Technical field of the invention

The present invention refers to improved gene transfer vectors for gene therapy. Particularly, the present inventions relates to DNA sequences capable of enhancing expression of integration- defective lentiviral vectors (IDLVs).

Background of the invention

Lentiviral vectors (LVs) have proven to be highly successful in several gene therapy protocols over the last twenty years. Their success is partly explained by their ability to transduce dividing and non-dividing cells, including hematopoietic stem cells (HSCs) neurons and T cells. However, concerns have been raised regarding the potential risk of inherent insertional mutagenesis caused by integrative lentiviral vectors. The use of integration-defective lentiviral vectors (IDLVs) is a logical option for minimizing insertional mutagenesis risk when target cells are quiescent. IDLVs are also an interesting alternative for transient expression in dividing cells. As with their integrative counterpart, the tropism of IDLV particles can be altered and adapted to target cells pseudotyped with different envelope proteins.

Current research in the field of retroviral vectors shows that LVs are often more effective than their IDLV counterparts in terms of gene expression mainly due to the tendency of IDLVs to undergo epigenetic silencing as a result of nuclear chromatinization. In 2013, Pelascini and Gongalves showed that histone deacetylase (HDAC) activity is the principal cellular determinant underlying weak IDLV transcriptional activity. Different strategies have been used to enhance the transgene expression of episomal molecules in both viral- and non-viral-based systems. In non-viral episomal gene delivery systems, genomic elements based on scaffold/matrix attachment regions (S/MARs) are widely used to enhance transcription levels and to maintain long-term expression rates. This is mainly due to the capacity of S/MAR elements to bind transcription factors such as special A+T-rich binding protein 1 (SATB1), nuclear matrix protein 4 (Nmp4) and CCCTC-binding factor (CTCF), in addition to their capacity to promote nucleoprotein structural aggregation, histone acetyltransferase recruitment and ATP- dependent chromatin remodeling complexes. As with the S/MAR elements, the inclusion of other cis-acting elements based on the 5'HS4 chicken -globin insulator (cHS4) also increases non-viral episomal efficiency due, in part, to the interaction of the cHS4 element with the matrix via CTCF nuclear proteins. This nuclear factor avoids heterochromatin spreading in episomal DNA when bound to the cHS4 sequence.

Several research groups have achieved varying levels of success in their attempt to improve IDLV expression by inserting different fragments of the b-interferon S/MAR element into IDLVs. However, the use of SAR elements to improve IDLV transcription efficiency has only been studied in relation to lg-k MAR sequences. In addition, other group concluded that these elements had, in general, no effect on transduction efficiency and observed an improvement only in differentiated primary neural progenitor cells.

The authors of the present invention have previously reported that the inclusion of the IS2 element (which combines SAR2 and HS4-650 regions of a HS4 insulator) in LVs reduced biological viral titers but improved transgene expression and prevented epigenetic silencing in Human embryonic stem cells (hESCs) and hematopoietic pluripotent cells (HSCs). However, these positive effects were cell-type dependent since no improvement in transgene expression could be observed on K562 cells and other immortalized cell lines. However, the authors of the present invention, until now, had not yet tested whether the IS2 element could improve IDLV gene expression, and not only LV gene expression, in different cell types, in order to overcome the unresolved need to significantly improve IDLV gene expression.

Brief description of the invention

In the present invention, the inventors have tested whether the IS2 element could improve IDLV gene expression in different cell types. Although the presence of the IS2 element did not abrogate epigenetic silencing, it did improved IDLV efficiency in several cell lines. Surprisingly, in spite of the improved expression levels, the inclusion of the IS2 element into IDLVs (SE-IS2- IDLV) reduced 3-5 times the amount of episomal vector in transduced cells relative to those transduced with unmodified SE-IDLVs. We have estimated that the IS2 element enhances the transcriptional activity of SE-IS2-episomes 6-7 fold. The final effect of the IS2 element in IDLVs might depend on the target cell and the balance between the negative versus the positive effects of the IS2 element in each cell type. Finally, a fluorescence in situ hybridization (FISH) analysis suggested that the improved behavior SE-IS2-IDLVs episomes is probably due to a distinct nuclear re-positioning into transcriptionally active regions, as suggested by the aggregation of SE-IS2-IDLVs -episomes into DAPI-low regions. Brief of the fii

Figure 1. Inclusion of IS2 element into IDLVs enhances eGFP expression levels in 293T cells, (a) Schematic representation of SE-IS2, SE, SEWP-IS2, and SEWP. eGFP (enhanced green florescence protein); SFFV (spleen focus forming virus) promoter; WPRE (Woodchuck Hepatitis Virus Posttranscriptional Regulatory Element) (b) Representative plots showing eGFP expression profiles of 293 T cells transduced with the different IDLVs. MOI = 0.3 was used to maintain the percentage of eGFP+ cells below 50%. The eGFP+ population gates were set to 0.2-0.7% of eGFP+ cells in the untransduced population and subtracted from the % obtained under the different vectors and conditions for the analysis. The percentages (%) and expression levels (MFI) of the eGFP+ population are shown in each plot, (c) Graphs showing relative % of GFP+ cells (top graphs) and relative expression levels (MFI : bottom graphs) in 293T cells of SE- IS2-I DLVs and SE-IDLVs in the absence (Left graphs) or presence (Right Graphs) of the WPRE element. Values represent means + /- standard error of the mean (SEM) of at least four separate experiments (*p < 0.05).

Figure 2.Apicidin enhances gene expression of IDLV transduced cells independently of the presence of the IS2 element, (a). Representative Plots showing eGFP expression profiles of 293T cells transduced with the SE or SE-IS2 at MOI=0.2, in the absence or presence of 0.4 uMapicidin. (b) Graphs showing % of GFP+ cells transduced with the SE- or IS2- IDLVs in the absence (-) or presence (+) of 0.4 uMapicidin. T values represent means + /- SEM of at least four separate experiments (*p < 0.05).

Figure 3. The insertion of the IS2 element into the LV backbone reduces their efficiency to generate vector genomes in target cells, (a) Representative plots showing eGFP expression profiles of 293T cells transduced with integrative LVs (left plots) and IDLVs (right plots) with (SE- IS2) or without (SE) the IS2 element. All the experiments were carried out using 0.7 viral particle/cells, (b) Graphs showing the amounts of reverse transcribed products (Vector genomes) in 293T cells transduced with LVs (left) and IDLVs (right) with (SE-IS2) or without (SE) the IS2 element at 72h after transduction. A clear decrease in the amount of the viral genome can be observed in both LV and IDLV in the presence of the IS2 sequence.

Figure 4. The IS2 element does not affect stability of IDLVs episomes but enhance their transcriptional efficacy and relocate them into DAPI-low nuclear domains, a. Graph showing the relative amount of mRNA expression level of eGFP cDNA normalized to the amount of vector genomes in 293T cells transduced with IDLVs-SE and IDLVs-SE-IS2. b. Representative Plots showing the effect of the IS2 on the stability of the episomes over the time almost the episomes disappear 7 days after transduction, either in the presence or in the absence of IS2. c. relative amount of SE-IS2-IDLVs episomes related to SE-IDLVs at different time points post transduction. Nuclear distribution of IDLV episomes. The cells were transduced at MOI = 5 in order to obtain several episomes inside the cells. The cells were subsequently fixed, methanol permeabilized, and incubated with the labeled probes. The confocal images showed a differential localization of lentiviral episomes in the presence or in the absence of IS2. One representative experiment out of two is shown, d. Statistical analysis of nuclear overlap chromatine, the presence of the IS2 element precludes the IDLV episomes, form the dense chromatin regions.

Figure 5. Insertion of the IS2 element or a control 1.2kb fragment into the IDLVs reduce the total number of episomes and the formation of lower expressing 2-LTR circles (a) Schematic representation of SE, SE-IS2 and SE-1.2kb. eGFP (enhanced green florescence protein); SFFV (spleen focus-forming virus) promoter. Representative plots showing eGFP expression profiles of 293T cells transduced with the different IDLVs at MOI= 0.7. eGFP+ population gates were set to 0.8 % of eGFP+ cells in the untransduced population (NT; left plot) and subtracted from the % obtained under the different vectors and conditions for the analysis. The percentages (%) and expression levels (MFI) of the eGFP+ population are shown in each plot. (b). Graph showing the titere of the different IDLVs supernatants using the ABM's Lentiviral qPCR Titer Kit (see Material and Methods for details), (c). Relative amounts of vector genomes in 293T cells transduced with the different IDLVs at 72h post-transduction and normalized to the levels observed in SE IDLVs. (d). Graph showing the percentage of GFP positive cells in 293T cells transduced with the different IDLVs and normalized to the levels observed in SE IDLVs. (e). Graph showing the relative amounts of 2LTR circles relative to total viral genomes in 293T target cells at 72h post transduction and normalized to the levels observed in SE IDLVs. The values represent means + /- SEM of at least four separate experiments (*p < 0.05). The data were reported to an equal amount of cells, estimated by b-albumin housekeeping gene.

Figure 6. The IS2 sequence improves transgene expression in neural progenitor cells and in differentiated neuron-like cells, (a) Representative image (Left) and plots (Right) showing eGFP expression profiles of undifferentiated neural stem cells transduced at MOI=3 with SE, SE-IS2, SEWP and SEWP-IS2 IDLVs and analyzed 72h post-transduction. The percentage (%) of the eGFP+ cells and the eGFP expression levels (MFI) are shown in each plot. (b). Representative image (Left) and plots (Right) showing eGFP expression profiles of differentiated neuron-like cells (positive for b-tubulin, see M&M for details) transduced at MOI=3 with SE, SE-IS2, SEWP and SEWP-IS2 IDLVs and analyzed 72h post-transduction. The percentage (%) of the eGFP+ cells and the eGFP expression levels (MFI) are shown in each plot. (c). Graphs showing the relative transgene expression levels (MFI) of the NPC transduced with the different IDLVs. (d). Graphs showing the relative transgene expression levels (MFI) of the differentiated NPC transduced with the different IDLVs. Values represent means + /- SEM of at least four separate experiments (*p < 0.05).

Figure 7. The IS2 sequence improves transgene expression in iPSCs. (a). Representative plots showing eGFP expression profiles of iPSCs transduced with the SE, SE-IS2, SEWP and SEWPIS2 IDLVs at MOI=10 . The percentage (%) of the eGFP+ population and the relative transgene expression levels (MFI) are shown in each plot. (b). Graphs showing the relative percentage of eGFP positive cells (top) and the relative transgene expression levels (bottom) in iPSCs transduced with different IDLVs and normalized to the levels obtained with SE IDLVs. The values represent means + /- SEM of at least four separate experiments (*p < 0.05).

Figure 8. Effects of IS2 elements on IDLV at different MOI. 293. Representative plots showing eGFP expression profiles of 293 T cells transduced with increased MOIs of SE (top) and SE-IS2 (bottom) IDLVs. The percentages (%) and expression levels (MFI) of the eGFP+ population are shown in each plot.

Figure 9. Scheme showing the different forms of the IDLV genome during transduction of target cells. Vector RNA genome inside IDLV particles (top) enter the cytoplasm of the target cell (middle) where vector DNA sequences can already be found with complete 5'AU3RU5 LTRs can be found. Once the vector pre-integration complex enters the nucleus, the reverse transcription continues and in IDLVs generates mainly 1-LTR and 2-LTR DNA episomal circles, although some lineal DNAs forms can also be found. Primers used to detect the different forms of vector DNA are indicated with arrows. AU3fw and PBSrev primer set were used to detect the amount of total reverse transcribed products (vector DNA genomes). q2LTRfw and q2LTRrev primers were used to assess the relative amounts of 2LTR circles versus total vector DNA genomes. Figure lO.Confocal images showing nuclear localization of Viral Episomes. Nuclear distribution of IDLV episomes. 293T Cells were transduced at MOI = 5. The cells were subsequently fixed, methanol permeabilized, and incubated with the labeled probes. The confocal images showed a differential localization of lentiviral episomes in the presence or in the absence of IS2. Confocal images showing eight continuous optical sections, (Op. Sl-6) showing viral episomes localization within the nucleus of the transduced cells.

Figure 11. Images of NPCs differentiated into neuron-like cells. NPCs were cultured in neural differentiation media (See Material and Methods for details) and maintained at 37^C in 5% C02 for 28 days. Neural-like cells were fixed and permeabilized for 30 min and stained with anti-b- tubulin (b-tubulin (TUJ1) mouse monoclonal antibody and Goat anti-mouse IgG Alexa Fluor 488. Optical images were captured using a Zeiss LSM 710 confocal microscope and an Axio Imager A1 microscope.

Figure 12. Performance of the different IDLVs in various T cells subpopulations. Top plots show isotype controls (Left), single staining for CD45RA-PE (HI100 clone - Middle) and single staining for CD62L-PE-Cy7 (DREG56 clone - Right). T cells were transduced with the SE and the SE-IS2 IDLVs at MOI=5 and 72h later analyzed. The different transduced cells were stained with CD45RA-PE and CD62L-PE-Cy7 and the different sub-populations (effector memory (CD62L- CD45RA-), effector (CD62L-CD45RA+), central memory (CD62L+CD45RA-) and nai ^' ve/stem cell memory (CD62L+CD45RA+)) analyzed for eGFP expression.

Figure 13. Performance of the different IDLVs in differentiated skin and oral mucosa cells (a). Representative plots showing eGFP expression profiles. Differentiated skin and oral mucosa cells were transduced at MOI=10 with SE and SEIS2 IDLVs and 72h later analyzed. The percentage (%) of the eGFP+ population and the expression levels (MFI) are shown in each plot, (b). Graphs showing the relative percentage (Top) and expression levels (Bottom) of the SE-IS2 IDLVs in the different cell types normalized to SE-IDLVs in the same cell lines and using equal MOIs. The values represent means +/- SEM of at least four separate experiments (*p < 0.05).

Figure 14. Performance of the IS2-I DLVs expressing the transgene through the human WAS promoter, (a). Scheme of the IDLVs harboring the human WAS promoter (b) Representative plots showing eGFP expression profiles of Jurkat cells transduced with AWE and AWE-IS2 (Top) and the SE and SEIS2 (Bottom) IDLVs at MOI = 0.5. The percentage {%) of the eGFP+ population and the expression levels (MFI) are shown in each plot. (c). Graphs showing the relative vector DNA genomes in IDLV-transduced cells at 72h after transduction. Values represent means + /- SEM of at least four separate experiments (*p < 0.05).

Description of the invention

The success of gene therapy greatly depends on the availability of appropriate gene transfer vectors for the selected strategy. The broad application of gene therapy to different diseases has been possible thanks to the development of a wide range of vectors with different properties. In general, integrative vectors are the vectors of choice when stable gene expression in actively dividing cells is required, whereas non-integrative vectors are preferred for the stable expression in non-dividing cells or when transient expression is sufficient or desirable. Integrative LVs have several properties that make them an attractive tool for gene delivery such as the ability to deliver inserts of up to 12Kb, the active translocation to intact nuclei and the possibility of using different envelopes that enable efficient gene delivery in almost all the cell lines analyzed. These characteristics have led scientists to extend the range of potential applications by developing integrative deficient LVs (IDLVs) [Wanisch, K. and R.J. Yanez-Munoz, Integration-deficient lentiviral vectors: a slow coming of age. MolTher, 2009. 17(8): p. 1316-32] which maintain several properties of LVs while expressing the transgene without integrating their genome into the host chromosome. IDLVs extend the applicability of LVs, which are safer when stable expression is required in non-dividing cells (neurons, hepatocytes) and can also achieve transient expression in actively dividing cells. However, the expression levels and titers of IDLVs are generally lower than those of LVs which has limited the applications of this technology.

The relatively low expression levels of IDLVs have been linked to epigenetic silencing through cellular defense mechanisms which apply heterochromatin marks to episomal viral sequences. This cellular response, which is not restricted to IDLV systems, affects different vector genomes such as herpes simplex viruses and adenoviruses. The episomal viral DNA is "chromatinized" and acquires nucleosome-like properties immediately after entry into the nucleus. In particular, IDLV genomes have been previously reported to undergo heterochromatinization through histone deacetylation, a process which can be reversed using histone deacetylase inhibitors (HDACi) such as sodium butyrate and valproic acid. For basic research purposes and some clinical applications, HDACi could be used to improve IDLV efficiency; however, in most gene therapy settings, the use of HDACi is not desirable due to potential severe side effects such as the development of malignancies.

The present invention confronted the above problems by using the improved IS2 element containing HS4 and synthetic S/MAR elements previously described in [Benabdellah, K., et al., A chimeric HS4-SAR insulator (IS2) that prevents silencing and enhances expression of lentiviral vectors in pluripotent stem cells. PLoS One, 2014.9(1): p. e84268.], whose inclusion in IDLVs could improve their behavior by avoiding epigenetic transcriptional silencing through HS4 activity and by improving the transcription efficiency through S/MAR activity. However, contrary to expectations, the presence of the IS2 element did not abrogate epigenetic silencing by histone deacetylases, although it did improve the transcriptional efficiency of episomal IDLVs.

Up to now, most attempts to improve IDLVs have focused on improving the stability of DNA episomal circles either through transient cell cycle arrest or by the inclusion of S/MAR elements alone or combined with replication origin (http://www.vivebiotech.com/technology). However, efficient stable transgene expression in highly dividing cells using IDLVs can be difficult to achieve. As an alternative, we have focused on improving the transient transgene expression levels of IDLVs though insertion of the IS2 element. Although the presence of S/MAR sequences in this element could also affect expression stability, we did not find this type of effect which is in line with the observations of Kymalainen et a I, who did no observe any differences in episomal establishment in IDLVs containing an S/MAR sequence. However, these data differ from other studies which show that the insertion of a full 1.2 kb or minimal 155pb fragment of the b-interferon S/MAR elements in IDLVs provided a sustained transgene expression (Xu, Z., et al., Non-integrating lentiviral vectors based on the minimal S/MAR sequence retain transgene expression in dividing cells. Sci China Life Sci, 2016. 59(10): p. 1024-1033), and (Verghese, S.C., et al., S/MAR sequence confers long-term mitotic stability on non-integrating lentiviral vector episomes without selection. Nucleic Acids Res, 2014. 42(7): p. e53). These contradictory findings could be explained by the differences in S/MAR elements used in the different IDLVs. Verghese et al., and Xu et al used the full b-interferon S/MAR element and a 155bp fragment, respectively. On the other hand, Kymalainen et al (Kymalainen, H., et al., Long-term episomal transgene expression from mitotically stable integration-deficient lentiviral vectors. Hum Gene Ther, 2014. 25(5): p. 428-42) used a truncated form of 0.7kb, while the IS2 element contained a synthetic S/MAR element consisting of 4 S/MAR recognition signatures (MRS). It is therefore possible that both the 1.2 kb b-interferon S/MAR element and the 155 bp fragment are required for episomal maintenance.

We inserted the IS2 element (SAR2-HS4650) of SEQ ID NO 1, said sequence is provided below:

taaataaacttataaattgtgagagaaattaatgaatgtctaagttaatgcagaaac ggaggctcctcattattttgaacttaaagacttaat attgtgaaggtatactttctttaataataagcctgcgcccaatatgttcaccccaaaaaa gctgtttgttaacttgtcaacctcatttAAAAJNlA

T AAGAAACagcccaaagacAATAACAAAAGAATAA TAAAAAAGAAT G AAAT AT GT AATT CTTT CAG AGT AAAAAT C

ACACCCATGACCTGGCCACTGAGGGCTTGATCAATTCACTTTGAATTTGGCATTAAA TACCATTAAGGTATATTAAC

TGATTTTAAAATAAGATATATTCaagatctgctcacggggacagcccccccccaaag cccccagggatgtaattacgtccctcccccgctag ggggcagcagcgagccgcccggggctccgctccggtccggcgctccccccgcatccccga gccggcagcgtgcggggacagcccgggcacgggga aggtggcacgggatcgctttcctctgaacgcttctcgctgctctttgagcctgcagacac ctggggggatacggggaaaatgtgtctgagcctgcatgtt tgatggtgtctggatgcaagcagaaggggtggaagagcttgcctggagagatacagctgg gtcagtaggactgggacaggcagctggagaattgcc atgtagatgttcatacaatcgtcaaatcatgaaggctggaaaagccctccaagatcccca agaccaaccccaacccacccaccgtgcccactggcca tgtccctcagtgccacatccccacagttcttcatcacctccagggacggtgaccccccca cctccgtgggcagctgtgccactgcagcaccgctctttgg agaaggtaaatcttgctaaatccagcccgaccctcccctggcacaacgtaaggccattat ctctcatccaactccaggacggagtcagtgagaatatt

SEQ. ID NO 1 was inserted into the lentiviral backbone 3'LTR in order to be duplicated during the reverse transcription process. This procedure enhances the effect of S/MAR sequences and/or increases homologous recombination in order to promote the formation of 1-LTR circles which is reported to be 2-4-fold more effective for expression than 2-LTR circles. To differentiate between these two effects, we constructed a 1.2kb-IDLV lentiviral backbone which has the same insertion in the LTR as IS2-IDLV but contains an irrelevant sequence. The 1-LTR form is the result of homologous recombination between the LTRs, while 2-LTR circles are the result of non-homologous end joining (NHEJ), meaning that longer LTRs are expected to render higher levels of 1-LTRs. Our analysis showed that the inclusion of both, the IS2 element and the irrelevant sequence 1.2 kb did not affect vector titer (Estimated as TU/ml), reduced the amount of episomes on transduced cells and reduced the formation of 2-LTR. While IS2-I DLVs episomes showed an increased eGFP transgene expression as compared to unmodified IDLVs, the 1.2kb- IDLVs episomes showed no effect. These data suggest that the insertion of the IS2 element into the LTRs reduced the reverse transcription process, rendering these IDLVs less efficient in generating IDLVs episomes in target cells. Additionally, they also indicated that the enhanced expression of IS2-IDLV DNA circles cannot be explained by the increment in 1-LTR forms, since this effect is not present in the SE-1.2kb IDLVs. The improved behavior of IDLVs harboring the IS2 element could be due to an improved transcriptional activity of the IDLVs episomes or to improved mRNA stability/expression of IS2- containing transcripts. However, the insertion of IS2 into integrative LVs reduced their expression levels in 293T cells and they also contained the IS2 element in their mRNAs. We can therefore conclude that the better performance of IS2-containing episomes must be due to an effect related to transcription and not to mRNA stability and/or other effects on the mRNA. We therefore focused our attention on trying to understand the potential mechanism involved in this enhanced transcriptional activity of SE-IS2-IDLVs.

By normalizing the transcription levels to the relative amount of episomes, we estimated that the transcriptional activity of IS2-circles is 6-7-fold higher than unmodified SE- circles. These positive effects of the IS2 sequence counter balance the negative effect on episomes generation in target cells. Therefore, the final effect of the IS2 element in IDLVs will greatly depends on the target cell and the balance between the negative (less efficacy of episomes generation) versus the positive (enhanced transcription) effects of the IS2 element in each cell type. Interestingly, the IS2 element still have a similar activity when inserted into a different LV backbone expressing the transgene through the WAS promoter, suggesting that the effect could be independent of the promoter used.

The elements contained in the IS2 (HS4 and SARs) function as DNA anchor points for the chromatin scaffold and organize the chromatin into structural domains that separate different transcriptional units from each other and provide a platform for the assembly of the factors involved in transcription regulation. Several studies indicate that these elements are located in proximity to expressed genes at the 5' end or near transcription start sites. Several pieces of evidence suggest that these elements may poise the DNA for transcription by allowing interaction with ubiquitous tissue-specific transcription factors such as special AT-rich binding protein I (SATB-1), NMP4 and CTCF; these, in turn, recruit regulatory proteins such topoisomerases and ATP-dependent chromatin remodeling complexes to mediate a more expression-permissive state. These nuclear domains involved in transcription and replication, stain poorly with DAPI due to a lower DNA context. In this direction, our FISH analysis showed that, while the SE-IDLVs episomes were uniformly distributed throughout the nuclei, the SE-IS2- IDLVs episomes followed a more aggregated pattern into DAPI-low regions. These observations indicate that the improved behavior of SE-IS2-IDLVs episomes is probably in part due to a preferential nuclear re-positioning into transcriptionally active regions. I n summary, we have designed a new LV backbone that improves the expression levels of I DLVs through a 6-7-fold increase in the transcriptional activity of I DLV circles due to the inclusion of the IS2 element at the LTR. However, as the inclusion of this element also negatively affects the amount of episomal vectors produced in target cells, the final effect may vary on different cell types varies. I n this sense, it is noted that the effect was especially significant in the transgene expression ofcell types such as 293T cells, NPCs, neurons and iPSCs.

Therefore, the present invention is directed to the element IS2, which comprises the following combination of nucleic acid molecules, namely the combination of nucleic acid molecule HS4- 650 bp and a synthetic S/MAR nucleic acid molecules containing 4M/SARs recognition signatures (M RS) (SEQ I D NO 1). I n this regard, the authors of the invention have shown that when this element, namely element IS2, is inserted in the U3 of the 3'LTR region of integration- defective lentiviral vectors (I DLVs), it is able to enhance expression in different vectors backbones and different cell types.

Thus, a first aspect of the invention refers to an integration-defective lentiviral vector (I DLVs) comprising a sequence consisting of SEQ. I D No 1 or any combination of HS4650 and SAR2 sequences such as:

SEQ I D NO 2. SAR2-HS4650-SAR2: taaataaacttataaattgtgagagaaattaatgaatgtctaagttaatgcagaaacgga ggctcctcatttatttttgaacttaaagactt aatattgtgaaggtatactttctttaataataagcctgcgcccaatatgttcaccccaaa aaagctgtttgttaacttgtcaacctcatttAA

AAT AT AT AAG AAACagccca aaga cAAT AAC AAAAG AAT AAT AAAAAAG AATG AAAT AT GT AATT CTTT C A

GAGTAAAAATCACACCCATGACCTGGCCACTGAGGGCTTGATCAATTCACTTTGAAT TTGGCATTAAATA

CCATTAAGGTATATTAACTGATTTTAAAATAAGATATATTCaagatctgctcacggg gacagcccccccccaaagccc ccagggatgtaattacgtccctcccccgctagggggcagcagcgagccgcccggggctcc gctccggtccggcgctccccccgcatcccc gagccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatcgctttcct ctgaacgcttctcgctgctctttgagcctg cagacacctggggggatacggggaaaatgtgtctgagcctgcatgtttgatggtgtctgg atgcaagcagaaggggtggaagagcttgc ctggagagatacagctgggtcagtaggactgggacaggcagctggagaattgccatgtag atgttcatacaatcgtcaaatcatgaagg ctggaaaagccctccaagatccccaagaccaaccccaacccacccaccgtgcccactggc catgtccctcagtgccacatccccacagtt cttcatcacctccagggacggtgacccccccacctccgtgggcagctgtgccactgcagc accgctctttggagaaggtaaatcttgctaa atccagcccgaccctcccctggcacaacgtaaggccattatctctcatccaactccagga cggagtcagtgagaatatttaaataaactt ataaattgtgagagaaattaatgaatgtctaagttaatgcagaaacggaggctcctcatt tatttttgaacttaaagacttaatattgtgaa ggtatactttctttaataataagcctgcgcccaatatgttcaccccaaaaaagctgtttg ttaacttgtcaacctcatttAAAATATATA AG AAACagccca a aga cAAT AAC AAAAG AAT AAT AAAAAAG AATG AAAT ATGTAATT CTTT CAG AGTAAAA ATCACACCCATGACCTGGCCACTGAGGGCTTGATCAATTCACTTTGAATTTGGCATTAAA TACCATTAAG GTAT ATT AACTG ATTTT AAAAT AAG AT AT ATT C;

SEQ I D NO 3. SAR2-HS4650-SAR2-SAR2: taaataaacttataaattgtgagagaaattaatgaatgtctaagttaatgcagaaacgga ggctcctcatttatttttgaacttaaagactt aatattgtgaaggtatactttctttaataataagcctgcgcccaatatgttcaccccaaa aaagctgtttgttaacttgtcaacctcatttAA

AAT AT AT AAG AAACagccca aaga cAAT AAC AAAAG AAT AAT AAAAAAG AATG AAAT AT GT AATT CTTT C A

GAGTAAAAATCACACCCATGACCTGGCCACTGAGGGCTTGATCAATTCACTTTGAAT TTGGCATTAAATA

CCATT AAGGTAT ATT AA CTGATTTT AAAAT AAGAT AT ATTCaagatctgctcacggggacagcccccccccaaagccc ccagggatgtaattacgtccctcccccgctagggggcagcagcgagccgcccggggctcc gctccggtccggcgctccccccgcatcccc gagccggcagcgtgcggggacagcccgggcacggggaaggtggcacgggatcgctttcct ctgaacgcttctcgctgctctttgagcctg cagacacctggggggatacggggaaaatgtgtctgagcctgcatgtttgatggtgtctgg atgcaagcagaaggggtggaagagcttgc ctggagagatacagctgggtcagtaggactgggacaggcagctggagaattgccatgtag atgttcatacaatcgtcaaatcatgaagg ctggaaaagccctccaagatccccaagaccaaccccaacccacccaccgtgcccactggc catgtccctcagtgccacatccccacagtt cttcatcacctccagggacggtgacccccccacctccgtgggcagctgtgccactgcagc accgctctttggagaaggtaaatcttgctaa atccagcccgaccctcccctggcacaacgtaaggccattatctctcatccaactccagga cggagtcagtgagaatatttaaataaactt ataaattgtgagagaaattaatgaatgtctaagttaatgcagaaacggaggctcctcatt tatttttgaacttaaagacttaatattgtgaa ggtatactttctttaataataagcctgcgcccaatatgttcaccccaaaaaagctgtttg ttaacttgtcaacctcatttAAAATATATA

AG AAACagccca aaga cAAT AACAAAAG AAT AAT AAAAAAG AAT G AAAT AT GT AATT CTTT CAG AGT AAAA

ATCACACCCATGACCTGGCCACTGAGGGCTTGATCAATTCACTTTGAATTTGGCATT AAATACCATTAAG

GTAT ATT AA CTGATTTT AAAAT AAGAT AT ATTCtaaataaacttataaattgtgagagaaattaatgaatgtctaagttaat gcagaaacggaggctcctcatttatttttgaacttaaagacttaatattgtgaaggtata ctttctttaataataagcctgcgcccaatatgt tcaccccaaaaaagctgtttgttaacttgtcaacctcatttAAAATATATAAGAAACagc ccaaagacAATAACAAAAGAAT

AATAAAAAAGAATGAAATATGTAATTCTTTCAGAGTAAAAATCACACCCATGACCTG GCCACTGAGGGC

TTG AT C AATT CACTTT G AATTT G G C ATT AAAT ACC ATT AAG GT AT ATT AACTG ATTTT AAAAT AAGAT AT A

TTC; or

SEQ I D NO 4. SAR2-SAR2-HS4650-SAR2-SAR2 taaataaacttataaattgtgagagaaattaatgaatgtctaagttaatgcagaaacgga ggctcctcatttatttttgaacttaaagactt aatattgtgaaggtatactttctttaataataagcctgcgcccaatatgttcaccccaaa aaagctgtttgttaacttgtcaacctcatttAA AAT AT AT AAG AAACagccca aaga cAAT AAC AAAAG AAT AAT AAAAAAG AATG AAAT AT GT AATT CTTT C A

GAGTAAAAATCACACCCATGACCTGGCCACTGAGGGCTTGATCAATTCACTTTGAAT TTGGCATTAAATA CCATTAAGGTATATTAACTGATTTTAAAATAAGATATATTCaagatcttaaataaactta taaattgtgagagaaatta atgaatgtctaagttaatgcagaaacggaggctcctcatttatttttgaacttaaagact taatattgtgaaggtatactttctttaataata agcctgcgcccaatatgttcaccccaaaaaagctgtttgttaacttgtcaacctcatttA AAATATATAAGAAACagcccaaagac

AAT AAC AAAAG AAT AAT AAAAAAG AATG AAAT ATGTAATT CTTT C AG AGTAAAAAT CAC ACCC ATG ACCT

G G CCACTG AGG G CTT GAT C AATT CACTTTG AATTT G G C ATT AAAT ACC ATT AAG GTAT ATT AACT G ATTTT

AAAATAAGATATATTCaagatctgctcacggggacagcccccccccaaagcccccag ggatgtaattacgtccctcccccgctag ggggcagcagcgagccgcccggggctccgctccggtccggcgctccccccgcatccccga gccggcagcgtgcggggacagcccgggc acggggaaggtggcacgggatcgctttcctctgaacgcttctcgctgctctttgagcctg cagacacctggggggatacggggaaaatgt gtctgagcctgcatgtttgatggtgtctggatgcaagcagaaggggtggaagagcttgcc tggagagatacagctgggtcagtaggact gggacaggcagctggagaattgccatgtagatgttcatacaatcgtcaaatcatgaaggc tggaaaagccctccaagatccccaagacc aaccccaacccacccaccgtgcccactggccatgtccctcagtgccacatccccacagtt cttcatcacctccagggacggtgaccccccc acctccgtgggcagctgtgccactgcagcaccgctctttggagaaggtaaatcttgctaa atccagcccgaccctcccctggcacaacgt aaggccattatctctcatccaactccaggacggagtcagtgagaatatttaaataaactt ataaattgtgagagaaattaatgaatgtcta agttaatgcagaaacggaggctcctcatttatttttgaacttaaagacttaatattgtga aggtatactttctttaataataagcctgcgccc aatatgttcaccccaaaaaagctgtttgttaacttgtcaacctcatttAAAATATATAAG AAACagcccaaagacAATAACAAA

AGAATAATAAAAAAGAATGAAATATGTAATTCTTTCAGAGTAAAAATCACACCCATG ACCTGGCCACTG

AGG G CTT GAT CAATT CACTTTG AATTT G G C ATT AAAT ACC ATT AAG GTAT ATT AACT G ATTTT AAAAT AAG

ATATATTCtaaataaacttataaattgtgagagaaattaatgaatgtctaagttaat gcagaaacggaggctcctcatttatttttgaa cttaaagacttaatattgtgaaggtatactttctttaataataagcctgcgcccaatatg ttcaccccaaaaaagctgtttgttaacttgtca acctcatttAAAATATATAAGAAACagcccaaagacAATAACAAAAGAATAATAAAAAAG AATGAAATATGTA

ATTCTTTCAGAGTAAAAATCACACCCATGACCTGGCCACTGAGGGCTTGATCAATTC ACTTTGAATTTGG

C ATT AAATACCATT AAGGTAT ATT AACTG ATTTT AAAAT AAG AT AT ATT C

I n a preferred embodiment of the first aspect of the invention, the combination of HS4650 a nd SAR2 sequences is in a 1 to 1 ratio SAR2:HS4650. More preferably, the combination of HS4650 and SAR2 sequences is in a 2 to 1 ratio SAR2:HS4650. More preferably, the combination of HS4650 and SAR2 sequences is in a 3 to 1 ratio SAR2:HS4650. More preferably, the combination of HS4650 and SAR2 sequences is in a 4 to 1 ratio SAR2:HS4650. In all of these preferred embodiments of the first aspect of the invention, the number of SAR2 sequences is between 1 and 8 sequences.

A second aspect of the invention refers to an integration-defective lentiviral vector (I DLVs) comprising a nucleic acid molecule which in turn comprises: a) The IS2 element or equivalent b) regulatory control elements, and c) coding nucleic acid molecules operatively associated with the regulatory elements and capable of expression in the target cell; wherein the insulator element is selected from any of the sequences defined in the first aspect of the invention or any combination of HS4650 and SAR2 sequences.

In the present invention, the term "integration-defective lentiviral vector (IDLVs)" is understood as any virus-like particle derived from the lentiviral family of retroviruses in which the integrase protein is mutated. The generation of the IDLVs particles follow a similar procedure as for the generation of the integrative Lentiviral vectors (LVs) with the only difference of the packaging plasmids, expressing the gag-pol polyprotein. In the IDLV system, the packaging plasmids, harbor a mutation in the Integrase gene that block the ability of the vectors to integrate. The genetic material delivered by the IDLV remains therefore as episomal DNA forms (mainly as episomal circles) in the nuclei of the target cells for a certain period of time, depending on the cell type.

The IS2 element of the present invention is capable of permitting the expression of coding nucleic acid molecules (please note that it is herein understood that the term "coding nucleic acid molecules" includes the term "transgene") in research, protein production and gene therapy in mammalian cells, preferably in cell types such as 293T cells, NPCs, neurons and iPSCs. Other synthetic elements apart from the one disclosed herein, preferably using sequences from mammals, having a high level of sequence identity to the IS2 elements described in the first aspect of the invention can be used in the present invention. Suitable sequences preferably have at least about: 70% identity, at least 80% identity, at least 90% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity or most preferably have at least 99% or 99.5% identity to the sequence of an insulator element as described in the first aspect above. Identity refers to the similarity of two nucleotide sequences that are aligned so that the highest order match is obtained. Identity is calculated according to methods known in the art. For example, if a nucleotide sequence (called "Sequence A") has 90% identity to a portion of SEQ ID NO 1, then Sequence A will be identical to the referenced portion of SEQ ID NO 1 except that Sequence A may include up to 10 point mutations (such as substitutions with other nucleotides) per each 100 nucleotides of the referenced portion of SEQ ID NO 1.

The invention also includes an IS2 element having DNA which in turn has a sequence with sufficient identity to the insulator elements described in the first aspect of the invention to hybridize under stringent hybridization conditions. In this sense, the present invention also includes IS2 elements having nucleic acid molecules that hybridize to one or more of the sequences in SEQ ID NO 1- SEQ ID NO 4 or its complementary sequences. Such nucleic acid molecules preferably hybridize under high stringency conditions (see Sambrook et al. Molecular Cloning: A Laboratory Manual, Most Recent Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. ). High stringency washes have preferably have low salt contents (preferably about 0.2% SSC) and a temperature of about 50-65 C.

Thus, these other insulator elements can be readily inserted in a nucleic acid molecule provided that expression of the coding nucleic acid molecule still occurs. In a preferred embodiment of the first or second aspect of the invention the element or the nucleic acid molecule is located at the U3 of the 3'LTR region of the IDLVs. Please note that upon reverse transcription and integration, the insulator will be located at both sides of the regulatory and coding sequences. The polypeptides produced from said vectors may also be administered to mammals, preferably humans. In the context of the present invention, it is understood that the U3 of the 3'LTR region of a IDLVis a sequence that contains the regulatory control elements of the virus, is present only in the 3' end of the viral genome (in the virus particles) and in both ends in the integrated provirus. This sequence is eliminated/ mutated from the vectors for safety reasons. In particular in reference to the use of lentiviral vectors in the present invention, the SEQ ID No 1 and SEQ ID No 2 or SEQ ID No 3 must be preferentially inserted into the Bbsl restriction site of the U3 of the 3'LTR.

In the context of the present invention, mammalian cells are cells which are derived or isolated from tissue of a mammal, cell types such as 293T cells, NPCs, neurons and iPSCs. In a preferred embodiment of the inventions these cells are stem cells, preferably pluripotent stem cells of adult tissue origin (iPS) or of embryonic origin (ESCs). In another preferred embodiment of the invention these cells are human mammalian cells of non-embryonic origin (ESCs) or non-human mammalian cells of any origin including embryonic stem cells (ESCs). In another preferred embodiment of the invention these cells are human embryonic stem cells when the nucleic acid molecules described in the present invention are used for therapeutic or diagnostic purposes which are applied to the human embryo and are useful to it. In the context of the present invention, the regulatory control elements of the second aspect of the invention are understood to be DNA sequences able to promote the synthesis of RNAs under different conditions.

In the context of the present invention, the coding nucleic acid molecules of the second aspect of the invention are understood to be DNA sequences that, when transcribed into RNA molecules through the action of the regulatory elements, will give rise to functional proteins or RNAs.

Therefore the nucleic acid molecules described in the second aspect of the present invention are constructed from regulatory elements, a coding nucleic acid molecule and the sequence/s of the invention. These nucleic acid molecules may be used in vivo or in vitro, preferably for transforming or transducing cell types such as 293T cells, NPCs, neurons and iPSCs. Cells transfected or transduced in vitro with this molecules can be used for ex vivo gene therapy or as a research tool or for protein production. These nucleic acid molecules are also useful for gene therapy by transfecting or transducing cells in vivo to express a therapeutic protein. For example, if one were to upregulate the expression of a gene, one could insert the sense sequence into the nucleic acid molecule. If one were to downregulate the expression of the gene, one could insert the antisense sequence into the expression cassette. Techniques for inserting sense and antisense sequences (or fragments of these sequences) would be apparent to those skilled in the art. The nucleic acid molecule described in the second aspect of the present invention may be either isolated from a native source (in sense or antisense orientations) or synthesized. It may also be a mutated native or synthetic sequence or a combination of these. Examples of coding nucleic acid molecules to be expressed include 3- globin and GFP expressing reporter genes.

In a preferred embodiment of the second aspect of the invention, two identical IS2 elements are located flanking the regulatory and coding sequences, wherein these two identical elements comprise any of the sequences identified in the first aspect of the invention.

In another preferred embodiment of the second aspect of the invention, the regulatory control element comprises a drug-responsive element. Preferably said regulatory control element comprises a doxycicline-responsive element. More preferably, said regulatory control element comprises a doxycicline-responsive element based on the original TetRrepresor. In the context of the present invention, it is understood that the original TetRrepresor is the product of the tetR gene (the TetR protein) from Escherichia coli.

In yet another preferred embodiment of the second aspect of the invention, the coding nucleic acid molecule is a reporter gene. In yet another preferred embodiment of the second aspect of the invention, the nucleic acid molecule of the second aspect of the invention comprises two regulatory elements and two coding nucleic acid molecules.

In yet another preferred embodiment, the nucleic acid molecule of the second aspect of the invention comprises two different regulatory elements, one drug-inducible and one constitutive. Preferably, the first regulatory element is regulated by the TetO operon and the second regulatory element expresses the TetR repressor. More preferably, the drug-inducible regulatory element is based on the cytomegalovirus (CMV) promoter and the constitutive regulatory element is based on the Spleen Focus Forming Virus LTR. Still more preferably, the drug-inducible regulatory element is based on any human gene promoter and the constitutive regulatory element is based on the EFlalpha gene promoter.

In still another preferred embodiment of the second aspect of the invention, the vector is used in vivo or in vitro, preferably for transforming or transducing cell types such as 293T cells, NPCs, neurons and iPSCs.

Moreover, the invention also relates, as a third aspect of the invention, to a method of medical treatment of a mammal, preferably a human, by administering to the mammal the vector of the first or second aspect of the invention, or of any of its preferred embodiments, or a cell containing any of these elements, preferably cell types such as 293T cells, NPCs, neurons and iPSCs. Diseases, such as blood diseases or neural diseases (neurodegenerative), that may be treated are diseases, such as thalassemia or sickle cell anemia that are treated by administering a globin gene. Blood diseases treatable by stem cell transplant include leukemias, myelodysplastic syndromes, and stem cell disorders, myeloproliferative disorders, lymphoproliferative disorders phagocyte disorders, inherited metabolic disorders, histiocytic disorders, inherited erythrocyte abnonnalities, inherited immune system disorders, inherited platelet abnormalities, plasma cell disorders, and malignancies. Stem cell nerve diseases to be treated by neural stem cell transplantation include diseases resulting in neural cell damage or loss, eg. paralysis, Parkinson's disease, Alzheimer's disease, ALS, multiple sclerosis).

Furthermore, the invention also relates to a mammalian host cell (isolated cell in vitro, a cell in vivo, or a cell treated ex vivo and returned to an in vivo site) comprising the vector of the first or second aspect of the invention. In this sense, cells transfected with suchvector, may be used, for example, in bone marrow or cord blood cell transplants according to techniques known in the art. Examples of the use of transduced bone marrow or cord blood cells in transplants are for ex vivo gene therapy of Adenosine deaminase (ADA) deficiency. Other cells which may be transfected or transduced either ex vivo or in vivo include purified stem cells. In any case such a mammalian cell or mammalian host cell transfected or transduced with such the vector can be useful as research tools to measure levels of expression of the coding nucleic acid molecule and the activity of the polypeptide encoded by the coding nucleic acid molecule.

Thus, a fourth aspect of the invention refers to a mammalian host cell comprising the vector of the first or second aspect of the invention. Preferably cell types such as 293T cells, NPCs, neurons and iPSCs are used.

A fifth aspect of the invention refers to the use of the vector of the first or second aspect of the invention, for cell marking.

A sixth aspect of the invention refers to the use of vector of the first or second aspect of the invention, for cell genetic manipulation studies. A seventh aspect of the invention refers to a method for expressing a nucleic acid molecule in a mammalian host cell, comprising a) administering to the cell an effective amount of the vector of the second aspect of the invention, and b) expressing the nucleic acid molecule to produce the coding nucleic acid molecule RNA and its encoding polypeptide.

An eight aspect of the invention refers to a method for producing a polypeptide in a mammalian host cell, comprising a) administering to the cell an effective amount of the vector of the second aspect of the invention, and b) expressing the nucleic acid molecule to produce the coding nucleic acid molecule RNA and its encoding polypeptide.

In a preferred embodiment of the seventh and eight aspects of the invention, the host cell is a stem cell of adult tissue origin. In a preferred embodiment of the seventh and eight aspects of the invention, the host cell is a pluripotent stem cell of adult tissue origin (iPS) or of embryonic origen (ESCs), preferably a non human embryonic stem cell.

A further aspect of the invention refers to a composition comprising the vector of the second aspect of the invention, wherein this composition can be a pharmaceutical composition (from hereinafter pharmaceutical composition of the invention).

The pharmaceutical composition of this invention can be used to treat patients having diseases, disorders or abnormal physical states and could include acceptable carriers or excipients. The pharmaceutical composition of the invention can be administered by ex vivo and in vivo methods such as electroporation, DNA microinjection, liposome DNA delivery, and virus vectors that have RNA or DNA genomes including retrovirus vectors, lentivirus vectors, Adenovirus vectors and Adeno-associated virus (AAV) vectors, Semliki Forest Virus. Derivatives or hybrids of these vectors may also be used.

Dosages to be administered depend on patient needs, on the desired effect and on the chosen route of administration. The expression cassettes may be introduced into the cells or their precursors using ex vivo or in vivo delivery vehicles such as liposomes or DNA or RNA virus vectors. They may also be introduced into these cells using physical techniques such as microinjection or chemical methods such as coprecipitation.

The pharmaceutical composition of the invention can be prepared by known methods for the preparation of pharmaceutically acceptable compositions which can be administered to patients, and such that an effective quantity of the nucleic acid molecule is combined in a mixture with a pharmaceutically acceptable vehicle. Suitable vehicles are described, for example in Remington's Pharmaceutical Sciences (Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa, USA). On this basis, the pharmaceutical composition could include an active compound or substance, such as a nucleic acid molecule, in association with one or more pharmaceutically acceptable vehicles or diluents, and contained in buffered solutions with a suitable pH and isosmotic with the physiological fluids. The methods of combining the expression cassettes with the vehicles or combining them with diluents is well known to those skilled in the art. The composition could include a targeting agent for the transport of the active compound to specified sites within the erythroid or other cells.

In addition, the present invention also includes compositions and methods (from hereinafter method of the invention) for providing a coding nucleic acid molecule as defined in the first or second aspect of the invention, to a subject such that expression of the molecule in the cells provides the biological activity of the polypeptide encoded by the coding nucleic acid molecule to those cells. The invention includes methods and compositions for providing a coding nucleic acid molecule to the cells of an individual such that expression of the coding nucleic acid molecule in the cells provides the biological activity or phenotype of the polypeptide encoded by the coding nucleic acid molecule. The method also relates to a method for providing an individual having a disease, disorder or abnormal physical state with a biologically active polypeptide by administering a nucleic acid molecule of the present invention. The amount of polypeptide will vary with the subject's needs. The optimal dosage of vector may be readily determined using empirical techniques, for example by escalating doses.

Various approaches to gene therapy may be used. The invention includes a process for providing a human with a therapeutic polypeptide including: introducing human cells into a human, said human cells having been treated in vitro or ex vivo to insert therein a pharmaceutical composition of the invention of the invention or a vector of the invention, the human cells expressing in vivo in said human a therapeutically effective amount of said therapeutic polypeptide.

The following examples are only meant for illustrative purposes.

Examples

Materials and Methods

Cell lines

293T cells (CRL11268; American Type Culture Collection, Rockville, MD) were cultured in Dulbecco's Modified Eagle Medium (DMEM, Invitrogen, Edinburgh, Scotland) supplemented with 10% Fetal Bovine Serum (FBS, Invitrogen). The Jurkat T lymphocyte line (TIB-152) (ATCC, Manassas, VA) were grown in RPMI medium supplemented with 10% FBS and Penicillin- Streptomycin Solution (Biowest). Human neural progenitor cells (GIBCO Human Neural Stem Cells, H9 hESC-derived), Cat. No. N7800) were maintained in StemPro NSC SFM Media (KnockOut™ DMEM/F-12, StemPro NSC SFM supplement, basic FGF recombinant protein and EGF recombinant protein (GIBCO, ThermoFisher Scientific)). Plates were previously coated with poly-L-Ornithine 10 mg/ml (SigmaAldrich, St. Louis, MO, http://www.sigmaaldrich.com) and Llaminin 20 mg/ml (Thermo Fisher Scientific, Cat. No. 23017-015). The human induced pluripotent stem cell (iPSC) line PBMCl-iPS4Fl, generated and characterized by Montes et al.,[78] was cultured under feeder-free culture conditions.

Neural cell differentiation in vitro

When the human neural progenitor cells were 90% confluent, the complete growth medium was replaced by the neural differentiation media (NSC SFM Media without basic FGF recombinant protein or EGF recombinant protein) and maintained at 37^C, in 5% C0 ₂ . The medium was changed every 3-4 days for 28 days. The mature neural-like cells were characterized by immunocytochemistry.

Immunocytochemistry of mature Neural-like cells

Mature neural-like cells were fixed in 4% paraformaldehyde for 30 min at room temperature. After fixation, the cells were washed three times with PBS. To permeabilize the cells and to avoid non-specific antigens, the fixed cells were incubated in PBS with 2% goat serum and 0.1% Triton-X100 buffer (SigmaAldrich, St. Louis, MO, http://www.sigmaaldrich.com) for 30 min at room temperature. After two washes with washing solution (PBS containing 0.1% goat serum and 0.05% Triton X-100), cells were incubated with primary antibody anti- -tubulin (b-tubulin (TUJ1) mouse monoclonal antibody, Covance Inc., http://es.covance.com) diluted 1:1000 in PBS overnight. Slides were then washed three times with washing solution and incubated with the secondary antibody (Goat anti-mouse IgG secondary antibody, Alexa Fluor 488 conjugate, Thermo Fisher Scientific, https://www.thermofisher.com) at 1:1000 dilution for 30 minutes. All incubations were performed in a humidified chamber at 4°C. Lastly, slides were washed twice and mounted in mounting medium (SlowFade Gold AntifadeMountant with DAPI, Thermo Fisher Scientific, https://www.thermofisher.com) with cover slip. Optical scanning was performed using a Zeiss LSM 710 confocal microscope and an Axio Imager A1 microscope. Lentiviral vector constructs

The IS2 element, which combinethe HS4-650 fragment and the SAR2, were designed and synthesized.The IS2 and an irrelevant 1.2 kb sequencewere inserted into the 3'LTR of the SE or SEWP and AWE backbones.

Viral production and titration

LVs and IDLVs were generated by transient transfection of 293T cells using the transfer plasmid, the packaging plasmid pCMVDR8.91 for LVs and pCMVDRD8.74 for IDLVs as well as the plasmid encoding the VSV-G envelope gene http://www.addgene.org/Didier_Trono. Transfection was performed with the aid of LipoD293™ (SignaGen Laboratories, Ijamsville, MD, USA) according to the manufacturer's instructions, and the supernatants were harvested at 48h and 72h after transfection. Viral titers were determined by the estimation of transduction units (TU) per milliliter using the ABM ^' s Lentiviral qPCR Titer Kit. Converting the amount of viral copies per ml (GC/ml) to Transduction units (TU/ml) as indicated by the manufacturer. (qPCR Lentivirus Titration Kit, Applied Biological Materials (ABM) Inc.).

Cell Transduction

Concentrated as well as unconcentratedLV and IDLV supernatants, were used to transduce different cell lines. Cells were washed with Dulbecco's PBS (lx) (Biowest), counted and plated on 48 well plates and incubated for 5 hours with different LV and IDLV particles at different transduction units (TUs)/cells (from 0.3 10 TUs/cells). Media were changed after 5 hours. NPCs and 293T cells were washed with Dulbecco's PBS (lx) (Biowest), dissociated with TrypLE (GIBCO) and plated on 24 well plates in the presence of the fresh viral particles at different TUs/cells. The cell line PBMCl-iPS4Fl was incubated for 5 hours on the day of passage with a concentrated virus in the presence of 8 pg/ml Polybrene and 10 mM Y-27632 (Sigma-Aldrich).

Flow cytometry

Seventy-two hours after transduction, the different cell types were harvested and washed twice with FACS buffer (PBS containing 2 mM EDTA and 2% FBS), acquired on a FACS Canto II flow cytometer and analyzed using FACS Diva software (BD Biosciences). Green fluorescence was detected in the FITC channel.. Profile of extrachromosomal forms of IDLV DNA

The 2-L.TR/ total IDLV DNA ratio in transduced cells was determined by real-time PCR using different primer pairs (Table 1) that enable to discriminate 2LTR from total IDLV DNA. As an internal control, we also used primers for the human albumin locus (hAlb). DNA of transduced cells was extracted 72 hours after transduction using a QJAamp DNA Mini kit (QJAGEN, Hilden, Germany, https://www.qiagen.com). Real-time PCRs were performed using the QuantiTectSYBRGreen PCR kit (Qjagen) on a Stratagene MX3005P System (Agilent Technologies, Santa Clara, CA, https://www.agilent.com). The PCRs were performed using the following run program: 10' at 95^C for denaturation, 40 cycles of 15 min at 95^C, 60min at 60^C and 72^C for 60" followed by the melting curve. PCR data were analyzed according to the comparative C _T method [79]. mRNA Analysis by RT-qPCR

Total RNA was obtained using the Trizol reagent (Invitrogen) according to the manufacturer's instructions. RNA samples were reverse-transcribed using the Superscript first-strand system (Invitrogen) and qPCRs were performed using the QuantiTectSYBRGreen PCR kit (Qiagen) on a Stratagene MX3005P system (Agilent Technologies, Santa Clara, CA, www.agilent.com), The primers used are listed in table 1.

Fluorescence in situ hybridization (FISH)

A previously described ([80]FISH approach based on the use of a green fluorescent probe was employed to localize IDLVs in cells. Briefly, to generate the IDLV-FISH probe DNA from the vector plasmid was directly labeled by Nick Translation according to the manufacturer's specifications (Invitrogen, Edinburgh, Scotland). Fixed cells withCarnoy's fixative, were hybridized overnight at 37°C with the SE-probe. After post-hybridization washes, the cells were counterstained with DAPI in anti-fade solution (Molecular Probes). Images were acquired on a Zeiss LSM 710 confocal microscope (Carl Zeiss, Jena, Germany, www.zeiss.com). The extent of colocalization was performed (using Mander's overlap coefficient (MOC) [81] to quantify the degree of fluorophores colocalization between using the ZEN 2010 software (Carl Zeiss).

Table 1. Pairs of primers used to establish the 2LTR/total IDLV DNA ratio by real-time PCR and to estimate the cDNA amount of eGFP. The q2LTR pair of primer flanks the c2LTR junction. The second pair of primers amplify c2LTR, as well as clLTR and linearized IDLV DNA. The qhAlb is used as a control for genomic normalization. .GFP cDNA pair of primers, amplify the eGFP cDNA and GAPDH were used for cDNA normalization.

Isolation and culture of primary human T cells

Peripheral blood mononuclear cells (PBMCs) from a healthy donor were isolated by density gradient (Lymphosep, Biowest) and T cells were purified using the Pan T cell Isolation kit (MiltenyBiotec) following manufacturer's instructions. T lymphocytes were activated with TransAct T Cell Reagent (MiltenyBiotec) in TexMACS medium supplemented with 5% of human AB serum (male HIV tested, Biowest) and 20 L^ml ¹ of IL-2 (MiltenyBiotec) during 48h. Cells were plated at a density of 10 ⁶ cells7ml and incubated at 37^C, 5% C0 ₂ .

Primary cell cultures of human oral mucosa and skin fibroblasts

Primary cell cultures of human oral mucosa and skin fibroblasts from biopsies of normal oral mucosa and skin were obtained from healthy donors. Human oral mucosa and skin biopsies were washed in lx PBS and enzymatically digested using 2 mg/ml Clostridium histolyticum collagenase I (Gibco-BRL) at 37°C for 6 hours. Isolated fibroblasts were collected by centrifugation and expanded in culture flasks containing basal culture medium (Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 U/ml penicillin, 0.1 mg/ml streptomycin and 0.25 mg /ml amphotericin B, all from Sigma-Aldrich, St. Louis, MO, http://www.sigmaaldrich.com under standard cell culture conditions)."

T cells Transduction

Activated T cells were transduced with viral supernatants and spinoculated at 800g during lh, and cells were washed 4 hours later. Similarly, Jurkat cells resuspended in viral supernatants were spinoculated at 800g at 32^C during 30 minutes. Four hours after transduction, cells were washed and plated at a density of 100.000 cells/ml.

Flow cytometry

For T cell phenotypic characterization, cells were stained during 30 min on ice and dark with

CD45RA-PE (HI100 clone) and CD62L-PE-Cy7 (DREG56 clone) antibodies, both from eBiosciences.

Statistical Analysis

All data are represented as means +/- standard error of the mean (SEM). Statistical analysis was performed using GraphPad Prism software (GraphPad Software, Inc., La Jolla, CA, www.graphpad.com) by applying the unpaired two-tailed t-test. Statistical significance was defined as a P value <0.05.

Results The inclusion of the IS2 element in the LTR of IDLVs improves their expression levels in 293T cells in a HDAC-independent manner.

We generated IDLV particles from a SE lentiviral backbone containing or not IS2 with and without WPRE (woodchuck hepatitis virus posttranscriptional regulatory element)(Figure la). We first analyzed the efficiency of different IDLVs in 293T cells. These cells were transduced with an equal MOI, estimated based on theABM's Lentiviral qPCR Titer Kit (see material and methods) and 3 days later, we analyzed the percentage of eGFP+ cells and the transgene expression levels (measured as mean fluorescence intensity (MFI) of the eGFP+ population). We found that, the incorporation of the IS2 element into the IDLVs significantly increased the expression levels of eGFPin the absence and presence of the WPRE element (Figure lb-(MFI) and Figure lc, bottom graphs). We also found an increase in the percentage of GFP positive cells, which, reached significance only in the absence of the WPRE element (Figure lb-% and Figure lc, upper graphs). We further corroborated that the effect of the IS2 element on IDLVs was maintained at higher MOIs (Fig 8)

Prevention of histone deacetylation as the main factor underlying weak IDLV transcriptional activity, could explain the higher SE-IS2-IDLV expression levels. In order to study this possibility, we analyzed SE-IDLV and SE-IS2 IDLV GFP expression levels in the presence and absence of apicidin, a HDAC inhibitor. As can be observed in Figure 2, the addition of apicidin enhancedthe eGFP expression to a similar degree in both cells transduced with SE-IDLV and in those transduced with SE-IS2-IDLV(2.90-foldand 2.35-fold, respectively). These findings suggest that IS2-mediated enhancement is caused by a HDAC-independent mechanism.

The insertion of IS2 element into the IDLV backbone does not affect RNA packaging into vector particles but reduces the amount of IDLV episomes in the target cells. It has been described previously that insertions of large fragments into the 3'LTR of LVs reduce their efficacy. These insertions do not affect viral particles production but reduce reverse transcription efficacy in target cells. We therefore analyzed the effect of IS2 (1.2kb long) on LVs and IDLVs transgene expression, vector production and reverse transcription products in 293T target cells.The vector production efficacy was measured from the vector supernatants using the ABM's Lentiviral qPCR Titer Kit. This Kit calculates the transduction units (TU) per milliliter (ml) based on an equation that convert genome copies per ml (GC/ml) values to TU/ml(See material and methods for details). The value obtained using this formula is generally very close to the amount of effective particles per ml, although this can vary depending on the vector backbone. The relative amounts of reverse transcription products of the different vectors were quantified by qPCR using the U3Fw/PBSRev primer pair (see Fig 9). As expected, we did not observe any effect of the IS2 on vector production of LVs or IDLVs. In addition, the insertion of IS2 into the LTR had a negative effect on the expression levels of integrative LVs (Figure 3a; left plots) that correlated with a reduction of the amount of reverse transcribed products in target cells (Figure 3b; top graph). Interestingly, although the insertion IS2 also caused a similar reduction of IDLVs reverse transcription products (Figure 3b; bottom graph), we observed a significant improvement in both, the percentage and the expression levels (Figure 3a; right plots).

IDLVs episomesharbouring the IS2 element express higher mRNA levels and have a distinct nuclear localization.

The IS2 is a chimeric DNA element containing a synthetic scaffold attachment region (SAR2) and a 650 pb fragment of the chicken b-globin HS4 insulator (Benabdellah, K., et al., A chimeric HS4- SAR insulator (IS2) that prevents silencing and enhances expression of lentiviral vectors in pluripotent stem cells. PLoS One, 2014. 9(1): p. e84268.]. As already mentioned, these elements could enhance transcription or increase episomalestability that can also lead to an improved transgene expression. In order to study the mechanisms involved in the IS2 effect, we first analyzed the increment in transcriptional efficacy of SE-IS2 episomes in comparison with SE episomes. To do that, we measured eGFP mRNA expression levels of 293T cells transduced with equivalent MOIs of SE-IDLV and SE-IS2-IDLV at 72h post transduction and normalized to the amount of vector genomes (Figure 4a). This analysis showed that the SE-IS2 episomes express 6-7 times more mRNA than SE-

We next analyzed whether the enhanced transcriptional activity of SE-IS2 episomes was due to an effect on their longtime stability. We therefore studied the eGFP expression levels (Figure 4b) and the relative amount of SE-IS2 episomes (Figure 4c) related to SE episomes at different time points post-transduction (24h to 7 days). Our data showed that the IS2 element does not influence the stability of the IDLVs expression (Figure 4c) or the stability of IDLVs episomes (Figure 4c).

We finally analyzed whether the presence of the IS2 in the IDLV episomes could influence their nuclear localization to transcriptionally active sites since SARs elements bind several factors that promote the aggregationof nucleoproteins, HDAC recruitment and chromatin remodeling complexes that enhance transcription. We performed a FISH analysis on 293T cells transduced with SE-IDLVs and SE-IS2-IDLVs at an MOI = 10 using SE plasmid as probe. As we can observe in Figure 4e and Figure 10 the SE-IDLVs episomes are uniformly distributed inside the nuclei, while the SE-IS2- IDLVs episomes follow a more aggregated pattern. An analysis of the DAPI/Probe co-localization indicated that the episomes harboring IS2 localized preferentially into regions with lower DAPI signal compared to the SE-IDLVs episomes (Figure 4C graph). These data indicated that the better behavior of SE-IS2-IDLVs episomes is probably in part due to a distinct nuclear re-positioning compared to SE-IDLVs episomes.

Insertion of the IS2 element into the IDLVs reduces the formation of lower expressing 2-LTR circles.

Large LTR inserts such as the IS2 element can also increase homologous LTR recombination favoring 1-LTR circles formation that are superior to 2-LTR circles in terms of transgenic expression and this could be another potential mechanism behind the improved transcriptional activity of SE- IS2-I DLVs. In order to study this possibility, we generated a control IDLV (SE-1.2kb) harboring an equivalent insertion (1.2kb) of irrelevant DNA at the same LTR location (Figure 5a) and compared it effect on IDLVs behavior. As observed previously with the IS2 element, the insertion of the 1.2kb fragment did not affect vector titer (estimated as TU/ml) (Figue 5b) and reduced 4-5 times the amount of reverse transcribed products in 293T target cells (Figure 5e). Additionally, as expected by their increased LTR size, the amount of 2-LTR circles related to total episomes was reduced similarly on SE-IS2 and SE-1.2kb IDLVs (Figure 5e) suggesting a similar increase on 1LTR circles. However, contrary to the SE-IS2-IDLVs, the transgene expression of SE-1.2kb-IDLVs was 2.5 lower than SE- IDLVs (Figure 5d), that correlates with the observed reduction on IDLVs episomes (Figure 5c). These data indicate that the decrease of the 2LTR dries is not the main mechanism involved on the increased transcriptional activity of the SE-IS2-IDLVs episomes, since the 293T cells transduced with the SE-1.2kb IDLVsshowed similar 2LTR decrease but no effect on transcription efficacy.

The final effect of the IS2 element depends on the target cell and vector backbone.

We next studied the potential applications of IS2-I DLVs in different target cells of interest with regard to gene therapy and/or basic research such as neural progenitor cells (NPCs), neuronal cells (NCs), induced pluripotent stem cells (iPSCs), mesenchymal stromal cells (MSCs), human oral mucosa and skin fibroblasts and T cells. The different cell types were transduced with SE-IDLVs and SE-IS2-IDLVs at equal MOIs and, 3 days later, we analyzed transgen expression levels in terms of Mean fluorescence intensity (MFI) and percentage of eGFP+ cells. The incorporation of the IS2 element resulted in a marked increase in GFP expression levels in NPCs regardless of the presence or absence of the WPRE element (MFI SE= 740 versus SE-IS2 =2048 and SEWP=4410 versus SEWPIS2=10073) (Figure 5a). However, in differentiated neurons (Figures6b and S4), the inclusion of IS2 enhanced expression levels only in WPRE-negative IDLVs (MFI SE=797 versus SE-IS2=2178),a positive effect which was masked by the inclusion of the WPRE sequence (Figure 6b, bottom panels). As previously shown in undifferentiated neurons, the incorporation of IS2 into the IDLV backbone significantly improved performance in iPSCseither in the absence (Figure 7a top plot; MFI SE-IS2 = 894 versus MFI SE = 613), and in the presence of WPRE(Figure 6a bottom plot, MFI SEWP- IS2 = 1426 versus MFI SEWP = 1154, 6b right graph). We couldnot find any significant positive effect of IS2-IDLV in terms of global effects on the percentage of eGFP+ cells and expression levels in the different T cell subpopulations (Figurel2), or primary fibroblasts from oral mucosa and skin or MSCs (Figure 13).

We finally analyzed whether the IS2 element had a similar effect when inserted in a different IDLV expressing the transgene under a physiological promoter. We used a LV backbone previously published (AWE) ([Frecha, C., et al., Improved lentiviral vectors for Wiskott-Aldrich syndrome gene therapy mimic endogenous expression profiles throughout haematopoiesis. Gene Ther, 2008. 15(12): p. 930-41.] that expressed eGFP trough the WAS{ Wiskott-Aldrich syndrome) promoter and generated the IS2-AWE (Figure S7). Since the WAS promoter is hematopoietic-specific, we tested the behavior of AWE-IDLV versus AWE-IS2 IDLVs in Jurkat cells (an immortalized line of human T lymphocytes). As can be observed in Figure 14, the results were similar to that obtained with the SEIDLVs. Indeed, although the cells transduced with AWE-IS2-IDLVs had 3-4 times lower episome numbers compared to those transduced with AWE IDLVs on target cells, they expressed similar or slightly higher levels of eGFP.