Background of the invention Several different versions of cell-free protein synthesis systems have been developed over the past decade that are well-known in the art. Some are based on the use of cell lysats, often derived from rabbit reticulocyte, wheat germ, or Escherichia coli cells.

Other approaches are based on the development of expression systems reconstituted from recombinant proteins purified to homogeneity. These systems have been substantially improved over the last years, commercially available cell free protein synthesis kits are now capable of producing as much as 100 microgram of protein per ml. or more.

The industrial importance of polypeptides is well known, and the construction and testing of variants of industrially important polypeptides have been areas of intense research activity for decades, especially within the area of industrial enzymes such as proteases and amylases etc. Site-directed mutagenesis has been employed to introduce specific amino acid substitutions, deletions, and/or integrations at pre-defined positions in such polypeptides.

Randomized shuffling protocols are also well known in the art, wherein polynucleotides encoding related polypeptides are"shuffled"or recombined in order to create libraries of new polypeptides with altered properties of interest; not variant libraries as such, but larger and more diverse libraries.

In vitro suppression is an extension of the in vitro polypeptide expression technique which utilizes the existing cell-free protein synthesis technology and the knowledge of tRNA suppressors, which by suppression of nonsense mutations (stop codons) will allow translation of the mRNA to proceed via read through of the stop codon, as is well described in the art. In vitro suppression has primarily been used to investigate single specific amino acid substitutions, mostly with unnatural amino acids (Short et al.,. Biochemistry 1999,38, pp: 8808-8819).

In vitro translation of polypeptide variants offers a number of benefits over in vivo expression. For instance, where variants of anti-microbial polypeptides are wanted, the more

potent variants may never be detected in vivo, because the host cell may be killed before any detectable amount of the polypeptide is produced. Further, in vivo expression is time- consuming when compared to in vitro expression, due to the comparably large number of operations necessary e. g. the introduction of the encoding polynucleotide into a host cell, the cultivation of the host cell, and the purification of the expressed polypeptide.

The present inventors have in this invention combined in vitro suppression technology and the research area of creating polypeptide variant libraries, a combination which has resulted in substantial benefits. Thus the invention provides a method for efficient generation of a library of variant polypeptides comprising any amino acid replacement (s) in any pre-defined position (s) of any polypeptide (s) of interest. In the method of the invention, there is no longer any requirement for the cumbersome manufacture of a new polynucleotide for each specific amino acid variation that one would like to investigate in the encoded polypeptide.

Summary of the invention It is of both scientific and industrial interest to create variant libraries of polypeptides of interest, in order to obtain variants having altered properties when compared to the parent polypeptide, to elucidate structure-function relationships, and for many other purposes.

Variant libraries varying in specific amino acid positions have been produced by site-directed mutagenesis and PCR-based methods, where the encoding sequences were changed to encode all amino acids, or those of interest, in that position. For instance, in order to achieve full variety at any given single amino acid position with conventional site-directed mutation techniques, it would be necessary to create 20 specific encoding genes with a single codon- variation between them.

There remain significant interest and need for the optimization of such processes to achieve more rapid and more efficient protocols for variant library generation. A problem to be solved by the present invention is to generate a library of variant polypeptides in pre- defined amino acid positions in an efficient manner. The present invention offers the ability to introduce all 20 amino acids into any pre-defined position of any given polypeptide after only one site-directed mutagenesis step, wherein a stop codon is introduced into the encoding polynucleotide. An in vitro transcription/translation system using suppressor tRNA charged with different amino acids will enable subsequent production of all the amino acid variants of the polypeptide simultanously in parallel reactions. Chemical charging of tRNA's with amino acids has been described in numerous publications, such as Ibba, M. (1995) Biotechnol. and Genetic Engineering Reviews. (13): 204-210. Roesser, J. R. et al. (1989) Biochem. 28: 5185- 5195. Krzyzaniak A. et al. (1998) Biochem and Mol Biol Int'l. 45 (3): 489-500. In vitro

translocation has also been described, see e. g. Walter, P. and Blobel, G. (1983) Meth.

Enzymol. 96,84. Additionally, a large number of kits for in vitro translation and transcription/translation are commercially available from e. g. Ambion Inc., Amersham Pharmacia Biotec Inc., Novagen Inc., Promega Inc., Roche Molecular Biochemical Inc., Sigma Inc., and Stratagene Inc.

Accordingly, in a first aspect the present invention relates to a method for generating polypeptide variants in vitro from a parent polynucleotide encoding a polypeptide of interest, the method comprising the steps of: a) providing a reaction mixture capable of in vitro transcription and translation of a template polynucleotide under suitable conditions, b) providing a polynucleotide construct comprising: i) a part which has promoter activity in the mixture of (a), ii) a part downstream of (i) which is a modified parent polynucleotide, wherein a sequence encoding one or more stop codon (s) has been introduced in at least one pre-defined codon position (s) in the encoding part of the parent polynucleotide without causing any frameshift mutations, and iii) a part downstream of (ii) which has transcription terminating activity in the mixture of (a); c) providing for each different stop codon pools of suppressor tRNA that suppresses the stop codon (s) of (ii), wherein the suppressor tRNA of each pool is charged with a different amino acid; d) mixing in separate reaction vessels, in no particular order: the reaction mixture of (a), the polynucleotide construct of (b), and for each different stop codon suppressor tRNA from each pool of (c); and e) carrying out the in vitro transcription and translation reaction (s) under the conditions of (a), wherein polypeptide variants are generated.

In the method of the first aspect, it is contemplated that some of the components may be premixed and stored before adding one more final components and performing step e); the reaction mixture of step a) and the pools of suppressor tRNA may be mixed to form pools of full reaction mix, where only the addition of the modified polynucleotide is needed before carrying out step e). In fact, the present inventors contemplate a ready made variant expression kit, where a selection of tRNA are charged with a number of amino acids e. g. all natural and optionally also non-natural amino acids and mixed with a suitable reaction mixture of the invention in separate but connected reaction vessels such as a microtiter plate. Such a kit may be used for variant library generation using any parent polynucleotide

encoding a polypeptide of interest, where one or more stop codon (s) has been introduced according to the method of the invention.

Accordingly in a second aspect the invention relates to a kit for generating polypeptide variants in vitro from a parent polynucleotide encoding a polypeptide of interest, the kit comprising: a) a reaction mixture capable of in vitro transcription and translation of a template polynucleotide under suitable conditions, b) at least two pools of suppressor tRNA charged with different amino acids, preferably at least three pools, more preferably at least four pools, and most preferably at least five pools.

In a third aspect the invention relates to a polypeptide variant of interest, obtained by a method as defined in the first aspect.

In a fourth aspect the invention relates to a polynucleotide encoding a polypeptide variant of interest as defined in the previous aspect, wherein the polynucleotide was constructed on the basis of sequence information obtained by a method as defined in the first aspect.

Further, in a fifth aspect, the invention relates to a process for producing a polypeptide of interest comprising cultivating a host cell that produces a polypeptide of interest as defined in the third aspect, or expresses a polynucleotide as defined in the fourth aspect, and subsequently isolating the polypeptide of interest.

In a final aspect the invention relates to the use of a method as defined in the first aspect to produce variants of a polypeptide of interest.

Definitions The following section provides definitions of technical features in above mentioned aspects of the invention.

The term"a gene"denotes herein a gene which is capable of being expressed into a polypeptide within a living cell or by an appropriate expression system. Accordingly, said gene is defined as an open reading frame starting from a start codon (normally"ATG", "GTG", or"TTG") and ending at a stop codon. In order to express said gene there must be elements, as known in the art, in connection with the gene, necessary for expression of the gene within the cell. Such standard elements may include a promoter, a ribosomal binding site, a termination sequence, and maybe others elements as known in the art.

The term"substantially pure polynucleotide"as used herein refers to a polynucleotide preparation, wherein the polynucleotide has been removed from its natural genetic milieu,

and is thus free of other extraneous or unwanted coding sequences as well as free charged tRNA's, and is in a form suitable for use within genetically engineered protein production systems.

Thus, a substantially pure polynucleotide contains at the most 10% by weight of other polynucleotide material with which it is naively associated (lower percentages of other polynucleotide material are preferred, e. g. at the most 8% by weight, at the most 6% by weight, at the most 5% by weight, at the most 4% at the most 3% by weight, at the most 2% by weight, at the most 1% by weight, and at the most 1/2% by weight). A substantially pure polynucleotide may, however, include naturally occurring 5'and 3'untranslated regions, such as promoters and terminators.

It is preferred that the substantially pure polynucleotide is at least 92% pure, i. e. that the polynucleotide constitutes at least 92% by weight of the total polynucleotide material present in the preparation, and higher percentages are preferred such as at least 94% pure, at least 95% pure, at least 96% pure, at least 97% pure, at least 98% pure, at least 99%, and at the least 99.5% pure.

The polynucleotides disclosed herein are preferably in a substantially pure form. In particular, it is preferred that the polynucleotides disclosed herein are in"essentially pure form", i. e. that the polynucleotide preparation is essentially free of other polynucleotide material with which it is naively associated. Herein, the term"substantially pure polynucleotide"is synonymous with the terms"isolated polynucleotide"and"polynucleotide in isolated form".

A"polynucleotide"is a single-or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5'to the 3'end. Polynucleotides include RNA and DNA, and may be isolated from natural sources, synthesized in vitro, or prepared from a combination of natural and synthetic molecules.

A"nucleic acid molecule"refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine;"RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules") in either single stranded form, or a double-stranded helix. Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary or quaternary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e. g. , restriction fragments), plasmids, and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences may be described herein according to the normal convention of giving only the sequence in the 5'to 3'direction along the

nontranscribed strand of DNA (i. e. , the strand having a sequence homologous to the mRNA).

A"recombinant DNA molecule"is a DNA molecule that has undergone a molecular biological manipulation.

The term"homologous"in the present context means that the two homologous polynucleotides or polypeptides have a"degree of identity"of at least 60%, more preferably at least 70%, even more preferably at least 85%, still more preferably at least 90%, more preferably at least 95%, and most preferably at least 98%. Whether two polynucleotide or polypeptide sequences have a sufficiently high degree of identity to be homologous as defined herein, can suitably be investigated by aligning the two sequences using a computer program known in the art, such as"GAP"provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) (Needleman, S. B. and Wunsch, C. D., (1970), Journal of Molecular Biology, 48,443-453). Using GAP with the following settings for DNA sequence comparison: GAP creation penalty of 5.0 and GAP extension penalty of 0.3.

"Nucleic acid construct"or"polynucleotide construct"when used herein, these terms mean a nucleic acid molecule, either single-or double-stranded, which is isolated from a naturally occurring source or which has been modified to contain segments of nucleic acids in a manner that would not otherwise exist in nature. The term nucleic acid construct is synonymous with the term"expression cassette"when the nucleic acid construct contains the control sequences required for expression of a coding sequence of the present invention.

"Control sequence"is defined herein to comprise all components that are necessary or advantageous for the expression of a polynucleotide of the present invention. Each control sequence may be native or foreign to the nucleotide sequence encoding the polypeptide. Such control sequences include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, signal peptide sequence, and transcription terminator. At a minimum, the control sequences include a promoter, and transcriptional and translational stop signals. The control sequences may be provided with linkers for the purpose of introducing specific restriction sites facilitating ligation of the control sequences with the coding region of the nucleotide sequence encoding a polypeptide.

A"secretory signal sequence"is a DNA sequence that encodes a polypeptide (a "secretory peptide"that, as a component of a larger polypeptide, directs the larger polypeptide through a secretory pathway of a cell in which it is synthesized. The larger polypeptide is commonly cleaved to remove the secretory peptide during transit through the secretory pathway.

The term"promoter"is used herein for its art-recognized meaning to denote a portion of a gene containing DNA sequences that provide for the binding of RNA polymerase

and initiation of transcription. Promoter sequences are commonly, but not always, found in the 5'non-coding regions of genes.

"Operably linked"is defined herein as a configuration in which a control sequence is appropriately placed at a position relative to the coding sequence of the polynucleotide sequence such that the control sequence directs the expression of the polynucleotide.

"Coding sequence"is intended to cover a polynucleotide sequence, which directly specifies the amino acid sequence of its protein product. The boundaries of the coding sequence are generally determined by an open reading frame, which usually begins with an ATG start codon. The coding sequence typically include DNA, cDNA, and recombinant nucleotide sequences.

In the present context, the term"expression"includes any step involved in the production of a polypeptide including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification, and secretion.

In the present context, the term"expression vector"covers a polynucleotide molecule, linear or circular, that comprises a polynucleotide segment encoding a polypeptide of interest, and which is operably linked to additional segments that provide for the expression.

Promoters Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention, especially in a bacterial host cell, are the promoters obtained from the E. coli lac operon, the Streptomyces coelicolor agarase gene (dagA), the Bacillus subtilis levansucrase gene (sacB), the Bacillus subtilis alkaline protease gene, the Bacillus licheniformis alpha-amylase gene (amyL), the Bacillus stearothermophilus maltogenic amylase gene (amyM), the Bacillus amyloliquefaciens alpha-amylase gene (amyQ), the Bacillus amyloliquefaciens BAN AMYLASE GENE, the Bacillus licheniformis penicillinase gene (penP), the Bacillus subtilis xylA and oxyl8 genes, and the prokaryotic beta- lactamase gene (Villa-Kamaroff et aL, 1978, Proceedings of the National Academy of Sciences USA 75: 3727-3731), as well as the tac promoter (DeBoer et al., 1983, Proceedings of the National Academy of Sciences USA 80: 21-25), or the Bacillus pumilus xylosidase gene, or by the phage Lambda PR or PL promoters or the E. coli lac, trp or tac promoters.

Further promoters are described in"Useful proteins from recombinant bacteria"in Scientific American, 1980,242 : 74-94; and in Sambrook et al., 1989, supra, or the promoter variants disclosed in WO 93/10249 and WO 99/43835.

Examples of suitable promoters for directing the transcription of the nucleic acid constructs of the present invention in a filamentous fungal host cell are promoters obtained from the genes encoding Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic

proteinase, Aspergillus niger neutral alpha-amylase, Aspergillus niger acid stable alpha- amylase, Aspergillus niger or Aspergillus awamori glucoamylase (glaA), Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase, Aspergillus nidulans acetamidase, Fusarium oxysporum trypsin-like protease (as described in U. S. Patent No. 4,288, 627, which is incorporated herein by reference), and hybrids thereof. Particularly preferred promoters for use in filamentous fungal host cells are the TAKA amylase, NA2-tpi (a hybrid of the promoters from the genes encoding Aspergillus niger neutral a-amylase and Aspergillus oryzae triose phosphate isomerase), and glad promoters.

Further suitable promoters for use in filamentous fungus host cells are the ADH3 promoter (McKnight et al., The EMBO J. 4 (1985), 2093-2099) or the tpiA promoter.

Examples of suitable promoters for use in yeast host cells include promoters from yeast glycolytic genes (Hitzeman et al., J. Biol. Chem. 255 (1980), 12073-12080; Alber and Kawasaki, J. Mol. Appl. Gen. 1 (1982), 419-434) or alcohol dehydrogenase genes (Young et al., in Genetic Engineering of Microorganisms for Chemicals (Hollaender et al, eds. ), Plenum Press, New York, 1982), or the TPI1 (US 4,599, 311) or ADH2-4c (Russell et al., Nature 304 (1983), 652-654) promoters.

Further useful promoters are obtained from the Saccharomyces cerevisiae enolase (ENO-1) gene, the Saccharomyces cerevisiae galactokinase gene (GAL1), the Saccharomyces cerevisiae alcohol dehydrogenase/glyceraldehyde-3-phosphate dehydrogenase genes (ADH2/GAP), and the Saccharomyces cerevisiae 3-phosphoglycerate kinase gene. Other useful promoters for yeast host cells are described by Romanos et aL, 1992, Yeast 8 : 423-488. In a mammalian host cell, useful promoters include viral promoters such as those from Simian Virus 40 (SV40), Rous sarcoma virus (RSV), adenovirus, and bovine papilloma virus (BPV).

Examples of suitable promoters for directing the transcription of the DNA encoding the polypeptide of the invention in mammalian cells are the SV40 promoter (Subramani et al., Mol. Cell Biol. 1 (1981), 854-864), the MT-1 (metallothionein gene) promoter (Palmiter et al., Science 222 (1983), 809-814) or the adenovirus 2 major late promoter.

An example of a suitable promoter for use in insect cells is the polyhedrin promoter (US 4,745, 051; Vasuvedan et al., FEBS Lett. 311, (1992) 7-11), the P10 promoter (J. M.

Vlak et al., J. Gen. Virology 69, 1988, pp. 765-776), the Autographa califomica polyhedrosis virus basic protein promoter (EP 397 485), the baculovirus immediate early gene 1 promoter (US 5,155, 037; US 5,162, 222), or the baculovirus 39K delayed-early gene promoter (US 5,155, 037; US 5,162, 222).

Terminators

Transcription terminator sequences, are sequences recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3'terminus of the nucleotide sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used in the present invention.

Preferred terminators for prokaryotic host cells are obtained from the genes encoding Bacillus amylases, e. g. the Bacillus licheniformis alpha-amylase amyL.

Preferred terminators for filamentous fungal host cells are obtained from the genes encoding Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, Aspergillus niger alpha-glucosidase, and Fusarium oxysporum trypsin-like protease. for fungal hosts) the TP11 (Alber and Kawasaki, op. cit. ) or<BR> ADH3 (McKnight et al., op. cit. ) terminators.

Preferred terminators for yeast host cells are obtained from the genes encoding Saccharomyces cerevisiae enolase, Saccharomyces cerevisiae cytochrome C (CYC1), or Saccharomyces cerevisiae glyceraldehyde-3-phosphate dehydrogenase. Other useful terminators for yeast host cells are described by Romanos et al., 1992, supra.

Polvadenviation Signals Preferred polyadenylation sequences for filamentous fungal host cells are obtained from the genes encoding Aspergillus oryzae TAKA amylase, Aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthase, and Aspergillus niger alpha-glucosidase.

Useful polyadenylation sequences for yeast host cells are described by Guo and Sherman, 1995, Molecular Cellular Biology 15: 5983-5990.

Polyadenylation sequences are well known in the art for mammalian host cells such as SV40 or the adenovirus 5 Elb region.

Siqnal Sequences An effective signal peptide coding region for bacterial host cells is the signal peptide coding region obtained from the maltogenic amylase gene from Bacillus NCIB 11837, the Bacillus stearothermophilus alpha-amylase gene, the Bacillus licheniformis subtilisin gene, the Bacillus licheniformis alpha-amylase gene, the Bacillus stearothermophilus neutral proteases genes (nprT, nprS, nprM), and the Bacillus subtilis PrsA gene. Further signal peptides are described by Simonen and Palva, 1993, Microbiological Reviews 57 : 109-137.

An effective signal peptide coding region for filamentous fungal host cells is the signal peptide coding region obtained from Aspergillus oryzae TAKA amylase gene, Aspergillus niger neutral amylase gene, the Rhizomucor miehei aspartic proteinase gene, the Humicola lanuginosa cellulase or lipase gene, or the Rhizomucor miehei lipase or protease

gene, Aspergillus sp. amylase or glucoamylase, a gene encoding a Rhizomucor miehei lipase or protease. The signal peptide is preferably derived from a gene encoding A. oryzae TAKA amylase, A. niger neutral a-amylase, A. niger acid-stable amylase, or A. niger glucoamylase.

Useful signal peptides for yeast host cells are obtained from the genes for Saccharomyces cerevisiae a-factor and Saccharomyces cerevisiae invertase. Other useful signal peptide coding regions are described by Romanos et al., 1992, supra.

For secretion from yeast cells, the secretory signal sequence may encode any signal peptide which ensures efficient direction of the expressed polypeptide into the secretory pathway of the cell. The signal peptide may be naturally occurring signal peptide, or a functional part thereof, or it may be a synthetic peptide. Suitable signal peptides have been found to be the a-factor signal peptide (cf. US 4, 870, 008), the signal peptide of mouse salivary amylase (cf. O. Hagenbuchle et al., Nature 289,1981, pp. 643-646), a modified carboxypeptidase signal peptide (cf. L. A. Valls et al., Cell 48,1987, pp. 887-897), the yeast BAR1 signal peptide (cf. WO 87/02670), or the yeast aspartic protease 3 (YAP3) signal peptide (cf. M. Egel-Mitani et al., Yeast 6,1990, pp. 127-137).

For efficient secretion in yeast, a sequence encoding a leader peptide may also be inserted downstream of the signal sequence and uptream of the DNA sequence encoding the polypeptide. The function of the leader peptide is to allow the expressed polypeptide to be directed from the endoplasmic reticulum to the Golgi apparatus and further to a secretory vesicle for secretion into the culture medium (i. e. exportation of the polypeptide across the cell wall or at least through the cellular membrane into the periplasmic space of the yeast cell). The leader peptide may be the yeast a-factor leader (the use of which is described in e. g. US 4,546, 082, EP 16 201, EP 123 294, EP 123 544 and EP 163 529). Alternatively, the leader peptide may be a synthetic leader peptide, which is to say a leader peptide not found in nature. Synthetic leader peptides may, for instance, be constructed as described in WO 89/02463 or WO 92/11378.

For use in insect cells, the signal peptide may conveniently be derived from an insect gene (cf. WO 90/05783), such as the lepidopteran Manduca sexta adipokinetic hormone precursor signal peptide (cf. US 5,023, 328).

Expression Vectors The present invention also relates to recombinant expression vectors comprising a nucleic acid sequence of the present invention, a promoter, and transcriptional and translational stop signals. The various nucleic acid and control sequences described above may be joined together to produce a recombinant expression vector which may include one

or more convenient restriction sites to allow for insertion or substitution of the nucleic acid sequence encoding the polypeptide at such sites. Alternatively, the nucleic acid sequence of the present invention may be expressed by inserting the nucleic acid sequence or a nucleic acid construct comprising the sequence into an appropriate vector for expression. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression, and possibly secretion.

The recombinant expression vector may be any vector (e. g. , a plasmid or virus) which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the nucleic acid sequence. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced.

The vectors may be linear or closed circular plasmids. The vector may be an autonomously replicating vector, i. e., a vector which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e. g. , a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome (s) into which it has been integrated. The vector system may be a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon.

The vectors of the present invention preferably contain one or more selectable markers which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like. Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers which confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol, tetracycline, neomycin, hygromycin or methotrexate resistance. A frequently used mammalian marker is the dihydrofolate reductase gene (DHFR). Suitable markers for yeast host cells are ADE2, HIS3, LEU2, LYS2, MET3, TRP1, and URA3. A selectable marker for use in a filamentous fungal host cell may be selected from the group including, but not limited to, amdS (acetamidase), argB (ornithine carbamoyltransferase), bar (phosphinothricin acetyltransferase), hygB (hygromycin phosphotransferase), niaD (nitrate reductase), pyrG (orotidine-5'-phosphate decarboxylase), sC (sulfate adenyltransferase), trpC (anthranilate synthase), and glufosinate resistance markers, as well as equivalents from other species. Preferred for use in an Aspergillus cell are the amdS and pyrG markers of Aspergillus nidulans or Aspergillus oryzae and the bar marker of Streptomyces hygroscopicus. Furthermore, selection may be

accomplished by co-transformation, e. g. , as described in WO 91/17243, where the selectable marker is on a separate vector.

The vectors of the present invention preferably contain an element (s) that permits stable integration of the vector into the host cell genome or autonomous replication of the vector in the cell independent of the genome of the cell.

The vectors of the present invention may be integrated into the host cell genome when introduced into a host cell. For integration, the vector may rely on the nucleic acid sequence encoding the polypeptide or any other element of the vector for stable integration of the vector into the genome by homologous or nonhomologous recombination.

Alternatively, the vector may contain additional nucleic acid sequences for directing integration by homologous recombination into the genome of the host cell. The additional nucleic acid sequences enable the vector to be integrated into the host cell genome at a precise location (s) in the chromosome (s). To increase the likelihood of integration at a precise location, the integrational elements should preferably contain a sufficient number of nucleic acids, such as 100 to 1,500 base pairs, preferably 400 to 1,500 base pairs, and most preferably 800 to 1,500 base pairs, which are highly homologous with the corresponding target sequence to enhance the probability of homologous recombination. The integrational elements may be any sequence that is homologous with the target sequence in the genome of the host cell. Furthermore, the integrational elements may be non-encoding or encoding nucleic acid sequences. On the other hand, the vector may be integrated into the genome of the host cell by non-homologous recombination. These nucleic acid sequences may be any sequence that is homologous with a target sequence in the genome of the host cell, and, furthermore, may be non-encoding or encoding sequences.

For autonomous replication, the vector may further comprise an origin of replication enabling the vector to replicate autonomously in the host cell in question. Examples of bacterial origins of replication are the origins of replication of plasmids pBR322, pUC19, pACYC177, pACYC184, pUB110, pE194, pTA1060, and paß1. Examples of origin of replications for use in a yeast host cell are the 2 micron origin of replication, the combination of CEN6 and ARS4, and the combination of CEN3 and ARS1. The origin of replication may be one having a mutation which makes its functioning temperature-sensitive in the host cell (see, e. g., Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75 : 1433).

More than one copy of a nucleic acid sequence encoding a polypeptide of the present invention may be inserted into the host cell to amplify expression of the nucleic acid sequence. Stable amplification of the nucleic acid sequence can be obtained by integrating at least one additional copy of the sequence into the host cell genome using methods well known in the art and selecting for transformants.

The procedures used to ligate the elements described above to construct the recombinant expression vectors of the present invention are well known to one skilled in the art (see, e. g. , Sambrook et a/., 1989, supra).

Host Cells The present invention also relates to recombinant host cells, comprising a nucleic acid sequence of the invention, which are advantageously used in the recombinant production of the polypeptides. The term"host cell"encompasses any progeny of a parent cell which is not identical to the parent cell due to mutations that occur during replication.

The cell is preferably transformed with a vector comprising a nucleic acid sequence of the invention followed by integration of the vector into the host chromosome.

"Transformation"means introducing a vector comprising a nucleic acid sequence of the present invention into a host cell so that the vector is maintained as a chromosomal integrant or as a self-replicating extra-chromosomal vector. Integration is generally considered to be an advantage as the nucleic acid sequence is more likely to be stably maintained in the cell. Integration of the vector into the host chromosome may occur by homologous or non-homologous recombination as described above.

The choice of a host cell will to a large extent depend upon the gene encoding the polypeptide and its source. The host cell may be a unicellular microorganism, e. g. , a<BR> prokaryote, or a non-unicellular microorganism, e. g. , a eukaryote. Useful unicellular cells are bacterial cells such as gram positive bacteria including, but not limited to, a Bacillus cell, e. g., Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus coagulans, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus megaterium, Bacillus stearothermophilus, Bacillus subtilis, and Bacillus thuringiensis ; or a Streptomyces cell, e. g., Streptomyces lividans or Streptomyces murinus, or gram negative bacteria such as E. coli and Pseudomonas sp. In a preferred embodiment, the bacterial host cell is a Bacillus lentus, Bacillus licheniformis, Bacillus stearothermophilus or Bacillus subtilis cell.

The transformation of a bacterial host cell may, for instance, be effected by protoplast transformation (see, e. g. , Chang and Cohen, 1979, Molecular General Genetics 168: 111-<BR> 115), by using competent cells (see, e. g. , Young and Spizizin, 1961, Journal of Bacteriology 81: 823-829, or Dubnar and Davidoff-Abelson, 1971, Journal of Molecular Biology 56: 209- 221), by electroporation (see, e. g. , Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or by conjugation (see, e. g., Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771- 5278).

The host cell may be a eukaryote, such as a mammalian cell, an insect cell, a plant cell or a fungal cell. Useful mammalian cells include Chinese hamster ovary (CHO) cells,

HeLa cells, baby hamster kidney (BHK) cells, COS cells, or any number of other immortalized cell lines available, e. g. , from the American Type Culture Collection.

Examples of suitable mammalian cell lines are the COS (ATCC CRL 1650 and 1651), BHK (ATCC CRL 1632,10314 and 1573, ATCC CCL 10), CHL (ATCC CCL39) or CHO (ATCC CCL 61) cell lines. Methods of transfecting mammalian cells and expressing DNA sequences introduced in the cells are described in e. g. Kaufman and Sharp, J. Mol. Biol. 159 (1982), 601-621; Southern and Berg, J. Mol. Appl. Genet. 1 (1982), 327-341; Loyter et al., Proc.

Natl. Acad. Sci. USA 79 (1982), 422-426; Wigler et al., Cell 14 (1978), 725; Corsaro and Pearson, Somatic Cell Genetics 7 (1981), 603, Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Inc., N. Y. , 1987, Hawley-Nelson et al., Focus 15 (1993), 73; Ciccarone et al., Focus 15 (1993), 80; Graham and van der Eb, Virology 52 (1973), 456; and Neumann et al., EMBO J. 1 (1982), 841-845.

In a preferred embodiment, the host cell is a fungal cell."Fungi"as used herein includes the phyla Ascomycota, Basidiomycota, Chytridiomycota, and Zygomycota (as defined by Hawksworth et al., In, Ainsworth and Bisby's Dictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, UK) as well as the Oomycota (as cited in Hawksworth et al., 1995, supra, page 171) and all mitosporic fungi (Hawksworth et al., 1995, supra). Representative groups of Ascomycota include, e. g., Neurospora, Eupenicillium (=Penicillium), Emericella (=Aspergillus), Eurotium (=Aspergillus), and the true yeasts listed above. Examples of Basidiomycota include mushrooms, rusts, and smuts.

Representative groups of Chytridiomycota include, e. g., Allomyces, Blastocladiella, Coelomomyces, and aquatic fungi. Representative groups of Oomycota include, e. g., Saprolegniomycetous aquatic fungi (water molds) such as Achlya. Examples of mitosporic fungi include Aspergillus, Penicillium, Candida, and Altemaria. Representative groups of Zygomycota include, e. g., Rhizopus and Mucor.

In a preferred embodiment, the fungal host cell is a yeast cell."Yeast"as used herein includes ascosporogenous yeast (Endomycetales), basidiosporogenous yeast, and yeast belonging to the Fungi Imperfecti (Blastomycetes). The ascosporogenous yeasts are divided into the families Spermophthoraceae and Saccharomycetaceae. The latter is comprised of four subfamilies, Schizosaccharomycoideae (e. g. , genus Schizosaccharomyces), Nadsonioideae, Lipomycoideae, and Saccharomycoideae (e. g., genera Pichia, Kluyveromyces and Saccharomyces). The basidiosporogenous yeasts include the genera Leucosporidim, Rhodosporidium, Sporidiobolus, Filobasidium, and Filobasidiella. Yeast belonging to the Fungi Imperfecti are divided into two families, Sporobolomycetaceae (e. g. , genera Sorobolomyces and Bullera) and Cryptococcaceae<BR> (e. g. , genus Candida). Since the classification of yeast may change in the future, for the

purposes of this invention, yeast shall be defined as described in Biology and Activities of <BR> <BR> Yeast (Skinner, F. A. , Passmore, S. M. , and Davenport, R. R. , eds, Soc. App. Bacteriol.

Symposium Series No. 9,1980. The biology of yeast and manipulation of yeast genetics are <BR> <BR> well known in the art (see, e. g., Biochemistry and Genetics of Yeast, Bacil, M. , Horecker,<BR> B. J. , and Stopani, A. O. M. , editors, 2nd edition, 1987; The Yeasts, Rose, A. H. , and Harrison,<BR> J. S. , editors, 2nd edition, 1987; and The Molecular Biology of the Yeast Saccharomyces, Strathern et al., editors, 1981).

The yeast host cell may be selected from a cell of a species of Candida, Kluyveromyces, Saccharomyces, Schizosaccharomyces, Candida, Pichia, Hansehula,, or Yarrowia. In a preferred embodiment, the yeast host cell is a Saccharomyces carlsbergensis, Saccharomyces cerevisiae, Saccharomyces diastaticus, Saccharomyces douglasii, Saccharomyces kluyveri, Saccharomyces norbensis or Saccharomyces oviformis cell. Other useful yeast host cells are a Kluyveromyces lactis Kluyveromyces fragilis Hansehula polymorpha, Pichia pastors Yarrowia lipolytica, Schizosaccharomyces pombe, Ustilgo maylis, Candida maltose, Pichia guillermondii and Pichia methanolio cell (cf. Gleeson et al., J. Gen. Microbiol. 132,1986, pp. 3459-3465; US 4,882, 279 and US 4, 879, 231).

In a preferred embodiment, the fungal host cell is a filamentous fungal cell.

"Filamentous fungi"include all filamentous forms of the subdivision Eumycota and Oomycota (as defined by Hawksworth et al., 1995, supra). The filamentous fungi are characterized by a vegetative mycelium composed of chitin, cellulose, glucan, chitosan, mannan, and other complex polysaccharides. Vegetative growth is by hyphal elongation and carbon catabolism is obligately aerobic. In contrast, vegetative growth by yeasts such as Saccharomyces cerevisiae is by budding of a unicellular thallus and carbon catabolism may be fermentative.

In a more preferred embodiment, the filamentous fungal host cell is a cell of a species of, but not limited to, Acremonium, Aspergillus, Fusarium, Humicola, Mucor, Myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium, and Trichoderma or a teleomorph or synonym thereof. In an even more preferred embodiment, the filamentous fungal host cell is an Aspergillus cell. In another even more preferred embodiment, the filamentous fungal host cell is an Acremonium cell. In another even more preferred embodiment, the filamentous fungal host cell is a Fusarium cell. In another even more preferred embodiment, the filamentous fungal host cell is a Humicola cell. In another even more preferred embodiment, the filamentous fungal host cell is a Mucor cell. In another even more preferred embodiment, the filamentous fungal host cell is a Myceliophthora cell. In another even more preferred embodiment, the filamentous fungal host cell is a Neurospora cell. In another even more preferred embodiment, the filamentous fungal host cell is a Penicillium cell. In another even more preferred embodiment, the filamentous fungal host cell is a Thielavia cell. In another

even more preferred embodiment, the filamentous fungal host cell is a Tolypocladium cell. In another even more preferred embodiment, the filamentous fungal host cell is a Trichoderma cell. In a most preferred embodiment, the filamentous fungal host cell is an Aspergillus awamori, Aspergillus foetidus, Aspergillus japonicus, Aspergillus niger, Aspergillus nidulans or Aspergillus oryzae cell. In another most preferred embodiment, the filamentous fungal host cell is a Fusarium cell of the section Discolor (also known as the section Fusarium). For example, the filamentous fungal parent cell may be a Fusarium bactridioides, Fusarium cereals, Fusarium crookwellense, Fusarium culmorum, Fusarium graminearum, Fusarium graminum, Fusarium heterosporum, Fusarium negundi, Fusarium reticulatum, Fusarium roseum, Fusarium sambucinum, Fusarium sarcochroum, Fusarium sulphureum, or Fusarium trichothecioides cell. In another prefered embodiment, the filamentous fungal parent cell is a Fusarium strain of the section Elegans, e. g., Fusarium oxysporum. In another most preferred embodiment, the filamentous fungal host cell is a Humicola insolens or Humicola lanuginosa cell. In another most preferred embodiment, the filamentous fungal host cell is a Mucor miehei cell. In another most preferred embodiment, the filamentous fungal host cell is a Myceliophthora thermophilum cell. In another most preferred embodiment, the filamentous fungal host cell is a Neurospora crassa cell. In another most preferred embodiment, the filamentous fungal host cell is a Penicillium purpurogenum cell. In another most preferred embodiment, the filamentous fungal host cell is a Thielavia terrestris cell or a Acremonium chrysogenum cell. In another most preferred embodiment, the Trichoderma cell is a Trichoderma harzianum, Trichoderma koningii, Trichoderma longibrachiatum, Trichoderma reesei or Trichoderma viride cell. <BR> <P>The use of Aspergillus spp. for the expression of proteins is described in, e. g. , EP 272 277, and EP 230 023.

Transformation The introduction of a vector into a bacterial host cell may, for instance, be effected by protoplast transformation (see, e. g. , Chang and Cohen, 1979, Molecular General<BR> Genetics 168: 111-115), using competent cells (see, e. g. , Young and Spizizin, 1961, Journal of Bacteriology 81: 823-829, or Dubnau and Davidoff-Abelson, 1971, Journal of Molecular Biology 56 : 209-221), electroporation (see, e. g. , Shigekawa and Dower, 1988, Biotechniques 6: 742-751), or conjugation (see, e. g., Koehler and Thorne, 1987, Journal of Bacteriology 169: 5771-5278).

Fungal cells may be transformed by a process involving protoplast formation, transformation of the protoplasts, and regeneration of the cell wall in a manner known per se.

Suitable procedures for transformation of Aspergillus host cells are described in EP 238 023

and Yelton et a/., 1984, Proceedings of the National Academy of Sciences USA 81: 1470- 1474. A suitable method of transforming Fusarium species is described by Malardier et al., 1989, Gene 78: 147-156 or in copending US Serial No. 08/269,449. Examples of other fungal cells are cells of filamentous fungi, e. g. Aspergillus spp. , Neurospora spp. , Fusarium spp. or<BR> Trichoderma spp. , in particular strains of A. oryzae, A. nidulans or A. niger. The use of<BR> Aspergillus spp. for the expression of proteins is described in, e. g. , EP 272 277, EP 230 023, EP 184... The transformation of F. oxysporum may, for instance, be carried out as described by Malardier et al., 1989, Gene 78 : 147-156.

Yeast may be transformed using the procedures described by Becker and Guarente, In Abelson, J. N. and Simon, M. I., editors, Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153: 163; and Hinnen et al., 1978, Proceedings of the National Academy of Sciences USA 75: 1920. Mammalian cells may be transformed by direct uptake using the calcium phosphate precipitation method of Graham and Van der Eb (1978, Virology 52 : 546).

Transformation of insect cells and production of heterologous polypeptides therein may be performed as described in US 4,745, 051; US 4,775, 624; US 4,879, 236; US 5,155, 037; US 5, 162, 222; EP 397,485) all of which are incorporated herein by reference. The insect cell line used as the host may suitably be a Lepidoptera cell line, such as Spodoptera frugiperda cells or Trichoplusia ni cells (cf. US 5,077, 214). Culture conditions may suitably be as described in, for instance, WO 89/01029 or WO 89/01028, or any of the aforementioned references.

Methods of Production The transformed or transfected host cells described above are cultured in a suitable nutrient medium under conditions permitting the expression of the desired polypeptide, after which the resulting polypeptide is recovered from the cells, or the culture broth.

The medium used to culture the cells may be any conventional medium suitable for growing the host cells, such as minimal or complex media containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e. g. in catalogues of the American Type Culture Collection).

The media are prepared using procedures known in the art (see, e. g. , references for bacteria and yeast; Bennett, J. W. and LaSure, L., editors, More Gene Manipulations in Fungi, Academic Press, CA, 1991).

If the polypeptide is secreted into the nutrient medium, the polypeptide can be recovered directly from the medium. If the polypeptide is not secreted, it is recovered from

cell lysats. The polypeptide are recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e. g. ammonium sulphate, purification by a variety of chromatographic procedures, e. g. ion exchange chromatography, gelfiltration chromatography, affinity chromatography, or the like, dependent on the type of polypeptide in question.

The polypeptides may be detected using methods known in the art that are specific for the polypeptides. These detection methods may include use of specific antibodies, formation of an enzyme product, or disappearance of an enzyme substrate. For example, an enzyme assay may be used to determine the activity of the polypeptide. Procedures for determining enzyme activity are known in the art.

The polypeptides of the present invention may be purified by a variety of procedures known in the art including, but not limited to, chromatography (e. g. , ion exchange, affinity, hydrophobic, chromatofocusing, and size exclusion), electrophoretic procedures (e. g., preparative isoelectric focusing (IEF), differential solubility (e. g. , ammonium sulfate<BR> precipitation), or extraction (see, e. g., Protein Purification, J. -C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Detailed description of the invention In one aspect the present invention relates to a method for generating polypeptide variants in vitro from a parent polynucleotide encoding a polypeptide of interest, the method comprising the steps of : a) providing a reaction mixture capable of in vitro transcription and translation of a template polynucleotide under suitable conditions, b) providing a polynucleotide construct comprising: i) a part which has promoter activity in the mixture of (a), ii) a part downstream of (i) which is a modified parent polynucleotide, wherein a sequence encoding one or more stop codon (s) has been introduced in at least one pre-defined codon position (s) in the encoding part of the parent polynucleotide without causing any frameshift mutations, and iii) a part downstream of (ii) which has transcription terminating activity in the mixture of (a); c) providing for each different stop codon pools of suppressor tRNA that suppresses the stop codon (s) of (ii), wherein the suppressor tRNA of each pool is charged with a different amino acid;

d) mixing in separate reaction vessels, in no particular order: the reaction mixture of (a), the polynucleotide construct of (b), and for each different stop codon suppressor tRNA from each pool of (c); and e) carrying out the in vitro transcription and translation reaction (s) under the conditions of (a), wherein polypeptide variants are generated.

In order for polypeptides to be functional, they need to be correctly folded, a process which in some instances happens on its own accord, however in other instances the polypeptide needs to be associated with a single or double lipid layer or membrane which is thought to mimic the membrane of a living cell. Such a mimicry lipid membrane may be provided in several ways as is known in the art, non-limiting examples are lipid vesicles or microsomes. Other polypeptides need to be post-translationally modified before they become active, they may need the aid of chaperone proteins to be folded correctly, they may need to be isomerized by the action of an isomerase enzyme such as disulfide-isomerase, and/or they may need to be maturated by the cleavage of a leader peptide from the mature peptide by the action of a leader peptidase enzyme. Microsomal vesicles can be used to study co- translational and initial post-translational processing of proteins or library of protein variants.

In addition processing or translocation events such as protein maturation, protein folding, signal peptide cleavage, membrane insertion, translocation and core glycosylation can be examined by the translation of the appropriate mRNA or library of mRNA in vitro in the presence of microsomal vesicles. Control mRNAs can be the precursor for ß-lactamase from E. coli or the precursor for a-mating factor from S. cerevisiae. Translation products may be further analyzed for cotranslational processing and core glycosylation by the addition of microsomal vesicles to a standard in vitro transcription/translation reaction. Processing events are generally detected as shifts in the apparent molecular weight of translation products.

Polypeptides may be so fragile and susceptible to proteolysis that even the slightest residual protease activity would be detrimental, in which case the inventors envision the addition of one or more protease inhibitor (s) in the method of the invention.

Accordingly, a preferred embodiment of the invention relates to a method of the first aspect, wherein the reaction mixture of step a) comprises one or more lipid vesicle (s), one or more microsome (s), and/or one or more biological membrane (s); or wherein in step d) or step e) there is also added to each reaction vessel : one or more lipid vesicle (s), one or more microsome (s), and/or one or more biological membrane (s). These components may be added to the reaction mixture prior to the mixing, or simultaneously with the mixing, or even

subsequently to the mixing in step d) of method of the invention. In short, it is preferred, that the reaction mixture of step a) is capable of in vitro polypeptide maturation.

In another preferred embodiment the invention relates to a method of the first aspect, wherein the reaction mixture of step a) comprises one or more chaperone (s), one or more isomerase (s) preferably disulfide isomerase (s), one or more protease inhibitor (s), and/or one or more leader peptidase (s); or wherein in step d) or step e) there is also added to each reaction vessel : one or more chaperone (s), one or more isomerase (s) preferably disulfide isomerase (s), one or more protease inhibitor (s), and/or one or more leader peptidase (s).

Other well-known means of achieving proper folding of a polypeptide include a denaturation of the polypeptide followed by a spontaneous renaturation, such as may be performed by first denaturing a polypeptide in a urea solution, and then renaturing by dialysis, whereby the urea is removed and the polypeptide re-folds.

In yet another preferred embodiment the invention relates to a method of the first aspect, wherein additional steps are performed subsequent to step e), the additional steps comprising polypeptide denaturation and renaturation, preferably the denaturation is achieved by addition of urea and the renaturation is achieved by dialysis.

As mentioned above, the method of the first aspect is very useful for generating variant libraries of industrially relevant polypeptides, one such group of polypeptides are enzymes. Accordingly a preferred embodiment of the first aspect of the invention relates to a method, wherein the polypeptide of interest is an enzyme; preferably the enzyme is an amylolytic enzyme, a lipolytic enzyme, a proteolytic enzyme, a cellulytic enzyme, an oxidoreductase or a plant cell-wall degrading enzyme, and most preferably the enzyme is selected from the group of enzymes consisting of aminopeptidase, amylase, amyloglucosidase, carbohydrase, carboxypeptidase, catalase, cellulase, chitinase, cutinase, cyclodextrin glycosyltransferase, deoxyribonuclease, esterase, galactosidase, beta- galactosidase, glucoamylase, glucose oxidase, glucosidase, haloperoxidase, hemicellulase, invertase, isomerase, laccase, ligase, lipase, lyase, mannosidase, oxidase, pectinase, peroxidase, phytase, phenoloxidase, polyphenoloxidase, protease, ribonuclease, transferase, transglutaminase, and xylanase.

Another highly relevant area of industrially relevant polypeptides, or just peptides, are those having antimicrobial properties, either growth-inhibiting effects or actual killing effects on undesirably microbial cells. The distinction between a polypeptide and a peptide is fluid and both terms are used throughout the art with large overlaps. Generally speaking polypeptides tend to comprise more amino acid residues than peptides, however, rigorously <BR> <BR> speaking"poly"simply means"more (than one) ", so in effect a small peptide of only 5-8

amino acids may also be termed a polypeptide. Most antimicrobial polypeptides are from 5- 100 amino acids, and are very often referrred to as"antimicrobial peptides"or"AMP's".

A preferred embodiment of the invention relates to a method of the first aspect, wherein the polypeptide of interest is a peptide having antimicrobial properties; preferably the antimicrobial peptide is of a type of antimicrobial peptide selected from the group of antimicrobial peptide types consisting of: Defensin, Magainin, Guamerin, Buforin, Apidaecin, Bombinin, Cecropin, Drosocin, Indolicidin, Melittin, Tachyplesin, HNP-I, Cecropin, Cecropia A/melittin hybrids CEME/CEMA, and Spirin.

Some industrial products from microorganisms are not polypeptides, but may be the resulting product of an entire biosynthetic, metabolic or anabolic pathway, or a side-or by- product from such a pathway e. g. amino acids, complex organic acids, steroids, antibiotics or other metabolites. It is of interest to alter the properties of polypeptides that are active in such a pathway, for instance where enzymes of a particular pathway are to be expressed recombinantly to produce a primary or secondary metabolite, or a complex organic molecule.

Accordingly a preferred embodiment relates to a method of the first aspect, wherein the polypeptide of interest is a biosynthetic polypeptide of a metabolic or anabolic intracellular pathway of a cell ; preferably the polypeptide of interest is of a hyaluronic acid biosynthetic pathway.

Another area of industrially relevant polypeptides are those with pharmaceutical properties, such as insulin and insulin derivatives and precursors, peptide hormones, blood clotting factors etc.

A preferred embodiment relates to a method of the first aspect, wherein the polypeptide of interest has pharmaceutical properties; preferably the polypeptide is an insulin or an insulin-derivative, has hormonal properties, or is a blood clotting factor or a derivative thereof.

The term"reaction mixture capable of in vitro transcription and translation"or"in vitro transription/translation system"or"in vitro transription/translation reaction mixture"or simply"reaction mixture"are synonymously used herein, and refer to a complex mixture of required components for carrying out transcription and translation in vitro, as recognized in the art. Such a reaction mixture may be a cell lysate such as an E. coli S30 extract, preferably from an E coli cell lacking one or more release factors, preferably Release Factor I (RF-I) (Short, Biochemistry 1999,38, pp: 8808-8819), or from a cell lacking a specific tRNA where the corresponding codon is to be used in the method of this invention as a stop codon.

The reaction mixture may additionally comprise inhibitory components or constituents, that reduce the formation of unwanted by-products. Further the reaction mixture may comprise specific enzymes that actively remove one or more unwanted by-products. Other such

reaction mixtures may be artificially reconstituted from single components that may be purified from natural or recombinant sources. A number of kits for in vitro translation and transcription/translation, comprising the reaction mixture of this invention, are commercially available, e. g. several S30 extract systems from Promega Inc.

A preferred embodiment of the invention relates to a method of the first aspect, wherein the reaction mixture is an S30 extract, preferably from an Escherichia coli, and more preferably an S30 extract from an E. coli having a deficient or thermo-sensitive Release Factor 1 (RF1) ; additionally the reaction mixture may comprise inhibitory components or constituents, that reduce the formation of unwanted by-products; further the reaction mixture may comprise specific enzymes that actively remove one or more unwanted by-products.

Any kind of polynucleotide constructs are contemplated by the present invention, as is described elsewhere herein, however a preferred embodiment of the invention relates to a method of the first aspect, wherein the polynucleotide construct is linear or circular ; preferably the polynucleotide construct further comprises an origin of replication or is capable of autonomous maintenance in a host cell.

A"stop codon"is usually"TAA", TAG"or"TGA", these are transcribed into UAA, UAG, or UGA in the messenger-RNA. A stop codon will in most normal cells not be recognized by a corresponding tRNA, and a release factor within that cell will terminate translation of that particular mRNA, as is well known in the art. However, in suppressor cells certain suppressor tRNA molecules will recognize a stop codon and will cause the translation of the mRNA to proceed by read-through, thus incorporating the amino acid of the suppressor tRNA into the elongating polypeptide, rather than terminating translation.

Any codon may function as a stop codon in the method of the invention. If a cell is lacking a tRNA corresponding to a specific codon, then that codon will in effect be a stop codon within that cell or in an in vitro transription/translation reaction mixture extracted from that cell. For the purposes of the present invention, any codon may be a stop codon, if the correspondingly charged tRNA is not present in the basic in vitro transcription/translation reaction mixture. The corresponding tRNA may be added to the reaction mixture where it then in fact becomes a suppressor tRNA.

A preferred embodiment of the invention relates to a method of the first aspect, wherein the one or more stop codon (s) is UAG, UGA, and/or UAA, preferably the one or more stop codon (s) is UAG. Another preferred embodiment of then invention relates to a method of the first aspect, wherein the one or more stop codon (s) is UAG or UGA, preferably the one or more stop codon (s) is UAG.

The term"pre-defined codon position (s)" as used herein refers to the amino acid position (s) in the polypeptide of interest where it is desired to create amino acid variations,

but more specifically to the corresponding codon position (s) of the encoding parent polynucleotide. The method of the invention introduces one or more stop codon (s) in the corresponding and now pre-defined codon position (s) of the parent polynucleotide encoding the polypeptide of interest, without causing any frameshift mutations i. e. the reading frame of the encoding polynucleotide is maintained after introduction of the stop codon (s).

Yet a preferred embodiment of the invention relates to a method of the first aspect, wherein different stop codons are introduced in different pre-defined codon positions in the encoding part of the parent polynucleotide without causing frameshift mutations; preferably the different stop codons are UAG and UGA; even more preferably the different stop codons are UAG, UGA, and UAA.

The term"suppressor tRNA"as used herein refers to a transfer-RNA (tRNA) charged with an amino acid, natural or non-natural, where the tRNA corresponds to a mRNA. codon (nucleotide triplet) for which there is no corresponding tRNA in the reaction mixture.

The tRNA may be chemically charged with the amino acid, as described in the art (e. g. Short et al., Biochemistry 1999,38, pp: 8808-8819).

Although the method of the invention allows the generation of all 19 natural amino acid variations in one amino acid position (excluding the one amino acid present in the parent), this is by no means a limitation. The inventors contemplate that many pools of suppressor tRNA may be provided up to and above the 19 pools of tRNA charged with the natural amino acids not present in the parent polypeptide, for instance pools of tRNA charged with different non-natural, or chemically modified amino acids may also be provided.

However, a preferred embodiment of the invention relates to a method of the first aspect, where for any given stop codon introduced in the modified parent polynucleotide up to 19 pools of suppressor tRNA are provided, each pool comprising suppressor tRNA charged with different amino acids that are all different from the amino acid naturally encoded by the pre-defined codon position of the parent polynucleotide. When a tRNA is charged with an amino acid different from the amino acid it is charged with in nature, the tRNA is said to be misacylated. Misacylation can be achieved by chemically charging the tRNA, and it this is referred to as chemical misacylation, and may be done using natural and/or non-natural amino acids.

Still another preferred embodiment of the invention relates to a method of the first aspect, wherein the suppressor tRNA (s) is chemically misacylated.

One of the benefits of the present invention is that with just one encoding polynucleotide and standard reaction mixtures, many reactions can be carried out simultaneously.

Accordingly, a preferred embodiment of the invention relates to a method of the first aspect, wherein the in vitro transcription and translation reactions are carried out simultaneously for two or more reaction vessels.

No particular reaction vessel is required in the method of the invention, however some are more commonplace than others, in particular are PCR tubes, PCR strips, and microtiter plates ubiquitous in molecular biology labs worldwide, and most machinery fits these types of reaction vessels. So, a preferred embodiment of the invention relates to a method of the first aspect, wherein the reaction vessels are physically joined, preferably the vessels are wells in a microtiter plate.

It is envisioned to introduce two, three, four or more"stop codons"in pre-defined codon positions in the encoding parent polynucleotide, provided a reaction mixture is used in the method, wherein none of the corresponding tRNA's are comprised. Pools of the corresponding tRNAs charged with the amino acids that are of interest in the pre-defined codon positions are then provided and the in vitro transcription/translation is carried out using these, resulting in a combinatorial variant library of polypeptides.

Accordingly, a preferred embodiment of the invention relates to a method of the first aspect, wherein two or more different stop codons are introduced in different pre-defined codon positions, and wherein for each stop codon pools of suppressor tRNA charged with at least two different amino acids are provided and used in the in vitro transcription and translation reactions, whereby at least four polypeptide variants are generated. Another preferred embodiment of the invention relates to a method of the first aspect, wherein two or more different stop codons are introduced in different pre-defined codon positions, and wherein for each stop codon at least two pools of suppressor tRNA charged with different amino acids are provided and used in the in vitro transcription and translation reactions, whereby at least four polypeptide variants are generated.

Once the variant library of polypeptides has been generated by the method of the invention, the next logical step is to select a variant with an altered property of choice from the library, a product candidate, or a candidate for further experiments.

So, a preferred embodiment of the invention relates to a method of the first aspect, wherein an additional step is performed of selecting a polypeptide variant having altered properties when compared with the polypeptide encoded by the parent polynucleotide under identical conditions, and optionally identifying the amino acid (s) inserted in the polypeptide variant in the position encoded by the pre-defined codon position (s); preferably additional steps are performed of constructing a polynucleotide encoding the selected polypeptide variant, and expressing this polynucleotide in a host cell to produce the variant polypeptide in commercially relevant amounts.

A second aspect of the invention relates to a kit for generating polypeptide variants in vitro from a parent polynucleotide encoding a polypeptide of interest, the kit comprising: a) a reaction mixture capable of in vitro transcription and translation of a template polynucleotide under suitable conditions, b) at least two pools of suppressor tRNA charged with different amino acids.

A third aspect relates to a polypeptide variant of interest, obtained by a method as defined above.

A fourth aspect relates to a polynucleotide encoding a polypeptide variant of interest as defined in the previous aspect, wherein the polynucleotide was constructed on the basis of sequence information obtained by a method as defined above.

A fifth aspect relates to a process for producing a polypeptide of interest comprising cultivating a host cell that produces a polypeptide of interest as defined in claim 23, or expresses a polynucleotide as defined above, and subsequently isolating the polypeptide of interest.

A final aspect relates to the use of a method as defined above to produce variants of a polypeptide of interest.

A few non-limiting illustrations of the invention are given below as examples.

Examples Experimental Outline 1. Construction and purification of suppressor tRNA 2. Design of a circular expression unit used for transcription/translation 3. Design of a linear expression unit used for transcription/translation 4. Construction of in vitro suppressor transcription/translation mix 5. In vitro transcription/translation 6. Screening and selecting a polypeptide variant Materials Standard reagents and buffers that are free from contaminating activities are used.

Special care should be exercised to avoid ribonuclease contamination throughout the experiment. Wherever relevant and possible, dose-response experiments are carried out to optimize experimental conditions. The in vitro translation reactions can use RNA added directly to the reaction mixture, or the RNA can be generated in a linked or coupled transcription/translation system. When RNA is provided directly it may be total RNA, mRNA

or synthesized template RNA. In linked or coupled translation the reaction is initiated by addition of circular or linear DNA template from which RNA is transcribed and the polypeptide subsequently translated without intermediate purification. Standard reaction mixtures for in vitro translation, such as the E. coli S30 extract, contain all macromolecular components (70S or 80S ribosomes, tRNAs, amino acyl-tRNA synthetases, initiation, elongation and termination factors etc. ) required for cell free protein synthesis of exogenous RNA. To ensure efficient translation, each extract must typically be supplemented with amino acids, energy sources (ATP, GTP), energy regenerating systems (creatine phosphate and creatine phosphokinase for eukaryotic systems, and phosphoenol pyruvate and pyruvate kinase for the E. coli lysate), and other co-factors (Mg+, tO, etc).

1. Construction and purification of suppressor tRNA Nonsense suppressor tRNAs are alleles of tRNA genes that have an altered tRNA capable of inserting a specific amino acid when the translating ribosome encounters a chain- terminating codon (eg. UAA, UGA, UAG). Thus chain termination is bypassed and a specific amino acid inserted in the polypeptide chain being translated. Several amber tRNA suppressor molecules have been isolated allowing the insertion of any one of at least 12 different amino acids at an amber (UAG) stop codon. When such suppressor tRNA's molecules were used in concert with genes, wherein the corresponding nonsense codon (UAG, UAA, UGA) was inserted by genetic engineering at desired positions, all 20 naturally occurring amino acids plus selected non-natural amino acids could be inserted at that position by the use of suppressor tRNA's chemically charged with the desired amino acids, both natural and non-natural, as described in Ibba, M. (1995) Biotechnol. and Genetic Engineering Reviews. (13): 204-210, and Roesser, J. R. et al. (1989) Biochem. 28 : 5185- 5195. The design and construction of suppressor tRNA's was achieved using structural based knowledge, recombinant DNA technology, directed molecular evolution and rationales such as those described in Kleina et a/., (1990), J. Mol. Biol 213: 705-717. The present inventors envision suppressor-tRNA optimization schemes, where the RNA part of the suppressor-tRNA's of the invention is altered e. g. by molecular evolution, or by one or more mutation (s). Once constructed the tRNAs were purified as described by Shimizu et al., (2001) Nature Biotechnol. 19: 751-755.

2. Design of a circular expression unit used for transcription/translation An expression unit is carefully designed such that the 5'untranslated region contains an RNA polymerase initiation site, a ribosome binding site, a translational initiation codon,

selected 5'untranslated sequences, and translation control elements specific for the chosen prokaryotic or eukaryotic system. The polymerase binding site used in this example is the T7 promoter sequence: (SEQ ID NO : 1)"taatacgactcactataggggaa"which is placed in the 5' region of the expression unit. Other promoters can be used, examples are promoters from bacteriophage SP6 or T3 or endogenous E. coli promoters (e. g. tac, lac). The Shine Dalgarno ribosome binding site"gaaggag"is placed after the promoter and is followed by an initiation codon, i. e. "atg", which overlaps an appropriate restriction endonuclease site for correct position of the start codon of the gene.

The gene encoding the haloperoxidase from C. verruculosa (rCvP) is cloned into a relevant expression vector (e. g. pRSET, InVitrogen)). This places the gene after the T7 promoter sequence followed by a Shine-Dalgarno ribosome binding site. A non-sense"tag"stop codon (amber codon) is inserted into the plasmid at position P173 of the CDS. This mutation is constructed by SOE PCR using plasmid pSteD-rCVHap (Ref. ) as template and the following oligonucleotides : (SEQ ID NO : 2): 5'taactcatatgatggggtccgttacaccaattc (SEQ ID NO : 3): 5'gcactcctcaacgattagcgaggtgcttcacaggag (SEQ ID NO : 4): 5'ctaatcgttgaggagtgcaaagaag (SEQ ID NO : 5): 5'aagtaqgatcctcattacggcgcctccttaaccaacggwac In SEQ ID NO : 2 a Ndel site overlapping the rCvHAP initiation codon is underlined. In SEQ ID NO : 3 and SEQ ID NO : 4 the amber-codon is underlined. In SEQ ID NO : 5 the BamHl restriction site succeeding the"taa"stop codon is underlined.

PCR reactions are performed using standard conditions and the following reactions: A: template pSteD01 and primers (SEQ ID NO : 2) and (SEQ ID NO : 3); this yields a PCR fragment of 530 basepairs.

B: template pSteD01 and primers (SEQ ID NO : 4) and (SEQ ID NO : 5); this yields a PCR fragment of 1316 basepairs.

PCR fragments A and B are combined in a third SOE-PCR reaction without primers; this generates a PCR fragment of 1828 basepairs containing the introduced amber codon at codon position 173, and Ndel and BamHl sites at the PCR fragment ends for cloning into pRSET-B. The 1828 basepair fragment is then restriction digested with Ndel/BamHl gelpurified and ligated into NdellBamHl digested and gelpurified pRSET-B vector to create pCvHAPambP173.

Transformation of pCvHAPAmbP173 into E. coli is done by standard method selecting for growth on LB plates containing 100 microgram/ml of ampicillin. Restriction analysis and DNA sequencing is used to verify the integrity of pCvHAPAmbP173.

3. Design of a linear expression unit used for transcription/translation A PCR reaction is performed using plasmid pCvHAPAmbP173 as template and primers (SEQ ID NO : 6) and (SEQ ID NO : 7) placed on each side of the gene: (SEQ ID NO : 6): 5'tctccccgcgcgttggccgattcattaatgc (SEQ ID NO : 7): 5'agcagccggatcaagcttcg This yields a PCR product of 2000 basepairs encompassing the T7 promoter, RBS and the amber containing the HAP CDS. The PCR product is purified or used directly in the transcription/translation reaction.

4. Construction of in vitro suppressor transcription/translation mix E coli S30 in vitro transcription/translation mix was prepared essentially as described by Kim et al, 1996, Eur J. Biochem. 239: 881-886. A total of 12 different S30 mixes, each containing a specific tRNA suppressor, were generated from exponentially growing cultures of 12 commercially available amber suppressing strains (InterchangeTM amber Supressor in vivo Mutagenesis System, Promega, WI). These S30 mixes incorporates the following amino acids when encountering the amber codon inserted at the codon encoding P173 in the haloperoxidase CDS: cys, glu, phe, his, lys, arg, ser, tyr, gin, leu, pro (wt), gly. In the transcription/translation reactions reaction the DNA template (the amber containing expression unit) was supplied either as 100-1000 ng of circular pCvHAPAmbP173 or as 100- 1000ng of PCR fragment synthesized as described above. Conditions for transcription/translation reactions were essentially as recommended by the literature; typically 0,5 microliter DNA template is transcribed in a 10 microliter volume at 30°C for 60 min. Then a small portion of the transcription reaction (1-3 microliter) is used in the subsequent translation reaction. Typically a single transcription/translation reaction will yield between 0,4-4 microgram synthetized polypeptide per ml reaction.

5. In vitro transcription/translation using commercial S30 extract and purified suppressor-tRNA chemically charged with the desired amino acids The S30 extract used was from a commercially supplier (PROTEINscriptT"PRO ; Ambon). In the reaction the DNA template (the amber containing expression unit) was supplied either as

100-1000 ng of circular pCvHAPAmbP173 or as 100-1000ng of PCR fragment synthesized as described above. Transcription/translation reaction conditions were essentially as recommended by the supplier except that the optimal concentration of added charged suppressor tRNA in each case was determined in a dose-response experiment. Purified suppressor tRNA was first chemically charged with each of 20 different amino acids. These charged supressor tRNA molecules thereby incorporates the desired amino acids when encountering the amber codon inserted at pos. P173 in the haloperoxidase CDS. In the transcription/translation reactions reaction the DNA template (the amber containing expression unit) was supplied either as 100-1000 ng of circular pCvHAPAmbP173 or as 100- 1000ng of PCR fragment synthesized as described. Conditions for transcription/translation reactions were essentially as recommended by the literature ; typically 0,5 microliter DNA template is transcribed in a 10 microliter volume at 30°C for 60 min. Then a small portion of the transcription reaction (1-3 microliter) is used in the subsequent translation reaction. A single transcription/translation reaction yielded between 0,04-4 microgram synthesized polypeptide per ml reaction.

6. Screening and selecting a polypeptide variant Typically all the in vitro transcription/translation reactions are performed at once in a microtiter plate, thus if one stop codon is inserted into only one predefined codon position, this procedure provides all 20 amino acid variants at once. In order to select a variant of interest, an assay is set up based on the property (ies) it is sought to alter, a non-limiting and non-exhaustive list of such properties could include pH-stability, pH activity profile, oxidation stability, redox profile, thermo-stability, thermo-activity profile, substrate specificity, specific activity, halo-stability, activity/stability/specificity in detergents, antimicrobial activity, allergenicity etc. , and all of these in various combinations.

Once a preferred variant has been selected, it will immediately be apparent which amino acid was incorporated into the position encoded by the stop codon, as the suppressor tRNA of each reaction is charged with only one amino acid. To synthesize a polynucleotide encoding the selected variant, for use in larger scale production, is then only a matter of trivial operations to the skilled person, e. g. site-directed mutagenesis may be used, or a completely new synthetic polynucleotide may be constructed and even codon-optimized to the preferred codon-usage of the intended production host cell.