, and up to 90%, as measured by standard assay techniques as described below.

Any mutants, parts or fragments as described herein are preferably such that they are capable of hybridizing with the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, preferably SEQ ID NO: 1, i. e. under conditions of"moderate stringency", and preferably under conditions of"high stringency". Such conditions will be clear to the skilled person, for example from the standard handbooks, such as Sambrook et al. and Ausubel et al. , mentioned above, as well as in EP 0 967 284, EP 1 085 089 or WO 00/55318.

It is also within the scope of the invention to use a fusion of a nucleotide sequence of the invention (as described above) with one or more further nucleotide sequence (s), including but not limited to one or more coding sequences, non-coding sequences or regulatory sequences. Preferably, in such fusions, the one or more further nucleotide sequences are operably connected (as described below) to the nucleotide sequence of the invention (for example so that, when the further nucleotide sequence is a coding sequence, the nucleotide fusion encodes a protein fusion as described below).

In another embodiment, the invention relates to an antisense molecule against a nucleotide sequence of the invention.

The nucleic acids of the invention may also be in the form of a genetic construct, again as further described below. Genetic constructs of the invention will generally comprise at least one nucleotide sequence of the invention, optionally linked to one or more elements of genetic constructs known per se, as described below. Such genetic constructs may be DNA or RNA, and are preferably double-stranded DNA. The constructs may also be in a form suitable for transformation of the intended host cell or host organism, in a form suitable for integration into the genomic DNA of the intended host cell or in a form suitable independent replication, maintenance and inheritance in the intended host organism. For instance, the genetic construct may be in the form of a vector, such as for example a plasmid, cosmid, a yeast artificial chromosome ("YAC"), a viral vector or transposon. In particular, the vector may be an expression vector, i. e. a vector that can provide for expression in vitro or in vivo (e. g. in a suitable host cell or host

organism as described Below). An expression vector comprising a nucleotide sequence of the invention is also referred to herein as a recombinant expression vector. These constructs will also be referred to herein as"genetic constructs of the invention".

In a preferred embodiment, such a construct of a recombinant expression vector will comprise: a) the nucleotide sequence of the invention; operably connected to: b) one or more regulatory elements, such as a promoter and optionally a suitable terminator; and optionally also: c) one or more further elements of genetic constructs known per se; in which the terms "regulatory element","promoter","terminator", further eleme ts"and"operably connected"have the meanings indicated herein below.

As the one or more"further elements"referred to above, the genetic construct (s) of the invention may generally contain one or more suitable regulatory elements (such as a suitable promoter (s), enhancer (s), or terminator (s) ), 3'-or 5'-untranslated region (s) ("UTR") sequences, leader sequences, selection markers, expression markers or reporter genes, or elements that may facilitate or increase (the efficiency of) transformation or integration. These and other suitable elements for such genetic constructs will be clear to the skilled person, and may for instance depend upon the type of construct used, the intended host cell or host organism; the manner in which the nucleotide sequences of the invention of interest are to be expressed (e. g. via constitutive, transient or inducible expression); and the transformation technique to be used.

Preferably, in the genetic constructs of the invention, the one or more further elements are"operably linked"to the nucleotide sequence (s) of the invention or to each other, by which is generally meant that they are in a functional relationship with each other. For instance, a promoter is considered"operably linked"to a coding sequence if said promoter is able to initiate or otherwise control or regulate the transcription or the expression of a coding sequence (in which said coding sequence should be understood as being"under the control of'said promoter) Generally, when two nucleotide sequences are operably linked, they will be in the same orientation and usually also in the same reading frame. They will usually also be essentially contiguous, although this may also not be required.

Preferably, the optional further elements ot the genetic construct (s) used in me invention are such that they are capable of providing their intended biological function in the intended host cell or host organism.

For instance, a promoter, enhancer or terminator should be"operable"in the intended host cell or host organism, by which is meant that (for example) said promoter should be capable of initiating or otherwise controlling or regulating the transcription or the expression of a nucleotide sequence-e. g. a coding sequence-to which it is operably linked (as defined above).

Such a promoter may be a constitutive promoter or an inducible promoter, and may also be such that it (only) provides for expression in a specific stage of development of the host cell or host organism, or such that it (only) provides for expression in a specific cell, tissue, organ or part of a multicellular host organism.

Some particularly preferred promoters include, but are not limited to, constitutive promoters, such as cytomegalovirus ("CMV"), Rous sarcoma virus ("RSV"), simian virus- 40 ("SV40"), for example, pSVL SV40 Late Promoter Expression Vector (Pharmacia Biotech Inc. , Piscataway, NJ), or herpes simplex virus ("HSV") for expression in mammalian cells or insect constitutive promoters such a the immediate early baculovirus promoter described by Jarvis et al. Methods in Molecular BiologyVol. 39 Baculovirus Expression Protocols ed. C. Richardson. Hamana Press Inc. , Totowa, NJ 1995 available in pIE vectors from Novagen (Novagen, Inc. Madison, WI) or insect inducible promoters such as the Drosophila metallothionein promoter described by Bunch et al. Nucleic Acids Research, Vol. 6, No. 3 1043-106, 1988 available in vectors from Invitrogen (Invitrogen Corporation, Carlsbad, CA).

A selection marker should be such that it allows-i. e. under appropriate selection conditions-host cells or host organisms that have been (successfully) transformed with the nucleotide sequence of the invention to be distinguished from host cells or organisms that have not been (successfully) transformed. Some preferred, but non-limiting examples of such markers are genes that provide resistance against antibiotics (such as geneticin or G-418 (GIBCO-BRL, Grand Island, NY), kanamycine or ampicilline), genes that provide for temperature resistance, or genes that allow the host cell or host organism to be maintained in the absence of certain factors, compounds or (food) components in the medium that are essential for survival of the non-transformed cells or organisms.

X leader"sequence"should be such that-in the intended host cell or host organism- it allows for the desired post-translational modifications or such that it directs the transcribed mRNA to a desired part or organelle of a cell such as a signal peptide. A leader sequence may also allow for secretion of the expression product from said cell. As such, the leader sequence may be any pro-, pre-, or prepro-sequence operable in the host cell or host organism, including, but not limited to, picornavirus leaders, potyvirus leaders, a human immunoglobulin heavy-chain binding protein ("BiP"), a tobacco mosaic virus leader ("TMV"), and a maize chlorotic mottle virus leader ("MCMV").

An expression marker or reporter gene should be such that-in the host cell or host organism-it allows for detection of the expression of (a gene or nucleotide sequence present on) the genetic construct. An expression marker may optionally also allow for the localization of the expressed product, e. g. in a specific part or organelle of a cell or in (a) specific cell (s), tissue (s), organ (s) or part (s) of a multicellular organism. Such reporter genes may also be expressed as a protein fusion with the amino acid sequence of the invention. Some preferred, but non-limiting examples include fluorescent proteins, such as GFP, antibody recognition proteins, for example, V5 epitope or poly Histidine available in vectors and antibodies supplied by Invitrogen, or purification affinity handles such as polyhistidine which allows for purification on nickel columns or dihydrofolate reductase which allows for purification on methotrexate column, or markers which allow for selection of cells expressing the gene such as the E. coli beta-galactosidase gene.

For some non-limiting examples of the promoters, selection markers, leader sequences, expression markers and further elements that may be present or used in the genetic constructs of the invention-such as terminators, transcriptional or translational enhancers or integration factors-reference is made to the general handbooks such as Sambrook et al. and Ausubel et al. mentioned above, to W. B. Wood et al.,"The nematode Caenorhabditis elegans", Cold Spring Harbor Laboratory Press (1988) and D. L. Riddle et al. ,"C. ELEGANSII", Cold Spring Harbor Laboratory Press (1997), as well as to the examples that are given in WO 95/07463, WO 96/23810, WO 95/07463, WO 95/21191, WO 97/11094, WO 97/42320, WO 98/06737, WO 98/21355, U. S. Patent 6,207, 410, U. S.

Patent 5,693, 492 and EP 1 085 089. Other examples will be clear to the skilled person.

Another embodiment of the invention relates to a host cell or host organism that has been transformed or contains with a nucleotide sequence, with a nucleic acid or with a

'"generic construct of me invention. The invention also relates to a host cell or host organism that expresses, or (at least) is capable of expressing (e. g. under suitable conditions), an amino acid sequence of the invention. Collectively, such host cells or host organisms will also be referred to herein as"host cells or host organisms of the invention".

The host cell may be any suitable (fungal, prokaryotic or eukaryotic) cell or cell line, for example: - a bacterial strain, including but not limited to strains of E. coli, Bacillus, Streptomyces and Pseudomonas ; a fungal cell, including but not limited to cells from species of Aspergillus and Trichoderma ; - a yeast cell, including but not limited to cells from species of Kluyveromyces or Saccharomyces ; - an amphibian cell or cell line, such as Xenopus oocytes.

In one specific embodiment, which may particularly useful when the nucleotide sequences of the invention are (to be) used in the discovery and development of insecticidal compounds, the host cell may be an insect-derived cell or cell line, such as: - cells or cell lines derived from Hemipteran, including, but not limited, to Spodoptera SF9 and Sf21 cells and cells or cell lines derived from Aphis ; - cells or cell lines derived from Drosophila, such as Schneider and Kc cells; and - cells or cell lines derived from a pest species of interest (as mentioned below), such as from Heliothis virescens.

The host cell may also be a mammalian cell or cell line, including but not limited to CHO-and BHK-cells and human cells or cell lines such as HeK, HeLa and COS.

The host organism may be any suitable multicellular (vertebrate or invertebrate) organism, including but not limited to: - a nematode, including but not limited to nematodes from the genus Caenorhabditis, such as C. elegans, - an insect, including but not limited to species of Aphis, Drosophila, Heliothis, or a specific pest species of interest (such as those mentioned above); - other well known model organisms, such as zebrafish; - a mammal such as a rat or mouse;

her sultable ìost cettis or host organisms will be clear to the skilled person, for example from the handbooks and patent applications mentioned above.

It should be noted that when a nucleotide sequence of the invention is expressed in a multicellular organism, it may be expressed throughout the entire organism, or only in one or more specific cells, tissues, organs or parts thereof, for example by expression under the control of a promoter that is specific for said cell (s), tissue (s), organ (s) or part (s).

The nucleotide sequence may also be expressed during only a specific stage of development or life cycle of the host cell or host organism, again for example by expression under the control of a promoter that is specific for said stage of development or life cycle. Also, as already mentioned above, said expression may be constitutive, transient or inducible.

Preferably, these host cells or host organisms are such that they express, or are (at least) capable of expressing (e. g. under suitable conditions), an amino acid sequence of the invention (and in case of a host organism: in at least one cell, part, tissue or organ thereof).

The invention also includes further generations, progeny and offspring of the host cell or host organism of the invention, which may for instance be obtained by cell division or by sexual or asexual reproduction.

In yet another aspect, the invention relates to a nucleic acid, preferably in (essentially) isolated form, which nucleic acid encodes or can be used to express an amino acid sequence of the invention (as defined herein), and in particular the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5. A particularly preferred example of an amino acid sequence of the invention is the amino acid sequence of SEQ ID NO 4.

The amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5, preferably SEQ ID NO: 4, may be isolated from the species mentioned above, using any technique (s) for protein isolation and purification known to one skilled in the art. Alternatively, the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO : 5, preferably SEQ ID NO : 4, may be obtained by suitable expression of a suitable nucleotide sequence-such as the nucleotide sequence of SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3 or a suitable mutant thereof- in an appropriate host cell or host organism, as further described below.

In another aspect, the invention relates to a protein or polypeptide, preferably in (essentially) isolated form, said protein or polypeptide comprising an amino acid sequence

"o tne invention as aennea"above), in particular the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5, more particularly preferred the amino acid sequence of SEQ ID NO 4.

In a broader sense, the term"amino acid sequence of the invention"also comprises: - parts or fragments of the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5; - (natural or synthetic) mutants, variants, alleles, analogs, orthologs (herein below collectively referred to as"analogs") of the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5; - parts or fragments of such analogs; - fusions of the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5 (or a part or fragment thereof) with at least one further amino acid residue or sequence; - fusions of the amino acid sequence of an analog (or a part or fragment thereof) with at least one further amino acid residue or sequence; in which such mutants, parts, fragments or fusions are preferably as further described below.

The term"amino acid sequence of the invention"also comprises"immature"forms of the abovementioned amino acid sequences, such as a pre-, pro-or prepro-forms or fusions with suitable leader sequences. Also, the amino acid sequences of the invention may have been subjected to post-translational processing or be suitably glycosylated, depending upon the host cell or host organism used to express or produce said amino acid sequence; or may be otherwise modified (e. g. by chemical techniques known per se in the art).

Examples of parts or fragments of the amino acid sequence of SEQ ID NO : 4 or SEQ ID NO: 5, or a part or fragment of a (natural or synthetic) analog thereof mutant thereof include, but are not limited to, N-and C-truncated amino acid sequence. Also, two or more parts or fragments of one or more amino acid sequences of the invention may be suitably combined to provide an amino acid sequence of the invention.

Preferably, an amino acid sequence of the invention has a length of at least 100 amino acids, preferably at least 250 amino acids, more preferably at least 300 amino acids; and up to a length of at most 1,000 amino acids, preferably at most 750 amino acids, more preferably at most 600 amino acids.

""Preferably,"any"sucn'parts or fragments will be such that they comprise ai least one continuous stretch of at least 5 amino acids, preferably at least 10 amino acids, more preferably at least 20 amino acids, even more preferably more than 30 amino acids, of the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5.

In particular, any parts or fragments as described herein are such that they (at least) comprise the active or catalytic site of the corresponding amino acid sequence of the invention or a binding domain of the corresponding amino acid sequence of the invention.

As will be clear to the skilled person, such parts or fragments may find particular use in assay-and screening techniques (as generally described below) and (when said part or fragment is provided in crystalline form) in X-ray crystallography.

Also, it is expected that-based upon the disclosure herein-the skilled person will be able to identify, derive or isolate natural"analogs" (as mentioned above) of the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5. Such mutants could be derived from (other individuals of) the same species (for example from an individual of a different strain or line, including but not limited to mutant strains or lines); or from (individuals of) other species. For example, such analogs could be derived from the insect species mentioned above.

It is also expected that-based upon the disclosure herein-the skilled person will be able to provide or derive synthetic"analogs" (as mentioned above) of the amino sequence of SEQ ID NO: 4 or SEQ ID NO: 5, preferably SEQ ID NO: 4.

Preferably, any mutants as described herein will have one or more, and preferably all, of the structural characteristics or conserved features referred to below for the sequences of SEQ ID NO : 4 or SEQ ID NO : 5, preferably SEQ ID NO : 4.

Preferably, any analogs, parts or fragments as described herein will be such that they have a degree of"sequence identity", at the amino acid level, with the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5, preferably SEQ ID NO: 4, of at least 50%, preferably at least 60%, more preferably at least 70%, even more preferably at least 80%, and in particular more than 90% and up to 95 % or more.

For this purpose, the percentage of"sequence identity"between a given amino acid sequence and the amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5 may be calculated by dividing the number of amino acid residues in the given amino acid sequence that are identical to the amino acid residue at the corresponding position in the

amino acid sequence of SEQ ID NO: 4 or SEQ ID NO: 5 by the total number of amino acid residues in the given amino acid sequence and multiplying by 100%, in which each deletion, insertion, substitution or addition of an amino acid residue-compared to the sequence of SEQ ID NO: 4 or SEQ ID NO: 5-is considered as a difference at a single amino acid (position).

Alternatively, the degree of sequence identity may be calculated using a known computer program, such as those mentioned above.

Also, such sequence identity at the amino acid level may take into account so- called"conservative amino acid substitutions", which are well known in the art, for example from GB-A-2 357 768, WO 98/49185, WO 00/46383 and WO 01/09300 ; and (preferred) types or combinations of such substitutions may be selected on the basis of the pertinent teachings from the references mentioned in WO 98/49185.

Also, preferably, any analogs, parts or fragments as described herein will have a biological activity that is essentially similar to the biological activity described above for the sequences of SEQ ID NO: 4 and SEQ ID NO: 5, preferably SEQ ID NO: 4, i. e. to a degree of at least 10%, preferably at least 50% more preferably at least 75%, and up to 90%, as measured by standard assay techniques as described below.

It is also within the scope of the invention to use a fusion of an amino acid sequence of the invention (as described above) with one or more further amino acid sequences, for example to provide a protein fusion. Generally, such fusions may be obtained by suitable expression of a suitable nucleotide sequence of the invention-such as a suitable fusion of a nucleotide sequence of the invention with one or more further coding sequences-in an appropriate host cell or host organism, as further described below.

One particular embodiment, such fusions may comprise an amino acid sequence of the invention fused with a reporter protein such as glutathione S-transferase ("GST"), green fluorescent protein ("GFP"), luciferase or another fluorescent protein moiety. As will be clear to the skilled person, such fusions may find particular use in expression analysis and similar methodologies.

In another embodiment, the fusion partner may be an amino acid sequence or residue that may be used in purification of the expressed amino acid sequence, for example using affinity techniques directed against said sequence or residue. Thereafter, said sequence or residue may be removed (e. g. by chemical or enzymatical cleavage) to

provide"tie"nucl'eotide sequence of the invention (for this purpose, the sequence or residue may optionally be linked to the amino acid sequence of the invention via a cleavable linker sequence). Some preferred, but non-limiting examples of such fusion constructs are decribed below: FUSION PROTEINS Peptides and polypeptides used to practice the invention (e. g. , MMP protein) can also be synthesized and expressed as fusion proteins with one or more additional domains linked thereto for, e. g. , producing a more immunogenic peptide, to more readily isolate a recombinantly synthesized peptide, attachment to a fixed substrate for column chromatography and high throughput screening analysis (described below), and the like. Detection, substrate attachment and purification facilitating domains include, e. g. , metal chelating peptides such as polyhistidine tracts and histidine-tryptophan modules that allow attachment and/or purification on immobilized metals, protein A domains that allow attachment and/or purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp, Seattle Wash.).

The inclusion of a cleavable linker sequences such as Factor Xa or enterokinase (Invitrogen, San Diego Calif. ) between the attachment/purification domain and the MMP peptide or polypeptide can be useful to facilitate purification. For example, an expression vector can include an epitope-encoding nucleic acid sequence linked to six histidine residues followed by a thioredoxin and an enterokinase cleavage site (see e. g. , Williams (1995) Biochemistry 34: 1787-1797; Dobeli (1998) Protein Expr. Purif. 12: 404-14). The histidine residues facilitate detection and purification while the enterokinase cleavage site provides a means for purifying the MMP from the remainder of the fusion protein.

Technology pertaining to vectors encoding fusion proteins and application of fusion proteins are well described in the scientific and patent literature, see e. g. , Kroll (1993) DNA Cell. Biol. , 12: 441-53.

In one preferred, but non-limiting aspect, any such fusion will have a biological activity that is essentially similar to the biological activity described above for the sequences of SEQ ID NO: 4 and SEQ ID NO: 5, preferably SEQ ID NO: 4, i. e. to a degree

Ofat'least"i'0%, preterabiy'"at'least 50 % more preferably at least 75%, and up to 90%, as measured by standard assay techniques as described below.

The nucleotide sequences and amino acid sequences of the invention may generally be characterized by the presence of one or more of the following structural characteristics or conserved features: For the gene Aphis gossypii: SEQ ID NO: 2 is a cDNA sequence encompassing the open reading frame ; SEQ ID NO: 4 is the protein encoded by SEQ ID NO: 2. SEQ ID NO: 5 is the polypeptide encoded by SEQ ID NO: 3.

By analogy to other membrane-bound matrix metalloproteinases, it is likely that the functional protein is monomeric. (See, e. g., Hannan and Hall, In Comparative Molecular Neurobiology, Y. Pichon, 1993, Birkhuaser Verlag Basel Switzerland).

On the basis of the above, and although the invention is not specifically limited to any specific explanation or mechanism, the nucleotide sequences and amino acid sequences have (biological) activity as a proteinase. In particular, the present invention has shown activity as a membrane-bound matrix metalloproteinase from insects of the order Hemiptera, which are aphids, leafhoppers, whiteflies, scales and true bugs that have mouthparts adapted to piercing and sucking. As is known in the art, biological activity of this kind can be measured using standard assay techniques (see Bicket et al.).

Another embodiment of the invention relates to a nucleic acid probe that is capable of hybridizing with a nucleotide sequence of the invention under conditions of moderate stringency, preferably under conditions of high stringency, and in particular under stringent conditions (all as described above). Such nucleotide probes may for instance be used for detecting or isolating a nucleotide sequence of the invention or as a primer for amplifying a nucleotide sequence of the invention ; all using techniques known per se, for which reference is again made to the general handbooks such as Sambrook et al. and Ausubel et al. , mentioned above.

Preferably, when to be used for detecting or isolating another nucleotide sequence of the invention, such a nucleotide probe will usually have a length of between 15 and 100 nucleotides, and preferably between 20 and 80 nucleotides. When used as a primer for amplification, such a nucleotide probe will have a length of between 25 and 75 nucleotides, and preferably between 20 and 40 nucleotides.

'Senerally ;' such'prob'e's''can be designed by the skilled person starting from a nucleotide sequence or amino acid sequence of the invention-and in particular the sequence of SEQ ID NO: 1 or SEQ ID NO: 4-optionally using a suitable computer algorithm. Also, as will be clear to the skilled person, such probes may be degenerate probes.

In a further aspect, the invention relates to methods for preparing mutants and genetic constructs of the nucleotide sequences of the present invention.

Natural mutants of the nucleotide sequences of the present invention may be obtained in a manner essentially analogous to the method described in the Experimental Part, or alternatively by: - construction of a DNA library from the species of interest in an appropriate expression vector system, followed by direct expression of the mutant sequence; - construction of a DNA library from the species of interest in an appropriate expression vector system, followed by screening of said library with a probe of the invention (as described below) or with a nucleotide sequence of the invention; -isolation of mRNA that encodes the mutant sequence from the species of interest, followed by cDNA synthesis using reverse transcriptase ; or by any other suitable method (s) or technique (s) known per se, for which reference is for instance made to the standard handbooks, such as Sambrook et al. ,"Molecular Cloning: A Laboratory Manual" (2nd. ed. ), Vols. 1-3, Cold Spring Harbor Laboratory Press (1989) and F. Ausubel et al. ,"Current protocols in molecular biology", Green Publishing and Wiley Interscience, New York (1987).

Techniques for generating such synthetic sequences of the nucleotide sequences of the present invention will be clear to the skilled person and may for instance include, but are not limited to, automated DNA synthesis; site-directed mutagenesis; combining two or more parts of one or more naturally occurring sequences, introduction of mutations that lead to the expression of a truncated expression product; introduction of one or more restriction sites (e. g. to create cassettes or regions that may easily be digested or ligated using suitable restriction enzymes), and the introduction of mutations by means of a PCR reaction using one or more"mismatched"primers, using for example a sequence of a naturally occurring membrane-bound matrix metalloproteinase as a template. These and

"other techiiiques wilr i'eclear"to the skilled person, and reference is again made to the standard handbooks, such as Sambrook et al. and Ausubel et al. , mentioned above.

The genetic constructs of the invention may generally be provided by suitably linking the nucleotide sequence (s) of the invention to the one or more further elements described above, for example using the techniques described in the general handbooks such as Sambrook et al. and Ausubel et al. , mentioned above.

Often, the genetic constructs of the invention will be obtained by inserting a nucleotide sequence of the invention in a suitable (expression) vector known per se. Some preferred, but non-limiting examples of suitable expression vectors include: - vectors for expression in mammalian cells: pSVL SV40 (Pharmacia), pMAMneo (Clontech), pcDNA3 (Invitrogen), pMClneo (Stratagene), pSG5 (Stratagene), EBO- pSV2-neo (ATCC 37593), pBPV-1 (8-2) (ATCC 37110), pdBPV-MMTneo (342-12) (ATCC 37224), pRSVgpt (ATCC37199), pRSVneo (ATCC37198), pSV2-dhfr (ATCC 37146), pUCTag (ATCC 37460) and 1ZD35 (ATCC 37565); - vectors for expression in bacterials cells: pET vectors (Novagen) and pQE vectors (Qiagen); - vectors for expression in yeast or other fungal cells: pYES2 (Invitrogen) and Pichia expression vectors (Invitrogen); vectors for expression in insect cells: pBlueBacII (Invitrogen), pEIl (Novagen), pMT/V5His (Invitrogen).

In a further aspect, the invention relates to methods for transforming a host cell or a host organism with a nucleotide sequence, with a nucleic acid or with a genetic construct of the invention. The invention also relates to the use of a nucleotide sequence, of a nucleic acid or of a genetic construct of the invention transforming a host cell or a host organism.

According to one specific embodiment, the expression of a nucleotide sequence of the invention in a host cell or host organism may be reduced, compared to the original (e. g. native) host cell or host organism. This may for instance be achieved in a transient manner using antisense or RNA-interference techniques well known in the art, or in a constitutive manner using random, site specific or chemical mutagenesis of the nucleotide sequence of the invention.

'SuMable transformation techniques will be clear to the skilled person and may depend on the intended host cell or host organism and the genetic construct to be used.

Some preferred, but non-limiting examples of suitable techniques include ballistic transformation, (micro-) injection, transfection (e. g. using suitable transposons), electroporation and lipofection. For these and other suitable techniques, reference is again made to the handbooks and patent applications mentioned above.

After transformation, a step for detecting and selecting those host cells or host organisms that have been successfully transformed with the nucleotide sequence or genetic construct of the invention may be performed. This may for instance be a selection step based on a selectable marker present in the genetic construct of the invention or a step involving the detection of the amino acid sequence of the invention, e. g. using specific antibodies.

The transformed host cell (which may be in the form of a stable cell line) or host organisms (which may be in the form of a stable mutant line or strain) form further aspects of the present invention.

In yet another aspect, the invention relates to methods for producing an amino acid sequence of the invention.

To produce or obtain expression of the amino acid sequences of the invention, a transformed host cell or transformed host organism may generally be kept, maintained or cultured under conditions such that the (desired) amino acid sequence of the invention is expressed or produced. Suitable conditions will be clear to the skilled person and will usually depend upon the host cell or host organism used, as well as on the regulatory elements that control the expression of the (relevant) nucleotide sequence of the invention.

Again, reference is made to the handbooks and patent applications mentioned above in the paragraphs on the genetic constructs of the invention.

Generally, suitable conditions may include the use of a suitable medium, the presence of a suitable source of food or suitable nutrients, the use of a suitable temperature, and optionally the presence of a suitable inducing factor or compound (e. g. when the nucleotide sequences of the invention are under the control of an inducible promoter); all of which may be selected by the skilled person. Again, under such conditions, the amino acid sequences of the invention may be expressed in a constitutive manner, in a transient manner, or only when suitably induced.

E wilY àlso be clear to the skilled person that the amino acid sequence of the invention may (first) be generated in an immature form (as mentioned above), which may then be subjected to post-translational modification, depending on the host cell or host organism used. Also, the amino acid sequence of the invention may be glycosylated, again depending on the host cell or host organism used.

The amino acid sequences of the invention may then be isolated from the host cell or host organism or from the medium in which said host cell or host organism was cultivated, using protein isolation and purification techniques known per se, such as (preparative) chromatography and electrophoresis techniques, differential precipitation techniques, affinity techniques (e. g. using a specific, cleavable amino acid sequence fused with the amino acid sequence of the invention) and preparative immunological techniques (i. e. using antibodies against the amino acid sequence to be isolated).

In one embodiment, the amino acid sequence thus obtained may also be used to generate antibodies specifically against said sequence or an antigenic part or epitope thereof.

In one embodiment, the present invention relates to antibodies, for example monoclonal and polyclonal antibodies, that are generated specifically against amino acid sequences of the present invention, preferably SEQ ID NO: 4, or an analog, variant, allele, ortholog, part, fragment or epitope thereof. In another embodiment, the present invention relates to antibodies, for example monoclonal and polyclonal antibodies, that are generated specifically against amino acid sequences of the present invention, preferably SEQ ID NO: 5, or an analog, variant, allele, ortholog, part, fragment or epitope thereof.

Such antibodies, which form a further aspect of the invention, may be generated in a manner known per se, for example as described in GB-A-2 357 768, USA 5,693, 492, WO 95/32734, WO 96/23882, WO 98/02456, WO 98/41633 and WO 98/49306. Often, but not exclusively, such methods will involve as immunizing a immunocompetent host with the pertinent amino acid sequence of the invention or an immungenic part thereof (such as a specific epitope), in amount (s) and according to a regimen such that antibodies against said amino acid sequence are raised, and than harvesting the antibodies thus generated, e. g. from blood or serum derived from said host.

For instance, polyclonal antibodies can be obtained by immunizing a suitable host such as a goat, rabbit, sheep, rat, pig or mouse with (an epitope of) an amino acid sequence of

'the'invention, optionally with the use of an immunogenic carrier (such as bovine serum albumin or keyhole limpet hemocyanin) or an adjuvant such as Freund's, saponin, aluminium hydroxide or a similar mineral gel, or keyhole limpet hemocyanin or a similar surface active substance. After a suitable immune response has been raised (usually within 1-7 days), the antibodies can be isolated from blood or serum taken from the immunized animal in a manner known per se, which optionally may involve a step of screening for an antibody with desired properties (i. e. specificity) using known immunoassay techniques, for which reference is again made to for instance WO 96/23882.

Monoclonal antibodies may for example be produced using continuous cell lines in culture, including hybridoma-based and similar techniques, again essentially as described in the above cited references. Accordingly, cells and cell lines that produce monoclonal antibodies against an amino acid sequence of the invention form a further aspect of the invention, as do methods for producing antibodies against amino acid sequences of the invention, which methods may generally involve cultivating such a cell and isolating the antibodies from the culture or medium, again using techniques known per se.

Also, Fab-fragments against the amino acid sequences of the invention (such as F (ab) 2, Fab'and Fab fragments) may be obtained by digestion of an antibody with pepsin or another protease, reducing disulfide-linkages and treatment with papain and a reducing agent, respectively. Fab-expression libraries may for instance be obtained by the method of Huse et al. , 1989, Science 245: 1275-1281.

In another embodiment, the amino acid sequence of the invention, or a host cell or host organism that expresses such an amino acid sequence, may also be used to identify or develop compounds or other factors that can modulate the (biological) activity of, or that can otherwise interact with, the amino acid sequences of the invention, and such uses form further aspects of the invention. As will be clear to the skilled person, in this context, the amino acid sequence of the invention will serve as a target for interaction with such a compound or factor.

SCREENING FOR MMP BINDING ACTIVITY Peptide sequence of the invention can be used to provide in vitro and in vivo methods of assaying for a modulator of MMP activity by identifying molecules that specifically bind the MMP, thereby affecting its activity. Antibodies Directed to MMP

Ewolyclonal or monocl'bnal antibodies can be used in vitro or in vivo to inhibit MMP activity. In one embodiment, antibodies are directed to active site binding domains on the MMP, as discussed above.

When used in assays to identify modulators of MMP and compositions that bind to the MMP, antibodies can non-covalently bind MMP is to the solid support. This can be done directly by binding MMP-specific antibodies directly to the support (e. g. , a column) and allowing MMP proteins to bind. Alternatively, it can be done by creating protein chimeras constructed from MMP linked to an appropriate immunoglobulin constant domain sequence, i. e. ,"immunoadhesins,"see, e. g. , Gascoigne (1987) Proc. Natl. Acad.

Sci. USA 84: 2936-2940; Capon (1989) Nature 377: 525-531; Traunecker (1989) Nature 33: 68-70.

Attaching of the MMP to Solid Supports Column Chromatography MMP, whether full length, or subsequences thereof (e. g. , an active domain or protein: protein binding domain) can be bound to a variety of solid supports. Solid supports that can be used in the methods of the invention include membranes (e. g. , nitrocellulose or nylon), microtiter dishes (e. g. , PVC, polypropylene, or polystyrene), test tubes (glass or plastic), dip sticks (e. g. , glass, PVC, polypropylene, polystyrene, latex and the like), microfuge tubes, or glass, silica, plastic, metallic or polymer beads or other substrates such as paper. One solid support uses a nickel column which binds with specificity to a histadine tag engineered onto a recombinant MMP-polyhistadine fusion protein (see fusion protein discussion, above).

Adhesion of a MMP"target"molecule to the solid support can be direct (i. e. directly contacting the solid support) or indirect (a particular compound or compounds are bound to the support and MMP binds to this compound rather than the solid support).

Immobilization of compounds can be covalent, e. g. , utilizing single reactive thiol groups of cysteine residues (see, e. g. , Colliuod (1993) Bioconjugate Chem. 4: 528-536).

Alternatively, compounds can be immobilized non-covalently but specifically, e. g. , via immobilized antibodies (see above), as described by Schuhmann (1991) Adv. Mater.

3: 388-391; Lu (1995) Anal. Chem. 67: 83-87; or, the biotin/strepavidin system, see, e. g., Iwane (1997) Biophys. Biochem. Res. Comm. 230: 76-80); or metal chelating, e. g., Langmuir-Blodgett films (Ng (1995) Langmuir 11: 4048-4055; Schmitt (1996) Angew.

Che itx d. Fiigl""'35 317 1) ; Frey (1996) Proc. Natl. Acad. Sci. USA 93: 4937-41; Kubalek (1994) J. Struct. Biol. 113: 117-123; or, metal-chelating self-assembled monolayers, see, e. g. , Sigal (1 996) Anal. Chem. 68: 490-497, for binding of polyhistidine fusion proteins.

Indirect binding of MMP can be achieved using a variety of linkers, many of which are commercially available. The reactive ends can be any of a variety of functionalities, e. g. , amino reacting ends such as N-hydroxysuccinimide (NHS) active esters, imidoesters, aldehydes, epoxides, sulfonyl halides, isocyanate, isothiocyanate, and nitroaryl halides; and thiol reacting ends such as pyridyl disulfides, maleimides, thiophthalimides, and active halogens. The heterobifunctional crosslinking reagents have two different reactive ends, e. g. , an amino-reactive end and a thiol-reactive end, while homobifunctional reagents have two similar reactive ends, e. g. , bismaleimidohexane (BMH) which permits the cross-linking of sulfhydryl-containing compounds. The spacer can be aliphatic or aromatic. Examples of commercially available homobifunctional cross-linking reagents include, but are not limited to, the imidoesters such as dimethyl adipimidate dihydrochloride (DMA), dimethyl pimelimidate dihydrochloride (DMP); and dimethyl suberimidate dihydrochloride (DMS). Heterobifunctional reagents include commercially available active halogen-NHS active esters coupling agents such as N-succinimidyl bromoacetate and N-succinimidyl (4-iodoacetyl) aminobenzoate (SIAB) and the sulfosuccinimidyl derivatives such as sulfosuccinimidyl (4-iodoacetyl) aminobenzoate (sulfo-SIAB) (Pierce Chemicals, Rockford, 111.). Another group of coupling agents is the heterobifunctional and thiol cleavable agents such as N-succinimidyl 3- (2- pyridyidithio) propionate (SPDP) (Pierce).

By manipulating the solid support and the mode of attachment of the target MMP molecule to the support, it is possible to control the orientation of the MMP. Thus, for example, where it is desirable to attach the MMP molecule to a surface in a manner that leaves a"tail" (preferably including an active site or a protein: protein binding site) free to interact with other molecules, e. g. , a MMP fusion protein with a binding domain and a non-MMP tag (e. g. , FLAG, myc, GST, polyHis, etc. ) for attachment to the column.

Once bound there are a variety of assay formats that can be used to screen for modulators of the MMP. For example, molecules that interact with a MMP binding domain can be identified by attaching the MMP to a solid support, contacting a second

nioleculc with the support"coated with MMP, and detecting the binding of the second molecule to the MMP. Molecules that interact or bind with the target are then eluted, thereby isolating molecules that interacted with the MMP.

Assays A variety of different assays for detecting compounds and compositions capable of binding MMP are used in this invention. For a general description of different formats for binding assays, see BASIC AND CLINICAL IMMUNOLOGY, 7. sup. th Ed. (D. Stiles and A. Terr, ed.) (1991) ; ENZYME IMMUNOASSAY, E. T. Maggio, ed. , CRC Press, Boca Raton, Fla. (1980) ; and"Practice and Theory of Enzyme Immunoassays"in P.

Tijssen, LABORATORY TECHNIQUES IN BIOCHEMISTRY AND MOLECULAR BIOLOGY, Elsevier Science Publishers, B. V. Amsterdam (1985).

In competitive binding assays, the test compound competes with a second compound (known to specifically bind MMP) for specific binding sites on the MMP molecule attached to the solid support. Binding is determined by assessing the amount of second compound associated with the fixed MMP molecule. The amount of second compound associated with MMP is inversely proportional to the ability of a test compound to compete in the binding assay.

The amount of inhibition or stimulation of binding of a labeled second compound by the test compound depends on the binding assay conditions and on the concentrations of labeled analyte and test compounds used. Under specified assay conditions, a test compound is said to be capable of inhibiting the binding of a second compound to a MMP target compound if the amount of bound second compound is decreased by 50% or more compared to a control (no test compound) sample.

Alternatively, various known or unknown compounds, including proteins, carbohydrates, and the like, can be assayed for their ability to directly, and specifically, bind to the target immobilized MMP. In one embodiment, samples from various tissues are contacted with MMP. In another embodiment, small molecule libraries and high throughput screening methods are used to identify compounds that bind to the target. The MMP-binding molecules is then eluted using any method, e. g. , column chromatography techniques.

Labels

Tlie"airiourit ot binamg ot a putative MMP-binding compound can be assessed by directly labeling the test compound with a detectable moiety. Alternatively, binding of the test compound can be detected by binding a labeled ligand that specifically binds to the test compound. A wide variety of labels can be used. The detectable labels can be primary labels (where the label comprises an element that is detected or that produces a directly detectable signal) or secondary labels (where the detected label binds to a primary label, e. g. , as is common in immunological labeling). An introduction to labels, labeling procedures and detection of labels is found in Polak and Van Noorden (1997) Introduction to Immunochemistry, 2. sup. nd ed., Springer Verlag, N. Y. and in Haugland (1996) Handbook of Fluorescent Probes and Research Chemicals, a combined catalog and handbook published by Molecular Probes, Inc. , Eugene, Oreg. Useful primary and secondary labels can include spectral labels such as fluorescein isothiocyanate (FITC) and Oregon Green. TM., rhodamine and derivatives (e. g. Texas red, tetrarhodimine isothiocyanate (TRITC), etc. ), digoxigenin, biotin, phycoerythrin, AMCA, CyDyes. TM., and the like), radiolabels (e. g.,. sup. 3 H,. sup. 125 I,. sup. 35 S,. sup. 14 C or. sup. 32 p), enzymes (e. g. horseradish peroxidase, alkaline phosphatase, etc. ), spectral calorimetric labels such as colloidal gold and colored glass or plastic (e. g. polysytrene, polypropylene, latex, etc. ) beads. The choice of label depends on sensitivity required, ease of conjugation with the compound, stability requirements, and available instrumentation.

Typical detectors include spectrophotometers, phototubes and photodiodes, microscopes, scintillation counters, cameras, film and the like, as well as combinations thereof. Examples of suitable detectors are widely available from a variety of commercial sources known to persons of skill.

In this context, the terms"modulate","modulation,"modulator"and"target"will have their usual meaning in the art, for which reference is inter alia made to the definitions given in WO 98/06737. Generally, a modulator is a compound or factor that can enhance, inhibit or reduce or otherwise alter, influence or affect (collectively referred to as"modulation") a functional property of a biological activity or process (for example, the biological activity of an amino acid sequence of the invention).

In this context, the amino acid sequence of the invention may serve as a target for modulation in vitro (e. g. as part of an assay or screen) or for modulation in vivo (e. g. for modulation by a compound or factor that is known to modulate the target, which

be used as an active compound for agrochemical, veterinary or pharmaceutical use).

For example, the amino acid sequences, host cells or host organisms of the invention may be used as part of an assay or screen that may be used to identify or develop modulators of the amino acid sequence of the invention, such as a primary screen (e. g. a screen used to identify modulators of the target from a set or library of test chemicals with unknown activity with respect to the target) or a secondary assay (e. g. an assay used for validating hits from a primary screen or used in optimizing hit molecules, e. g. as part of hits-to-leads chemistry).

High-Throughput Screening of Candidate Agents that Bind MMP Conventionally, new chemical entities with useful properties are generated by identifying a chemical compound (called a"lead compound") with some desirable property or activity, creating variants of the lead compound, and evaluating the property and activity of those variant compounds. However, the current trend is to shorten the time scale for all aspects of discovery. Because of the ability to test large numbers quickly and efficiently, high throughput screening (HTS) methods are replacing conventional lead compound identification methods.

In one embodiment, high throughput screening methods are used to identify compositions that specifically bind MMP and modulate its activity. This involves providing a library containing a large number of potential compounds (candidate compounds). Such"combinatorial chemical libraries"are then screened in one or more assays to identify those library members (particular chemical species or subclasses) that bind MMP. The compounds thus identified can serve as conventional"lead compounds" or can themselves be used as potential or actual reagents.

Combinatorial Chemical Libraries A combinatorial chemical library is a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis by combining a number of chemical"building blocks"such as reagents. For example, a linear combinatorial chemical library such as a library is formed by combining a set of chemical building blocks called amino acids in every possible way for a given compound length (i. e. , the number of amino acids in a compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks. For example, the systematic,

'°'oiizbiriatorial mixing ot luu mterchangeable chemical building blocks can result in the theoretical synthesis of 100 million tetrameric compounds or 10 billion pentameric compounds (see, e. g. , Gallop (1994) 37: 1233-1250).

Preparation and screening of combinatorial chemical libraries is well known to those of skill in the art. Such combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e. g., U. S. Pat. No. 5, 010, 175, Furka (1991) Int. J. Pept. Prot.

Res. , 37: 487-493, Houghton (1991) Nature, 354: 84-88). Peptide synthesis is by no means the only approach envisioned and intended for use with the present invention. Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to: peptoids (PCT Publication No WO 91/19735, Dec. 26, 1991), encoded peptides (PCT Publication WO 93/20242, Oct. 14,1993), random bio- oligomers (PCT Publication WO 92/00091, Jan. 9,1992), benzodiazepines (U. S. Pat. No.

5,288, 514), diversomers such as hydantoins, benzodiazepines and dipeptides (Hobbs (1993) Proc. Nat. Acad. Sci. USA 90 : 6909-6913), vinylogous s (Hagihara (1992) J.

Amer. Chem. Soc. 114: 6568), nonpeptidal peptidomimetics with a Beta-D-Glucose scaffolding (Hirschmann (1992) J. Amer. Chem. Soc. 114: 9217-9218), analogous organic syntheses of small compound libraries (Chen (1994) J. Amer. Chem. Soc. 116: 2661), oligocarbamates (Cho (1993) Science 261: 1303), and/or peptidyl phosphonates (Campbell (1994) J. Org. Chem. 59: 658). See, generally, Gordon (1994) J. Med. Chem. 37: 1385, nucleic acid libraries, peptide nucleic acid libraries (see, e. g. , U. S. Pat. No. 5,539, 083) antibody libraries (see, e. g. , Vaughn (1996) Nature Biotechnology 14: 309-314), and PCT/US96/10287), carbohydrate libraries (see, e. g. , Liang (1996) Science 274: 1520-1522, and U. S. Pat. No. 5,593, 853), and small organic molecule libraries (see, e. g., benzodiazepines, Baun (1993) C&EN, Jan 18, page 33, isoprenoids U. S. Pat. No.

5,569, 588, thiazolidinones and metathiazanones U. S. Pat. No. 5,549, 974, pyrrolidines U. S.

Pat. Nos. 5,525, 735 and 5,519, 134, morpholino compounds U. S. Pat. No. 5,506, 337, benzodiazepines U. S. Pat. No. 5, 288, 514).

Devices for the preparation of combinatorial libraries are commercially available; see, e. g. , 357 MPS, 390 MPS, Advanced Chem Tech, Louisville Ky.; Symphony, Rainin, Woburn, Mass.; 433A Applied Biosystems, Foster City, Calif.; 9050 Plus, Millipore, Bedford, Mass.; the Ultra-high Throughput Screening System (UHTSS. TM. ) capable of screening over 100,000 compounds per day, Aurora BioSciences, San Diego, Calif.

A* number 01 well known robotic systems have also been developed for solution phase chemistries. These systems include automated workstations like the automated synthesis apparatus developed by Takeda Chemical Industries, LTD. (Osaka, Japan) and many robotic systems utilizing robotic arms (Zymate II, Zymark Corporation, Hopkinton, Mass.; Orca, Hewlett-Packard, Palo Alto, Calif.) which mimic the manual synthetic operations performed by a chemist. Any of the above devices are suitable for use with the present invention. The nature and implementation of modifications to these devices (if any) so that they can operate as discussed herein will be apparent to persons skilled in the relevant art. In addition, numerous combinatorial libraries are themselves commercially available (see, e. g. , ComGenex, Princeton, N. J.; Tripos, Inc. , St. Louis, Mo.; 3D Pharmaceuticals, Exton, Pa.; Martek Biosciences, Columbia, Md.).

High Throughput Assays of Chemical Libraries Any of the assays for compounds capable of binding MMP and/or modulating MMP activity described herein are amenable to high throughput screening. These systems (examples of which as described, above) can automate entire procedures including all sample and reagent pipetting, liquid dispensing, timed incubations, and final readings of the microplate in detector (s) appropriate for the assay. These configurable systems provide high thruput and rapid start up as well as a high degree of flexibility and customization.

ASSAYS TO IDENTIFY MODULATORS OF MMP ACTIVITY The invention provides methods of assaying for modulators of MMP activity. Any means can be used to determine if a composition activates or inhibits MMP activity, including in vitro and in vivo assays. All of these assays (particularly the in vitro assays) can be designed for high throughput assay methodologies, as described above. While the invention is not limited by what means a composition inhibits or activates MMP activity or by what assay this modulation is determined, several exemplary means are described below.

For instance, such an assay or screen may be configured as an in vitro assay or screen, which will generally involve binding of the compound or factor to be tested as a potential modulator for the target (herein below also referred to as"test chemical") to the target, upon which a signal generated by said binding is measured. Suitable techniques for such in vitro screening will be clear to the skilled person, and are for example described in Eldefrawi et al. , (1987). FASEB J. , Vol. 1, pages 262-271 and Rauh et al. , (1990), Trends

in Pharmacol. Sci., vol. 11, pages 325-329. For example, such an assay or screen may be configured as a binding assay or screen, in which the test chemical is used to displace a detectable ligand from the target (e. g. a radioactive or fluorescent ligand), upon which the amount of ligand displaced from the target by the modulator is determined.

Such an assay or screen may also be configured as a cell-based assay or screen, in which a host cell of the invention is contacted with or exposed to a test chemical, upon which at least one biological response by the host cell is measured.

Also, such an assay or screen may also be configured as an whole animal screen, in which a host organism of the invention is contacted with or exposed to a test chemical, upon which at least one biological response (such as a phenotypical, behavioral or physiological change, including but not limited to paralysis or death) by the host organism is measured.

Thus, generally, the assays and screens described above will comprise at least one step in which the test chemical is contacted with the target (or with a host cell or host organism that expresses the target), and in particular in such a way that a signal is generated that is representative for the modulation of the target by the test chemical. In a further step, said signal may then be detected.

Accordingly, in one aspect, the invention relates to a method for generating a signal that is representative for the interaction of an amino acid sequence of the invention with a test chemical, said method at least comprising the steps of : a) contacting the amino acid sequence of the invention, or a host cell or host organism containing or expressing an amino acid sequence, with said test chemical, in such a way that a signal may be generated that is representative for the interaction between said test chemical and said amino acid sequence; and optionally b) detecting the signal that may thus be generated.

In another aspect, the invention relates to a method for identifying modulators and/or inhibitors of an amino acid sequence of the invention (e. g. from a set or library of test chemicals), said method at least comprising the steps of : a) contacting the amino acid sequence of the invention, or a host cell or host organism containing or expressing an amino acid sequence, with a test chemical, in such a way that a signal may be generated that is representative for the interaction between said test chemical and said the target; and optionally

b')'Uetectmg"the signal tnat may mus be generated, said signal identifying the modulator and/or inhibitor of said amino acid sequence.

Accordingly, the present invention provides methods of identifying a modulator and/or inhibitor of a Hemipteran membrane-bound matrix metalloproteinase protein activity. In preferred embodiments, the Hemipteran membrane-bound matrix metalloproteinase protein used in the methods has an amino acid sequence selected from the group consisting of : SEQ ID NO: 4, a mutant thereof, a fragment thereof, SEQ ID NO: 5, a mutant thereof, and a fragment thereof, preferably SEQ ID NO: 4. In some embodiments, the nucleic acid sequence that encodes the Hemipteran membrane-bound matrix metalloproteinase is SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, preferably SEQ ID NO : 1.

A test chemical may be part of a set or library of compounds, which may be a diverse set or library or a focussed set or library, as will be clear to the skilled person. The libraries that may be used for such screening can be prepared using combinatorial chemical processes known in the art or conventional means for chemical synthesis.

The assays and screens of the invention may be carried out at medium throughput to high throughput, for example in an automated fashion using suitable robotics. In particular, in this embodiment, the method of the invention may be carried out by contacting the target with the test compound in a well of a multi-well plate, such as a standard 24,96, 384,1536 or 3456 well plate.

Usually, in a screen or assay of the invention, for each measurement, the target or host cell or host organism will be contacted with only a single test compound. However, it is also within the scope of the invention to contact the target with two or more test compounds-either simultaneously or sequentially-for example to determine whether said combination provides a synergistic effect.

Once a test chemical has been identified as a modulator and/or inhibitor for an amino acid sequence of the invention (e. g. by means of a screen or assay as described hereinabove), it may be used per se as a modulator and/or inhibitor of the relevant amino acid sequence of the invention, preferably, an amino acid sequence of SEQ ID NO: 4, a mutant thereof, a fragment thereof, SEQ ID NO: 5, a mutant thereof, and a fragment thereof, more preferably SEQ ID NO: 4 (e. g. as an active substance for agrochemical,

veterinary or pnarmaceuucaruscj, or it may optionally be further optimized for final use, e. g. to improve properties such as solubility, adsorption, bio-availability, toxicity, stability, persistence, environmental impact, etc.. It will be clear to the skilled person that the nucleotide sequences, preferably SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3, more preferably SEQ ID NO: 1, amino acid sequences, host cells or host organisms and methods of the invention may find further use in such optimization methodology, for example as (part of) secondary assays.

The invention is not particularly limited to any specific manner or mechanism in or via which the modulator and/or inhibitor (e. g. the test chemical, compound or factor) modulates, inhibits, or interacts with, the target (in vivo or in vitro). For example, the modulator and/or inhibitor may be a competitive inhibitor, a non-competitive inhibitor, a cofactor, an allosteric inhibitor or other allosteric factor for the target, or may be a compound or factor that enhances or reduces binding of target to another biological component associated with its (biological) activity, such as another protein or polypeptide, a receptor, or a part of organelle of a cell. As such, the modulator and/or inhibitor may bind with the target (at the active site, at an allosteric site, at a binding domain or at another site on the target, e. g. covalently or via hydrogen bonding), block and/or inhibit the active site of the target (in a reversible, irreversible or competitive manner), block and/or inhibit a binding domain of the target (in a reversible, irreversible or competitive manner), or influence or change the conformation of the target.

As such, the test chemical, modulator and/or inhibitor may for instance be: - an analog of a known substrate of the target; - an oligopeptide, e. g. comprising between 2 and 20, preferably between 3 and 15 amino acid residues ; - an antisense or double stranded RNA molecule ; - a protein, polypeptide ; - a cofactor or an analog of a cofactor.

The test chemical, modulator and/or inhibitor may also be a reference compound or factor, which may be a compound that is known to modulate, inhibit or otherwise interact with the target (e. g. a known substrate or inhibitor for the target) or a compound or factor that is generally known to modulate, inhibit or otherwise interact with other members from

tne'generar"class"tb tò thtwtnelttarget belongs (e. g. a known substrate or inhibitor of said class).

Preferably, however, the test chemical, modulator and/or inhibitor is a small molecule, by which is meant a molecular entity with a molecular weight of less than 1500, preferably less than 1000. This may for example be an organic, inorganic or organometallic molecule, which may also be in the form or a suitable salt, such as a water- soluble salt. The term"small molecule"also covers complexes, chelates and similar molecular entities, as long as their (total) molecular weight is in the range indicated above.

As already mentioned above, the compounds or factors that have been identified or developed as modulators and/or inhibitors of the amino acid sequences of the invention, preferably, an amino acid sequence of SEQ ID NO: 4, a mutant thereof, a fragment thereof, SEQ ID NO: 5, a mutant thereof, and a fragment thereof, more preferably SEQ ID NO: 4, (and precursors for such compounds) may be useful as active substances in the agrochemical, veterinary or pharmaceutical fields, for example in the preparation of agrochemical, veterinary or pharmaceutical compositions, and both such modulators as well as compositions containing them further aspects of the invention.

For example, in the agrochemical field, the modulators and/or inhibitors of the invention may be used as an insecticide, nematicide, molluscide, helminticide, acaricide or other types of pesticides or biocides, e. g. to prevent or control (infestations with) harmful organisms, both as contact agents and as systemic agents. As such, the modulators and/or inhibitors may for example be used as a crop protection agent, as a pesticide for household use, or as an agent to prevent or treat damage caused by harmful organisms (e. g. for the protection of seed, wood or stored crops or fruits). Preferably, the modulators and/or inhibitors of the invention are used as insecticides.

For any such application, one or more modulators and/or inhibitors of the invention may be suitably combined with one or more agronomically acceptable carriers, adjuvants or diluents-and optionally also with one or more further compounds known per se with activity as (for example) a plant protection agent (to broaden the spectrum of action and optionally to provide a synergistic effect), herbicide, fertilizer or plant growth regulator- to provide a formulation suitable for the intended final use. Such a formulation may for example be in the form of a solution, emulsion, dispersion, concentrate, aerosol, spray, powder, flowable, dust, granule, pellet, fumigation candle, bait or other suitable solid,

semi-solid or liquid tomiuiaiion, and may optionally also contain suitable solvents, emulsifiers, stabilizers, surfactants, antifoam agents, wetting agents, spreading agents, sticking agents, attractants or (for a bait) food components. Reference is made to the standard manuals, such as"Pesticidal Formulation Research", ACS-publications (1969) and"Pesticide Formulations", Wade van Valkenburg Ed, Marcel Dekker publications (1973).

Such compositions may generally contain one or more modulators and/or inhibitors of the invention in a suitable amount, which generally may be between 0.1 and 99 %, and in particular between 10 and 50 %, by weight of the total composition.

The modulators and/or inhibitors and compositions of the invention may be particularly useful as insecticides, for example to combat or control undesired or harmful insects (both adult and immature forms, such as larvae) from following orders: - Coleoptera, such as Pissodes strobi, Diabrotica undecimpunctata howardi, and Leptinotarsa decemlineata ; -Diptera, such as Rhagoletis pomonella, Mayetiola destructor, and Liriomyza huidobrensis ; -Hymenoptera, such as Neodiprion taedae tsugae, Camponotus pennsylvanicus, and Solenopsis wagner, - Hemiptera, such as Pseudatomoscelis seriatus, Lygus lineolaris (Palisot de Beauvois), Acrosternum hilare, and Aphis gossypii -Homoptera, and - Lepidoptera, such as Heliothis virescens.

When used to control harmful or undesired organisms, these organisms may be directly contacted with the modulators, inhibitors, or compositions of the invention in an amount suitable to control (e. g. kill or paralyze) the organism. This amount may be readily determined by the skilled person (e. g. by testing the compound on the species to be controlled) and will usually be in the region of between particular between 10 and 500 g/ha, in particular between 100 and 250 g/ha.

The modulators, inhibitors, or compositions of the invention may also be applied systemically (e. g. to the habitat of the organism to be controlled or to the soil), and may also be applied to the plant, seed, fruit etc. to be protected, again in suitable amounts, which can be determined by the skilled person. The modulators and/or inhibitors of the

invention may also be mcorporated - e. g. as additives-in other compositions known per se, for example to replace other pesticidal compounds normally used in such compositions.

In one specific embodiment, the modulators and/or inhibitors and compositions of the invention may be used in the fields of agrochemical, veterinary or human health to prevent or treat infection or damage or discomfort caused by parasitic organisms, and in particular by parasitic arthropods, nematodes and helminths such as: - ectoparasitic arthropods such as ticks, mites, fleas, lice, stable flies, horn flies, blowflies and other biting or sucking ectoparasites; - endoparasites organisms such as helminths ; and also to prevent or treat diseases that are caused or transferred by such parasites. For such purposes, the modulators and/or inhibitors of the invention may for example be formulated as a tablet, an oral solution or emulsion, an injectable solution or emulsion, a lotion, an aerosol, a spray, a powder, a dip or a concentrate.

In the fields of animal and human health, the modulators, inhibitors, and compositions of the invention may also be used for the prevention or treatment of diseases or disorders in which the amino acid sequence of the invention may be involved as a target. For this purpose, the modulators and/or inhibitors of the invention may be formulated with one or more additives, carriers or diluents acceptable for pharmaceutical or veterinary use, which will be clear to the skilled person.

Thus, in a further aspect, the invention relates to the use of a modulator and/or inhibitor of the invention in the preparation of a composition for agrochemical, veterinary or pharmaceutical use, as described hereinabove. The invention relates to the use of the modulators, inhibitors and compositions of the invention in controlling harmful organisms and in preventing infestation or damage caused by harmful organisms, again as described above.

The invention will now be further illustrated by means of the following non- limiting Experimental Part.

Experimental Part:

Example 1 - Cotton Aphid ("CA") Membrane-Bound Matrix Metalloproteinase Sequence Identifications Materials and Methods.

Isolation of poly (A+) RNA. Cotton aphids were collected from cotton plants and placed in ice-chilled glass centrifuge tubes which had been cleaned and baked for 6 hours at 180°C prior to use. Aliquots of approximately 0.4 gram of cotton aphids was used for isolation of poly (A) RNA.

Diethyl pyrocarbonate (DEPC) -treated water was made by incubating DEPC (Aldrich Chemical Co. , Inc. Milwaukee, WI) in water at concentration of 0. 1% (v/v) for 16 hours at room temperature, followed by autoclaving. The microprobe of a Braun homogenizer (B. Brawn Biotech International, Allentown, PA) was soaked in 100% ethanol and dried prior to use.

RNA isolation was done using QuickPrep mRNA Purification kit (Amersham Pharmacia biotech, Piscataway, NJ) according to the manufacturer's instruction. All the buffers and solutions mentioned here are included in the kit. An aliquot of 0.4 gram of cotton aphid was homogenized at full speed in 1.5 ml chilled extraction buffer until it is in a uniform suspension. After adding 3 ml of elution buffer, the sample was homogenized again briefly and the resulting mixture was centrifuged at approximately 12000 x g for 10 minutes at room temperature. The supernatant was used for poly (A+) RNA isolation.

After application of supernatant to the resin of oligo (dT) -cellulose spun column, washing with high salt and low salt buffers, the bound poly (A+) RNA was eluted with three washes of 0.25 ml elution buffer pre-warmed to 65°C. To precipitate the mRNA, 50 ut off Acetate solution, 10 pt1 of Glycogen solution, and 1 ml of 95% Ethanol were added to 0.5 ml of elute. The mixture was placed at-20°C for one hour and then centrifuged at maximal speed. Precipitated poly (A+) RNA was then dissolved in 50 1ll DEPC-treated water and stored at-80°C until use.

Reverse Transcription, PCR amplification, and 5'RACE. RT-PCR was accomplished using the Thermoscript RT-PCR system (Invitrogen, Carlsbad, CA).

Reverse transcription was initiated by addition of 1 1 Thermoscript reverse transcriptase to 0.3 pg of cotton aphid poly (A+) RNA in a 20 Ill reaction. The reverse transcription reaction also included the following reagents contained in the

rhermoscri'pt'i"M RT-PCR system: 1 µl of oligo dT primer (50 uM), 4 1 5x cDNA Synthesis Buffer, 1 p1 RNaseOUTTM, 1 p1 0.1 M DTT. The reactions were placed on a Geneamp 9600 thermal cycler (Perkin-Elmer-ABI) and held for 25°C for 10 minutes then 50°C for 50 minutes. The reaction was terminated by incubation at 85°C for 5 minutes and then stored at-20°C or used immediately.

PCR amplification was accomplished using 2 IAI from reverse transcription reaction above as template in a 50 u. l reaction. The reaction mixture also contains the following: 5 al of 10X PCR buffer, 1. 5 ul of 50 mM MgCl2, 1 ul of 10 mM dNTP, lul of 10 uM sense primer, 1 p1 of 10 uM antisense primer, 0.4 Ill of Platinum Tag DNA polymerase (5 U/gl), and 38. 1 , l of DEPC-treated water. PCR was run on a Perkin Elmer cycler using the following cycling conditions. The reaction mix was subject to initial denaturing at 94°C for 5 minutes. The first 20 cycles were"touch down"cycles with annealing temperature progressively decreasing by 0. 5°C. For these 20 cycles, the denaturing was at 94°C for 15 seconds, the annealing was for 20 seconds at 60°C for the first cycle, and the last cycle at 50. 5°C. The extention was at 68°C for 2 minutes. Following this was the 25 cycles of PCR amplification: denaturing at 94°C for 20 seconds, annealing at 56°C for 20 seconds, and extension at 68°C for 2 minutes.

Gene specific antisense primers were designed from FMC proprietary EST sequence information. One EST clone was determined to be a portion of aphid MMP gene. This EST, encoding 245 amino acids, covers the 3 prime portion of the gene that extends to the stop codon and includes the 3'untranslated region. Two antisense primers were synthesized: 2064L (ATAATAAATCGATGCGGTCCC), (SEQ ID NO : 6) and 1942L (CGCCTCACATCCAGCCACGAC) (SEQ ID NO : 7). A degenerate primer was designed from conserved region (PRCGVP [R] D): 673U2 (GCCTCGGTGCGGHGTVCGNGA) (SEQ ID NO : 8).

PCR was first carried out with 673U2 and 2064L as sense and antisense primers, respectively. For secondary"nested"amplifications were carried out, 2 u. l of first PCR amplification reaction was used to provide template, with 673U2 and 1942L as sense and antisense primers respectively. The PCR products were characterized by agarose gel electrophoresis. PCR product (named PRC2) was then cloned into pCRII TOPO vector for sequencing.

5'RACE using the Gene Racer method. 5'RACE was carried out using GeneRacer kit (Invitrogen, Carlsbad, CA). poly (A+) RNA was first treated with calf intestinal phosphatase (CIP) to remove 5'phosphate from partial transcripts, then treated with tobacco acid pyrophosphatase (TAP), which removes the cap from capped full-length mRNA, exposing the 5'phosphate and permitting ligation of GeneRacer RNA Oligo. The GeneRacer RNA Oligo (CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA) (SEQ ID NO : 17) was ligated to the above treated mRNA with T4 RNA ligase. First strand cDNA is generated using a gene specific primer (GTCGTCCATTGTAGTGTCAG) (SEQ ID NO : 9). The 5'end of the transcript is amplified with a gene specific primer whose sequence (CTGATTTCGATGTGCACTTGGCCAGAC) (SEQ ID NO : 10) was derived from PRC2, as the 3'primer, and a 5'primer whose sequence (CGACTGGAGCACGAGGACACTGA) (SEQ ID NO : 11) was derived from the ligated GeneRacer RNA Oligo. The PCR conditions were as follows: initial denaturing at 94°C for 2 min, followed by 34 cycles of denaturing at 94°C for 1 minute, annealing at 61°C for 1 minute and 30 seconds, and extension at 72°C for 2 minutes, which was then followed by extension at 72°C for 10 minutes. The resulting 881bp PCR product (named MMP9) was cloned into pCRII TOPO for sequencing.

Subcloning and sequencing. PCR fragments were subcloned into pCRII-TOPO vector using a TOPO TA Cloning kit (available from Invitrogen Corp. ) according to the manufacturer's instructions. The resulting clones were sequenced by SeqWright Inc. and then analyzed using VectorNTI suite 6.0 software.

Primers. The primers utilized were as follows: Primer Sequence Orientation 2064L (SEQ ID NO : 6) vrimer Orientation 1942L (SEQ ID NO : 7) 673U2 (SEQ ID NO : 8) GSPI (SEQ ID NO : antisense 9) GSP2 (SEQ ID NO : 10) GeneRacer CGACTGGAGCACGAGGACACTGA (SEQ sense ID : 11)

Example 2-Construction of Histine-tagged Cotton Aphid Membrane-bound Matrix Metalloproteinase expression vector (pHis-MMP) Materials and Methods PRC2 was used as the template to amplify the MMP cDNA for the catalytic domain (amino acid 20 to 180) and to introduce an enterokinase cleavage (EK) site. This sequence was obtained by two sequential PCR reactions. The upstream primer used in the first PCR reaction encoded part of the EK site (last 4 amino acids) whereas the downstream primer encoded the STOP codon and carried a Hind III restriction site. (See below for primer sequences). Following amplification with the thermostable Pfu DNA polymerase, the PCR product was diluted and used as a template for a second amplification using a downstream primer overlapping the STOP codon along with an upstream primer encoding the first amino acid of the EK site and a Bgl II restriction site.

The PCR product obtained from the second PCR reaction was gel-purified and ligated into transfer vector pCR Blunt II TOPO (Invitrogen) per manufacturer's instructions. An aliquot of the ligation reaction was used to transform competent One Shot Top 10 E. coli cells (Invitrogen) according to the manufacturer's instructions. Clones were picked and used for small-scale DNA preparation, and the DNA was subjected to restriction analysis.

Two clones showing the expected restriction pattern were chosen and their inserts were fully sequenced to confirm the integrity of the sequences coding for the MMP catalytic

domain, the EK site, and the presence of the STOP codon. One clone was chosen for further work. Primer sequences : Primers for first PCR reaction : MMP primer (SEQ ID NO : 12) 5'-GAT Partial Enterokinase site MMP sequence MMP/Hind III primer (-) ID NO : 13) 5'GG'AAG CTA GG-3' HindIII HindIII Stop MMP sequence Primers for second PCR reaction : BglII/MMP primer (+) : (SEQ ID NO : 14) Bgl Bgl II Complete Enterokinase site MMP sequence MMP primer x . - -..- 5'CCCGCG GCGHrAAG'CTT C-TA ACCGT'A GAG AGr-3' Hind III Stop MMP sequence In order to generate the pHis-MMP fusion construct, the sequence coding for MMP (with the EK site) was excised from pCR Blunt II TOPO/MMP using BglII and HindIII, gel- purified and ligated into the pQE30 vector (Qiagen) previously digested with BamHI and HindIII per manufacturer's instructions.

Example 3--Expression of Histine-tagged Cotton Aphid Membrane-bound Matrix Metalloproteinase fusion Protein (His-MMP) Materials and Methods M15 cell transformation with pHis-MMP expression vector. The pHis-MMP construct generated in example 2 was used to express the catalytic domain of the insect MMP containing a His tag at the N-terminus and an enterokinase cleavage site between the tag and the enzyme itself (i. e. His-EK-MMP). An aliquot of the ligation reaction from example 2 was used to transform competent M15 (pREP4) E. coli cells, which carried the

pREP4 plasmid encoding the lacIq repressor and was used for protein expression. Clones were picked and used for small-scale DNA preparation, and the DNA was subjected to restriction analysis. A clone with the expected restriction pattern was chosen and used to inoculate a 100-ml culture. A large-scale plasmid preparation was performed using the Qiagen Maxi-prep kit. Purity of the plasmid preparation was confirmed by UV spectrophotometry, and a complete restriction analysis of the DNA was carried out to confirm the presence of MMP sequences as well as the orientation of the insert. Finally, the regions spanning the site of insertion were sequenced to confirm the correctness of the reading frame relative to the His-tag and the presence of the STOP codon.

Bacterial Overexpression of His-MMP Fusion Protein. E. coli strain M15 containing pHis-MMP was grown in 3 liter LB medium containing 100 0 g/ml carbencillin at 37°C until the absorbance at 600 nm reached 0.6. Cells were then induced for protein expression with 1 mM IPTG at 37°C for 3 hours. A small portion of cells before the IPTG induction was retained and used as a negative control. Cells were harvested by centrifugation at 7,500 x g, 4°C for 20 minutes, washed once with cold PBS, and stored at - 80°C until use.

In order to determine expression level and the solubility of the recombinant His- MMP fusion protein, cells were resuspended in lysis buffers (50 mM NaH2 ? 04, pH 8.0, 100 mM NaCl, and 1% Triton X-100) supplemented with Complete (EDTA-free) protease inhibitor contail (Boehringger Mannheim). After lysozyme (0.1 mg/mL) was added, cells were incubated on ice with gentle rocking for 30 minutes. Cells were sonicated using six bursts of 10 sec in a Misonix sonicator equipped with a microtip and set at intensity level 3. The mixture was then treated with DNase I and RNase A for 20 minutes at 4°C in the presence of 2 mM MgCl2. The lysate (crude extract) was centrifuged at 15,000 x g for 15 minutes at 4°C, and both the supernatant, corresponding to the soluble fraction, and the pellets, corresponding to the inclusion bodies, were collected. The crude extract, the soluble fraction, and the inclusion bodies were analyzed with SDS-PAGE and Western blotting.

For SDS-PAGE, NuPage system (Novex) was used. Reduced samples were prepared per manufacturer's recommendations. They were then subjected to electrophoresis in 4-12% Bis-Tris acrylamide NuPAGE gradient gels using MES buffer.

The resulting protein bands were either stained with Coomassie R-250 or transfered to a Hybond-ECL nitrocellulose membrane for 1 hour at 30V.

For Western blotting, the Penta-His HRP Conjugate kit (Qiagen) was used. The membranes were first washed with TBS buffer for 2 x 10 minutes, then blocked for 1 hour with the Blocking Reagent Buffer containing 0. 1 % (v/v) Tween 20. After two washes with TBS containing 0. 1% Tween-20, the membranes were incubated with Penta-His HRP conjugate antibody diluted 1: 2,000 in Blocking Reagent Buffer for 1 hour at room temperature. The membranes were subsequently washed twice for 5 min with TBS containing 0.1 % Tween-20, then twice for 15 min with the same buffer. ECL detection was finally carried out using Western Blot Chemiluminescence Reagent Plus Kit (NEN Life Sciences).

Example 4-Purification of Bacterial Expressed His-MMP fusion protein Materials and Methods Purification of His-MMP inclusion bodies by Ni-NTA affinity chromatography under denaturing conditions. On the day of purification, cells were thawed briefly at 37°C, and resuspended in lysis buffer (lOOmM Tris, 5 mM CaCl2, 0.5 mM ZnS04, 0.05% Brij-35, pH 7.5, containing Complete (EDTA-free) protease inhibitor contail (Boehringger Mannheim) and 100 uM PMSF). Inclusion bodies were prepared following the Novagen protocol (pET System Manual, ninth edition).

The purified inclusion bodies were extracted with binding buffer (8 M urea, 0.5 M NaCl, 20 mM Tris, pH 7.5, containing 5 mM imidazole). The extract was purified by centrifugation at 50,000 x g before loading onto a 2 ml Ni-NTA agarose column. The affinity column was washed consecutively with 5 mM and 20 mM imidazole in the binding buffer, and eluted with 200 mM imidazole in binding buffer. All fractions from the washing step as well as the elution step were collected and analyzed by SDS PAGE/Coomassie stain and Western blot. Protein concentration of each fraction was also determined with Bradford reagent (BioRad) using BSA as a standard.

Refolding of His-MMP fusion protein. All steps were performed at 4°C unless otherwise noted. The His-MMP inclusion bodies eluted from the Ni-NTA column were dialyzed against 2 changes of 8 M urea, 50 mM Tris pH 7.5 to get rid of the imidozole.

"After dialysis, the inclusion"bodies suspension was added dropwise to 10 volume of refolding buffer (50 mM Tris pH 7.5, 1 mM CaCl2, and 0.1 mM ZnCl2) under constant stirring. The refolding mixture was then centrifuged at 20,000 x g, for 20 minutes, and both the supernatant and the pellet were collected. The pellet was dissolved in 8 M urea, 50 mM Tris pH 7.5, and refolding was repeated twice as above.

All of the 20,000 x g supernatants were analyzed by SDS PAGE/Coomassie for purity. Protein concentrations were determined with Bradford reagent (BioRad) using BSA as a standard, and activities confirmed (see below Enzymatic Assay). The purified supernatants were combined and concentrated by centrifugation in Centricon Plus with a molecular cutoff of 5000 Dalton, and then dialyzed against storage buffer (50 mM Tris pH 7.5, 200 mM NaCl, 5 mM CaCl2, 0.2 mM DTT, containing 20 uM ZnCl2). The storage protein stock was again analyzed by SDS PAGE/Coomassie. Its protein concentration was determined and activity assayed. The stock was then aliquoted 0.5 ml each, and kept at- 80°C until future use.

Example 5-Enzymatic assay of the recombinant Cotton Aphid Membrane- bound Matrix Metalloproteinase fusion Protein (His-MMP).

Materials and Methods Enzymatic activity of the purified recombinant insect His-MMP was detected using the synthetic fluorescent substrate (SEQ ID NO: 16) Mca-Pro-Leu-Gly-Leu-Dpa- Ala-Arg-NH2TFA [Dpa = N-3- (2, 4-dinitrophenyl) -L-2, 3-diaminopropionyl] (CalBiochem, San Diego, CA). Assays were routinely performed at 25°C for one hour using a substrate concentration of 10 uM in assay buffer containing 50 mM Tris, pH 7.5, 200 mM NaCl, 5 mM CaC12, and 200 pM ZnS04. The fluorometric measurements were made in a Fusion- Universal Microplate Analyzer (Available from Perkin-Elmer, Foster City, CA), with excitation wavelength at 325 nM, and emission at 395 nM. For inhibition assays, the recombinant insect His-MMP and inhibitors (10 M) were pre-incubated for 30 minutes at room temperature.