Method for producing cell wall-targeting antibiotics in susceptible bacteria

FIELD OF THE INVENTION

The present invention is in the field of a method for producing engineered microorganisms, a method for producing cell wall-targeting antibiotics using said engineered

microorganisms, and a product obtainable by said methods. The microorganisms are engineered in that various gene sequences are provided in the microorganisms to support amongst others antibiotic production.

BACKGROUND OF THE INVENTION

The present invention is in the field of production of antibiotics by microorganisms, specifically bacteria.

An antibiotic relates to an agent that either kills or

inhibits the growth of a microorganism. At present most modern antibacterials are naturally occurring compounds, or

semisynthetic modifications thereof. Some compounds are still isolated from living organisms, such as aminoglycosides, whereas many others are produced by chemical synthesis.

Following screening of antibacterials against a wide range of bacteria, production of the active compounds or of their precursors is often carried out in strongly aerobic

conditions .

Antibacterial compounds may be classified on the basis of their origin into natural, semisynthetic, and synthetic.

Another classification system is based on biological activity; in this classification, antibacterials are divided into two broad groups according to their biological effect on

microorganisms: Bactericidal agents kill bacteria, and

bacteriostatic agents slow down or stall bacterial growth.

Antibiotics have many medical uses, such as treatment of a bacterial infection, of a protozoan infection,

immunomodulation, and non-operative resource for patients who have non-co plicated acute appendicitis. Also prevention of infection may be considered, such as of a surgical wound, and dental antibiotic prophylaxis.

The use of antibiotics to treat and cure infectious disease has removed one of the major causes of death to the human population. Recently, the antibiotic arsenal is losing its effectiveness, as resistant bacteria are beginning to spread, making infections that only a decade ago would be considered trivial often fatal. Furthermore, healthcare costs are rising worldwide. Any technology that might alleviate the upward pressure on healthcare costs would save lives.

Antibacterial antibiotics may also be classified based on their mechanism of action, chemical structure, or spectrum of activity; typically they target a bacterial function or growth process, such as a bacterial cell wall, and a cell membrane, and interference with essential bacterial enzymes.

Bactericidal aminoglycosides may target protein synthesis (macrolides, lincosamides and tetracycline) but are typically not bacteriostatic. Further detailed categorization may be done .

In general a problem with present antibiotics is that microorganisms become resistant. In view thereof, and also in view of other treatments, novel antibiotics may need to be developed. While novel antibiotics have been discovered, the microbial producers are often species that are either

difficult or impossible to culture in large-scale

fermentations. This presents a severe hindrance to producing the antibiotics on an industrial scale, which is needed if the antibiotics are to find medical applications. Hence,

alternative production methods may be required to develop and produce antibiotics at an increased speed and frequency.

Various chemical classes of antibiotics exist, such as the b-lactam class. Members of this b-lactam class are

carbapenems, penicillins and cephalosporins. An example of a carbapenem is thienamycin, a naturally derived product of Streptomyces cattleya.

In general, production of antibiotics and precursors thereof by microorganisms normally not producing the

antibiotic is inherently cumbersome, as increased levels of antibiotics inside the microorganism kill the microorganism.

So despite successes in identifying metabolic pathways for antibiotic production, improvements have only been established towards non-toxic or slightly toxic intermediate products.

Antibiotics may be produced within engineered bacteria; however, some antibiotics cannot be made commercially by these engineered bacteria because the host is not amenable to genetic engineering or industrial cultivation processes. In an alternative natural producers can be mutated or otherwise manipulated, but alterations to natural producers may not be sufficient to achieve industrially-relevant titres or

productivity. In these instances it would be advantageous to make the antibiotic within a cultivation-friendly host such as Escherichia coli or Bacillus subtilis . However, these hosts are susceptible to antibiotics, limiting their application to antibiotic production.

Antibiotics are therefore not normally produced by

susceptible hosts because they are toxic to the hosts, and this toxicity would impede production to high titres. It is therefore a problem to make antibiotics in bacterial species that are highly susceptible to the antibiotic. This problem has not been addressed yet to the knowledge of the inventors. Typically production of such antibiotic compounds is achieved in native producers, which have natural mechanisms to resist antibiotics. Even these native hosts do not produce large amounts as they are rarely totally resistant to their own products. In principle these natural mechanisms could be replicated in engineered strains. However, there is no

guarantee these mechanisms would work in alternative

production hosts such as E. coli.

Recently advances have been made in identifying potential production routes, such as for kanamycin.

In an example, carbapenems exemplify a class of antibiotics that cannot be economically produced via microbial synthesis due to low titers. Carbapenems show powerful broad-spectrum activity and resist inactivation by b-lactamases far better than other b-lactam antibiotics, making carbapenems valuable last-resort treatments against multi-drug resistant

infections .

Some documents recite carbapenem production routes. For instance US2013/0065878 A1 recites cell-free systems for generating carbapenems.

US 5,871,922 A (or WO 95/32294 A) recites genes involved in the biosynthetic pathway of carbapenem, comprising: a) at least one of the genes carA, carB, carC, carD, carE, carF, carG, carH, b) DNA capable of hybridizing to any of the genes defined in a) and capable of functioning as such genes in the biosynthetic pathway of a carbapenem, c) DNA which is a) or b) above by virtue of the degeneracy of the genetic code.

Polypeptides encoded by such DNA.

Coulthurst et al . in "Regulation and biosynthesis of

Carbapenem antibiotics in Bacteria", Nature Reviews,

Microbiology, Vol. 3, No. 4, p. 295-306 (2005) recites some biosynthetic principles of carbapenem and carbapenem

production in bacteria, which may involve genetic engineering. On p. 296-297 it is clearly indicated that only low titres are obtainable, which is supposed to relate to < 0.1 mg/1.

McGowan et al . in "Analysis of bacterial carbapenem antibiotic production genes reveals a novel b-lacta

biosynthesis pathway", Molecular Microbiology, 22(3), p. 415- 426 (1998) recites a method for preparation of an engineered microorganism, such as E.coli, capable of carbapenam

production, such as expression of CarA and CarB.

Nunez et al. in "The Biosynthetic Gene Cluster for the b- Lactam Carbapenem Thienamycin in Streptomyces cattleya",

Chemistry & Biology, Vol. 10, p. 301-311, (2003) recites identification of genes involved in biosynthesis of

thienamycin and insertion thereof in bacterial hosts thereby producing thienamycin.

Bodner et al. in "Definition of the Common and Divergent Steps in Carbapenem b-Lactam Antibiotic Biosynthesis",

ChemBioChem, Vol. 12, p. 2159-2165 (2011), and McGowan et al. in "Bacterial production of carbapenems and clavams: evolution of b-lactam antibiotic pathways", Trends in Microbiology, Vol. 6, No. 5, p. 203-208 (1998) recite preparation of an

engineered microorganism capable of carbapenem production comprising expression of CarA and CarB in E. coli.

US 2015/0353939 Al recites preparation of an engineered microorganism capable of carbapenem production comprising expression of CarA and CarB in a host cell, wherein the sequence used originates from P. carotovora.

Some further background documents can be referred to, namely WO 2014/160025 A2, relating to a system for tunable expression of target protein in a cell, an article by G.

Bokinsky (J. Bacter. Vol. 195, No. 14, May 10, 2013, p. 3173- 3182}, relating to growth-arrested cells as platforms for production of antibiotics, WO 2010/141468 Al, US 2009/137010 Al, WO 2013/036787 A2 , an article by Cameron (Nature Biotech. Vol. 32, No. 12, December 2014, p. 1276-1281), an article by Rodionov (Microbiology, Oct. 1996, Vol. 142, No. 10, p. 2871- 2877), and NL 2014028 Bl.

The present invention therefore relates to an improved method for producing high levels of antibiotics, and

specifically cell wall-targeting antibiotics, a method for engineering microorganisms suitable for said production, and products obtained, which solve one or more of the above problems and drawbacks of the prior art, providing reliable results, without jeopardizing functionality and advantages.

SUMMARY OF THE INVENTION

The present invention relates to an improved method of production of an engineered microorganism according to claim 1, comprising providing a microorganism, wherein the

microorganism is selected from the group comprising yeasts, fungi, and bacteria, and which microorganism is susceptible to cell wall-targeting antibiotics; introducing in the

microorganism a nucleic acid sequence encoding at least one tag linked to at least one first gene sequence encoding at least one fatty acid synthesis enzyme for fatty acid synthesis (FAS) , such that the fatty acid synthesis enzyme comprises the at least one tag; and introducing in the microorganism at least one inducible second gene sequence encoding a tag- identifying protease to obtain a genetically modified

microorganism, wherein the tag is capable of providing

protease degradation of the FAS enzyme. The tag is typically covalently bonded to the at least one first gene sequence. Details of the present invention may also be found in the international patent application PCT/NL2017/050564 and in a submitted publication by Shomar et al. entitled "Metabolic engineering of a carbapenem antibiotic biosynthesis pathway in Escherichia coli", which documents and the contents thereof are incorporated by reference, as well as in the co-filed sequence listing. In principle one could start with any wild- type or modified microorganism, and continue according to the invention; these modified microorganisms are considered to fall under the scope of the microorganisms as claimed.

Therewith amongst others high titres (from a few hundred to about ten thousand LC/MS counts, or likewise 1-100 mg/1, such as 2-20 mg/1) are obtained; put different a 50-100-fold improvement in productivity is obtained. For near future titres of 1-10 gr/1 are foreseen. In an example E. coli is used as a host to engineer a synthesis pathway for carbapenem (5R) -carbapen-2-em-3-carboxylic acid (known as Car) . By additionally identifying and overexpressing a cofactor of a key enzyme, and by increasing supply of native metabolites that serve as Car precursors, a productivity enhancement of 35-60-fold was obtained. In a second aspect the present invention enables production of antibiotics that are

considered immediately toxic to a microorganism' s cell, such as penicillin and cephalosporin antibiotics. It is still difficult to produce these antibiotics on an industrial scale via a biological process, and these are therefore produced using chemical synthesis, which greatly raise its cost to medical systems worldwide. A benefit of the present methods is the development of a process for producing an expensive class of antibiotics via inexpensive microbial synthesis. The development of such processes has caused antibiotic costs to dramatically plummet e.g. for b-lactam antibiotics. A further benefit is that the ease of genetic modifications enables the antibiotic production pathway to be readily modifiable by the addition or removal of other genes, enabling the production of derivatives the present antibiotics that evade resistance mechanisms. Within the application the term "gene" also refers to homologues thereof, and derivatives thereof. The term

"derivative" Is used in its chemical meaning, being a compound that is derived from a similar compound by a chemical

reaction. The term "analogue" or "structural analogue" is used in its chemical meaning as being a compound having a structure similar to that of another one, but differing from it in respect of a certain component. The term "precursor" is used to refer to a first compound that participates in chemical reaction that produces a further compound, and the first compound therefore precedes the further compound. It is noted that this would not overcome the problem of resistance; it would however expand the repertoire of available drugs.

The present method allows production of antibiotics, such as b-lactams, while avoiding cell lysis, which would normally cease antibiotic production. In an example Escherichia coli is manipulated.

Inventors also used several new approaches for generating antibiotics while preserving the metabolism of the production host, without which, productivity is considered to be severely limited by the toxicity of the antibiotic compound. These are approaches that are found generally useful for production of antibiotics in vulnerable species.

In an example inventors have found a way to produce sufficient antibiotics, such as Car, to lyse the producing cells, thus providing a platform to test approaches to

circumvent antibiotic toxicity to cells that enable production of antibiotics to continue over time.

In the present engineering method in the microorganism at least one tag encoding sequence appended to a fatty acid synthesis encoding gene sequence is provided, such that the fatty acid synthesis (FAS) enzyme comprises the tag. The FAS enzyme is therewith recognizable. Also in the microorganism at least one inducible third gene sequence encoding a tag- identifying protease is provided; this third gene sequence, when induced, provides a protease that is capable of

identifying the tag, initiating degradation of the FAS enzyme by the protease. The protease is intended to specifically degrade a FAS enzyme with the tag, whereas other enzymes without such a tag are in principle left alone. As such, the tag is capable of providing protease degradation of the fatty acid synthesis enzyme, such as a FabD, FabB, or FabF enzyme. The tag sequence and the third gene sequence encoding the tag- identifying protease may be introduced in the microorganism by methods known in the field.

To avoid expression of wild-type FabD, FabB and/or FabF enzyme, one or more of the corresponding genes fabD, fabB and fabF may be substituted by a fabD, fabB and/or fabF gene sequence comprising a tag, such as fabD-pdt#3, fabB-pdt#3 and/or fabF-pdt#3. Such a substitution may be realized using heterologous recombination.

In a second aspect the present invention relates to a method of producing an antibiotic, comprising providing a genetically engineered microorganism such as of the invention, culturing the genetically engineered microorganism in a medium, reducing an amount of fatty acid synthesis enzyme in the microorganism, such as by triggering expression of the at least one inducible third gene sequence in the microorganism, and producing antibiotics. The present invention now enables the production of antibiotics in microorganism species that are highly susceptible to the antibiotic, and thus are not natively produced by these susceptible hosts like E. coli, because they are toxic to the hosts, and this toxicity would impede production to high titres. The present method avoids exposure to the antibiotic to some extent while the cell remains vulnerable (during growth, and expression of

antibiotic production enzymes) . The present method helps surmount this barrier, which enables in principle production of several classes of antibiotics within hosts rather than native producers. A further advantage of the present invention is that the inhibition of fatty acid synthesis by degradation of fatty acid synthesis enzyme may be the resulting elevated malonyl-CoA pool in the microorganism. Malonyl-CoA is a precursor for several antibiotics, and as such, a higher antibiotic yield may be realized. This not only leads to lower production costs for antibiotics, but more importantly, it enables rapid development of production methods for novel antibiotics. In an alternative, or additional, approach blocking FAS via microbial engineering may be achieved by targeting an mRNA, which mRNA encodes the FabD, FabB, FabF (or other enzymes) , using anti-sense RNA. Herein RNA that is complementary to the FabD, FabB, or FabF coding regions may be expressed and bind to the mRNA, leading to its degradation, and as a result suppressing expression of those enzymes. This technique may be used to arrest FAS synthesis completely, which leads to resistance against b-lactam antibiotics. In an example a plasmid may be constructed in which expression of the antisense RNA is under control, such as of an inducible promotor, and its expression may be triggered once sufficient cell density has been reached and the antibiotic synthesis pathway is induced.

It is noted that according to the knowledge of the inventor the present problem has not even been addressed. As mentioned, typically production of antibiotic compounds is achieved in native producers, which have natural mechanisms to resist antibiotics. These natural mechanisms could in principle be replicated in engineered strains. However, these natural mechanisms may be overwhelmed (even in native producers) at high concentrations achieved of antibiotics or toxic

precursors during production in an industrial fermentation. Furthermore there is no guarantee these mechanisms would work in alternative susceptible production hosts such as E. coli.

The present inventor has found that production of

antibiotics in genetically-tractable and fast-growing species can be much faster and much cheaper than production in native strains, as genetic manipulation tools have been established. Growth is very rapid (enabling the quick production of large quantities of biomass) , and there is much experience with using e.g. E. coli in industrial fermentation, indicating that boundary conditions per se for growth of E. coli are well known. In another aspect the production of antibiotics in E. coli enables a much quicker development of antibiotic

production pathways after the discovery of the genes

responsible for their production. This also enables a rapid diversification of antibiotics using biochemical diverse synthesis .

It is noted that antibiotic production in susceptible cells is expected to limit achievable titres by inhibiting biomass production (growth) , and by disrupting cell metabolism. Cell optical density (ODsoo) measurements clearly indicate growth inhibition occurring very early (2 h) after induction of antibiotic-production pathways.

For better understanding of the biosynthesis routes, engineering of microorganisms, and details thereof, reference can be made to the presentation by H. Shomar et al, 3 ^rd

Synthetic Biology Congress, London, United Kingdom. October 20, 2016, of which the contents are incorporated by reference.

In a third aspect the present invention relates to a product obtainable by any of the methods according to the invention. It has now been found, that until sufficient cell biomass has been generated, such as during at least 0.5 hour in an initial biomass production stage, preferably during at least 1 hour, such as at least two hours, cell lysis can be prevented and production of the antibiotic is increased significantly. The amount of cell biomass may be considered sufficient at 5*10 ⁸ -5* 10 ^® cells per ml, which can be verified with spectrophotometry by measuring the optical density such as at 600 nm. Likewise production of antibiotic is increased if cell growth is in at least one stage during production of the antibiotic inhibited.

In an exemplary embodiment the antibiotic product may further comprises residual products of the production method. These residual products may provide further advantages, such as inherently a mixture of antibiotics may be produced, making the mixture (or cocktail) more effective.

Thereby the present invention provides a solution to one or more of the above mentioned problems and drawbacks.

Advantages of the present description are detailed

throughout the description.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates in a first aspect to an engineering method according to claim 1.

In an exemplary embodiment of the present engineering method the at least one second gene sequence has a sequence identity to the first gene sequence of at least 70%,

preferably higher than 80%, more preferably higher than 90%, most preferably 95% up to 100%.

In an exemplary embodiment of the present engineering method the at least one second gene sequence is a homologue or an orthologue of the first gene sequence.

In an exemplary embodiment of the present engineering method

the first gene sequence may be selected from the group

comprising a gene encoding 3-oxoacyl- [acyl-carrier-protein] synthase, such as fabB, fabC, fabF _r fabJ, or fabH, a gene encoding a 3-hydroxydecanoyl- [acyl-carrier-protein]

dehydratase, such as fabA, a gene encoding biotin carboxyl carrier protein of acetyl-CoA carboxylase, such as accB, or fabE, a gene encoding malonyl CoA-acyl carrier protein

transacylase, such as fabD, or tfpA, a gene encoding 3- oxoacyl- [acyl-carrier-protein] reductase, such as fabG, a gene encoding enoyl- [acyl-carrier-protein] reductase, such as fabl, or env , a gene encoding cyclopropane-fatty-acyl-phospholipid synthase, such as cfa, or cdfA, a gene encoding acyl carrier protein, such as acpP, a gene encoding acetyl-coenzyme A carboxylase carboxyl transferase, such as accA, accD, dedB, or usg, a gene encoding biotin carboxylase, such as accC, or fabG, a gene encoding 3-hydroxyacyl- [acyl-carrier-protein] dehydratase, such as fabZ, sefA, or yaeA, a gene encoding glycerol-3-phosphate acyltransferase, such as plsB, a gene encoding l-acyl-sn-glycerol-3-phosphate acyltransferase, such as plsC, or parF, a gene encoding phosphatidate cytidylyl- transferase, such as cdsA, or cds, a gene encoding a CDP- diacylglycerol—glycerol-3-phosphate 3- phosphatidyltransferase, such as pgsA, a gene encoding a

CDP-diacylglycerol—serine O-phosphatidyl-transferase, such as pssA, or pss, a gene encoding a glycerol-3-phosphate

dehydrogenase, such as gpsA, a gene encoding a

phosphatidylserine decarboxylase proenzyme, such as psd, and combinations thereof.

In an exemplary embodiment of the present engineering method the tag may be appended to the C-terminus or N-terminus of the fatty acid synthesis enzyme encoded by the first gene sequence .

In an exemplary embodiment of the present engineering method the nucleic acid sequence encoding the tag may be derived from Mesoplasma forum tmRNA, preferably pmF-Lon or pmF-Lon_bis .

In an exemplary embodiment of the present engineering method the tag encoding nucleic acid sequence, the first gene sequence, the at least one second gene sequence and/or the third gene sequence may be codon optimised.

In an exemplary embodiment of the present engineering method the first gene sequence may be modified.

In an exemplary embodiment of the present engineering method at least one gene sequence may be introduced in the genetically modified microorganism for producing a cell wall targeting antibiotic, wherein the antibiotic may be selected from the group comprising penicillins, such as natural penicillins, b-lactamase resistant, aminopenicilins,

carboxypenicillins , ureidopenicillins , and b-lactamase

inhibitors, cephalosporins, such as carbapenem compounds, and combinations thereof.

In an exemplary embodiment of the present engineering method the genetically modified microorganism may be capable of carbapenem production. Details of hereof can be found in the above references.

In an exemplary embodiment of the present engineering method the microorganism may be selected from

Enterobacteriales , Actinobacteria, Bacillaceae, Streptomyces , Ascomycota and Basidiomycota .

In an exemplary embodiment of the present engineering method the microorganism may be selected from Escherichia, such as Escherichia coli, Bacillus, such as Bacillus subtilis, Streptomyces cattleya, Streptomyces argenteolus, Streptomyces flavogriseus, and Saccharomycetes, such as Saccharomyces cerevisiae .

In an exemplary embodiment of the present engineering method the genetically modified microorganism may be E. coli BL21(DE3), preferably containing plasmid pKD46, and/or wherein a small peptide tag may be appended to an end of the FAS gene, such as a pdt#3, and wherein the FAS gene together with the small peptide tag may preferably be introduced in the

genetically modified microorganism by homologous recombination resulting in a strain selected from the group comprising a FAS—pdt#3 strain, such as FabB-pdt#3 strain, a fabD-pdt#3 strain, and a fabF-pdt#3 strain, and optionally removing pKD46 from the microorganism.

In a second aspect the present invention relates to a method of producing an antibiotic, wherein the antibiotic may be selected from the group comprising penicillins, such as natural penicillins, such as Penicillin G, Penicillin K,

Penicillin N, Penicillin 0, and Penicillin V, b-lactamase resistant, such as Cloxacillin, Dicloxacillin, Flucloxacillin, Methicillin, Nafcillin, and Oxacillin, aminopenicilins , such as Amoxicillin,

Ampicillin, Bacampicillin, Epicillin, Hetacillin,

Metampicillin, Pivampicillin, and Talampicillin,

carboxypenicillins, such as

Carbenicillin, Temocillin, and Ticarcillin, ureidopenicillins, such as Mezlocillin, and Piperacillinand, b-lactamase

inhibitors, such as Clavulanic acid, Sulbactam, and

Tazobactam, cephalosporins, such as Cefacetrile, Cefadroxil; Duricef, Cefalexin; Keflex, Cefaloglycin, Cefalonium,

Cefaloridine, Cefalotin; Keflin; Cefapirin; Cefadryl;

Cefatrizine; Cefazaflur, Cef ^a zedone, Cefazolin, Ancef, Kefzol, Cefradine; Velosef, Cefroxadine, Ceftezole, Cefaclor, Cefonicid, Cefprozil, Cefuroxime, Cefuzonam, Cefmetazole, Cefotetan, Cefoxitin, Cephems, such as Carbacephems , such as Loracarbef, Cephamycins, such as Cefbuperazone, Cefmetazole, Cefminox, Cefotetan, Cefoxitin, Cefotiam, Cefcapene,

Cefdaloxime, Cefdinir, Cefditoren, Cefetamet, Cefixime,

Cefmenoxime, Cefodizime, Cefotaxime, Cefovecin, Cefpimizole, Cefpodoxime, Cefteram, Ceftamere, Ceftibuten, Ceftiofur,

Ceftiolene, Ceftizoxime, Ceftriaxone, Cefoperazone, and

Ceftazidime, Oxacephems, such as Latamoxef (moxalactam) ,

Cefclidine, Cefepime, Cefluprenam, Cefoselis, Cefozopran, Cefpirome, Cefquinome, and Flomoxef, Ceftobiprole,

Ceftaroline, Ceftolozane, Cefaloram, Cefaparole, Cefcanel, Cefedrolor, Cefempidone, Cefetrizole, Cefivitril, Cefmatilen, Cefmepidium, Cefoxazole, Cefrotil, Cefsumide, Ceftioxide, Cefuracetime, Nitrocefin, such as carbapenem compounds, derivatives thereof, precursors thereof, and combinations thereof .

In an exemplary embodiment of the present production method the carbapenem compound is a carbapenem antibiotic, such as azabicyclo [ 3.2.0 ] hept-2-ene-2-carboxylic acids, such as 7-oxo-

1-azabicyclo [3.2.0] hept-2-ene-2-carboxylic acids, such as thienamycin ( (5R, 6X) -3- [ (2-Aminoethyl) thio] -6- [ (1R) -1- hydroxyethyl ] -7-oxo-l-azabicyclo [3.2.0] hept-2-ene-2-carboxylic acid), imipenem ( 5R, 6S ) -6- [( 1R) -1-hydroxyethyl ] -3- ({ 2-

[ (iminomethyl) amino] ethyl }thio) -7-oxo-l-azabicyclo [3.2.0] hept-

2-ene-2-carboxylic acid, meropenem 4R, 5S , 6S ) -3- ( ( ( 3S , 5S ) -5- (Dimethylcarbamoyl) pyrrolidin-3-yl) thio) -6- ( (R) -1- hydroxyethyl ) -4-methyl-7-oxo-l-azabicyclo [3.2.0] hept-2-ene-2- carboxylic acid, ertapenem (4R, 5S, 6S) -3- [ (3S, 5S) -5- [ (3- carboxyphenyl) carbamoyl]

pyrrolidin-3-yl] sulfanyl-6- ( 1-hydroxyethyl ) -4-methyl-7- oxo-l-azabicyclo [3.2.0] hept-2-ene-2-carboxylic acid, doripenem (4R, 5S, 6S) -6- (1-Hydroxyethyl) -4-methyl-7-oxo-3- ( ( (5S) -5- ( ( sulfamoylamino ) methyl ) pyrrolidin-3-yl } thio ) -1- azabicyclo [3.2.0] hept-2-ene-2-carboxylic acid,

panipenem/betamipron (5R, 6S) -3-{ [ { 3S ) -1- ethanimidoylpyrrolidin-3-yl ] sulfany1 }- 6— [ ( 1R)—1—

hydroxyethyl ] -7-oxo-l-azabicyclo [3.2.0] hept-2-ene-2-carboxylic acid, biapenem (4R, 5S, 6S ) -3- ( 6, 7-dihydro-5H- pyrazolo [1, 2- a] [ 1 , 2 , 4 ] triazol-8- ium-6-ylsulfanyl ) - 6- ( 1-hydroxyethyl } - 4- methyl-7-oxo-l-azabicyclo [3.2.0] hept-2- ene-2-carboxylate, razupenem (4R, 5S, 6S) -6- ( (R) -1-hydroxyethyl) -4-methyl-3- ( (4- ( (S) -5-methyl-2, 5-dihydro-lH-pyrrol-3-yl ) thiazol-2-yl) thio) -7- oxo-l-azabicyclo [ 3.2.0 ] hept-2-ene-2-carboxylic acid, tebipenem (4R,5S, 6S) - ( Pivaloyloxy) methyl 3- ( ( 1- ( , 5-dihydrothiazo1-2- yl) azetidin-3-yl ) thio) -6- ( (R) -1-hydroxyethyl) -4-methyl-7-oxo- 1-azabicyclo [3.2.0 ] hept-2-ene-2-carboxylate, lenapenem, and tomopenem ( (4R, 5S, 6S) -3- [ (3S, 5S) -5- [ (3S) -3- [ [2- (diaminomethylideneamino) acetyl] amino] pyrrolidine-l-carbonyl] - l-methylpyrrolidin-3-yl] sulfanyl-6- [ (1R) -1-hydroxyethyl] -4- methyl-7-oxo-l-azabicyclo [3.2.0] hept-2-ene-2-carboxylic acid) , or a derivative thereof, or an analogue thereof. Hence a large variety of antibiotics can be produced.

In an exemplary embodiment of the present production method production of malonyl-ACP may be blocked.

In an exemplary embodiment of the present production method production of malonyl-ACP from Acetyl-CoA may be blocked by removing a fatty acid synthesis enzyme, such as FabD, from the genetically modified microorganism.

In an exemplary embodiment of the present production method microorganisms may be grown to an optical density ODeoo of >1 and delaying expression of antibiotic synthesis with at least 0.5 hour, subsequently inducing fatty acid enzyme degradation and producing antibiotics. Typically growth of the culture is initiated by inoculation, generating sufficient cell biomass and thereafter ceasing growth, such as after at least 0.5 hour bacterial growth, preferably after at least 1 hour, such as after least two hours, therewith preventing cell lysis. The amount of cell biomass may be considered sufficient at 5*10 ⁸ - 5*10 ⁹ cells per ml, which can be verified with

spectrophotometry by measuring optical density such as at 600 nm. The ODeoo is preferably > 1, more preferably > 2, or even >

5 or > 10. Thereby, typical microorganisms as E. coli ,

significantly increase the amount of produced antibiotic, such as carbapenem, by about a factor 3-5, which is unexpected.

In an exemplary embodiment of the present production method an improvement is achieved by preventing cell lysis when the antibiotic is produced; this is considered to prevent the cell from halting antibiotic production, thereby improving carbapenem production.

In an exemplary embodiment of the present production method an improvement is achieved by a method for preventing or slowing down or dcerasing cell lysis before sufficient biomass is generated. This may prevent antibiotic accumulation, which may lead to cell lysis and prevent the accumulation of

sufficient biomass that could enable high-titre production.

In an exemplary embodiment the present production method may be comprise at least one further biological or chemical synthesis step of producing an antibiotic, such as addition or removal of a moiety, such as methylation and thiolation, oxidation, reduction, epimerization, reacting with a further compound, etc.; i.e. one may start with the present

biosynthesis of carbapenem and complete a full synthesis, towards a desired molecule, with at least one further

biological or chemical synthesis step, preferably only (a) biological synthesis step(s) as production can then be carried out by a microorganism. When using only microorganism

production is typically limited to natural occurring

carbapenems . The present method may be considered to deliver an intermediate product in such a case.

By splitting the present method in various steps also alternative biosynthesis routes become directly available, starting from more common steps. Such makes the present method very versatile.

The above characteristics of the host cell provide specific advantages for the production of specific antibiotics, such as carbapenems .

The one or more of the above examples and embodiments may be combined, falling within the scope of the invention.

FIGURES

Fig. la-d shows Car Production in growth arrested cultures.

Fig. 2a-e FAS inhibition results in a substantial

intracellular accumulation of malonyl-CoA.

Fig. 3 shows LC/MS analysis of CMP (3) titers over time in culture supernatants.

Fig. 4 shows FAS arrest increases tolerance to the complex carbapenem imipenem.

Fig. 5: Car biosynthesis pathway.

Fig. 6 shows Car production causes lysis and limits achievable titers .

Fig. 7 shows inhibition of fatty acid synthesis increases antibiotic tolerance and Car pathway flux.

Figs. 8-9 show experimental results.

DETAILED DESCRIPTION OF THE FIGURES

Fig. la-d shows Car production in growth-arrested cultures using two methods: HipA overexpression and FAS inhibition (cerulenin treatment) . HipA overexpression was induced with 50 ng/mL aTc simultaneously with induction of Car pathway

expression. 20 gg/mL cerulenin was added with induction of the Car pathway, (a) PI fluorescence per OD600 recorded in culture samples 24h after induction. Error bars represent the standard deviation of analytical replicates (b) Growth curves of engineered cultures after induction measured by OD6Q0. (c) 3 titers after induction. FAS inhibition results in accumulation of 3, whereas growth arrest by HipA decreases 3 titers, (d)

Car production (6 counts) after induction. Dots represent biological replicates grown from separate colonies.

In order to prevent lysis of Car-producing cells and extend Car production further, we explored natural mechanisms that confer tolerance to b-lactams. A phenotype known as

persistence, in which cells are temporarily immune to

antibiotic exposure, can be artificially induced by expression of growth-arresting toxin proteins. Overexpression of the toxin HipA causes growth-arrest and confers b-lacta tolerance by triggering guanosine tetraphosphate synthesis (ppGpp) , which directly inhibits the phospholipid synthesis enzyme PlsB. HipA-arrested cultures survive b-lactam exposure while remaining metabolically active, and are able to sustain production of the isoprenoid precursor mevalonate from a heterologous pathway for several days while resisting phage- induced lysis. We tested whether growth arrest by HipA could also prevent Car-induced lysis. While HipA-arrested cultures sustained production of Car and exhibited lower cell

permeability (Fig. la, Id) , higher titers were not achieved, likely due to decreased production of carboxymethylproline {Fig. lc) .

Fig. 2a-e FAS inhibition results in a substantial

intracellular accumulation of malonyl-CoA. (a) Fluorescence of BL21 cells carrying the pCFR malonyl-CoA biosensor plasmid treated with cerulenin. (b-d) The strains fabB-pdt#3, fabB- pdt#3 and fabD-pdt#3 strains were co-transformed with pCFR and pmf-Lon bis. mf-Lon protease was induced with aTc. (b, c) Malonyl-CoA accumulation was not observed in strains fabBpdt#3 and fabF-pdt#3. (d) Sufficient expression of mf-Lon protease triggers FabD degradation, resulting in significant

accumulation of malonyl-CoA, resulting from FabD degradation, and growth arrest (e) . Error bars represent the standard deviation of culture triplicates grown from an individual colony.

Fig. 3 shows LC/MS analysis of CMP (3) titers over time in culture supernatants. For f-lon overexpression, cultures were induced with 10 ng/mL aTc simultaneously. Cerulenin {20 pg/mL) was added at induction. FAS inhibition significantly boosts the incorporation of malonyl-coA into the Car pathway

{cerulenin treatment and FabD degradation in the strain FabD- pdt#3) . Dots represent biological replicates. Solid lines represent average values from biological replicates grown from separate colonies.

Fig. 4 shows FAS arrest increases tolerance to the complex carbapenem imipenem. Cultures of BL21{DE3) and fabD-pdt#3 pmf- Lon were grown until OD600 = 1.0 and treated with imipenem. Cultures of fabD-pdt#3 pmf-Lon were induced with 10 ng/mL aTc and incubated for 2.5 h to provoke growth-arrest prior to imipenem exposure. Measurements were performed 24 h after treatment. Error bars represent standard deviation of

biological triplicates grown from 3 separate colonies. FAS arrest reduces imipenem-induced lysis as measured by cell permeability {a) and optical density loss (b) .

Figure 5 shows the Car biosynthesis pathway and LC/MS detection of metabolites (details of the LC-MS method can be found in the above articles of Bokinsky) . (a) The enzyme CarB joins P5C, an intermediate of proline synthesis, with the fatty acid precursor malonyl-CoA to yield carboxy ethylproline {CMP} . CarA catalyses the ATP-dependent formation of the b- lactam ring to generate carbapenam, the precursor to all known naturally-occurring carbapenems. CarC catalyses two enzymatic steps: C5 epimerisation and C2-C3 desaturation to produce the bioactive carbapenem nucleus of Car. As with all carbapenems, the b-lactam ring of Car is susceptible to spontaneous hydrolysis. Highlighted are the strategies employed to increase Car production. (I) increasing P5C by relieving allosteric inhibition by proline; (II) eliminating consumption of malonyl-CoA by FabD; (III) regenerating CarC activity by expressing the ferredoxin CarE. (b) Chromatograms of Car pathway metabolites and by-products detected in cultures of E. coli pCarB, pCarAB, pCarCSA, and BL21: CMP (3), carbapenam (4) and hCar (6). Fragmentation spectra are included as well.

Production of antibiotics in susceptible cells is expected to limit achievable titers by inhibiting biomass production (growth) . In particular, production of b-lactam antibiotics, which target cell wall synthesis, should further limit titers by triggering lysis of the microorganism and arresting

biosynthesis. ODeoo measurements clearly indicate growth inhibition occurring very early (2 h) after induction of high- performing pathways (Fig. 6a) . Growth curves of genetically engineered E. coli strains after induction of a carbapenem (Car) synthesis pathway are shown in Fig. 6a, wherein the various strains are indicated by pCarAB, pCarCBA, pCarCBAE, pCarCBAE_ProB ( I69E) A) . The Dots represent 25 mL culture biological replicates. A complete Car pathway has been

introduced in strain pCarCBAE_ProB (I69E) A, consisting of genes carC, carB, carA, carE, proB(l69E), and proA. In gene

proB(I69E) an isoleucine at position 69 has been mutated to a glutamate to remove feedback inhibition from the encoded enzyme product by proline.

Growth inhibition reduces maximum biomass achievable (as estimated by ODeoo) by 9-fold compared to a control strain (E. coli BL21 pCarAB) . Car-producing cultures accumulate cell debris characteristic of cell lysis, which is also reflected by decreasing trends in ODeoo apparent 3-5 h after induction (Fig. 6a) . Measurements of membrane permeability using

propidium iodide (PI) confirm that permeability increases early after induction of the Car pathway and correlates with Car productivity, consistent with Car-induced lysis (Fig. 6b) . As optical density is not an accurate measure of total biomass produced after lysis, propidium iodide (PI) fluorescence was normalized instead to total protein precipitated by methanol- chloroform extraction from whole cultures. Error bars

represent the standard deviation of biological triplicates. Measurements of cell viability, as determined from counts of colony forming units (CFU) 24 h after induction, confirm that cell death correlates with productivity.

Growth inhibition by Car prevents the translation of productivity improvements into titer increases. 25 mL cultures of BL21 pCarCBAE exhibit 14-fold higher productivity than BL21 pCarCBA early after the pathway is induced, while reaching only 70% of the titer of 6 measured at 24 h. BL21

CarCBAE_ProB ( I69E) A (37-fold higher productivity) improves 24 h titers of hCar by only 2.6-fold (Fig. 6c, 6d) . This is partly caused by the considerable reduction in biomass

produced caused by growth inhibition and lysis by Car. Car production by cultures of BL21 pCarCBAE_ProB ( I69E) A apparently continues during lysis, but at a decreasing rate, likely due to arrest of cell metabolism (Fig. 6a, 6c).

Inhibition of FAS using the mycotoxin cerulenin, an inhibitor of FabF and FabB enzymes, starves phospholipid synthesis and confers b-lactam tolerance. But the cost of cerulenin makes its use in large-scale fermentations

impractical, therefore we sought a genetically-encoded trigger for FAS inhibition. We used a recently-developed synthetic protein degradation system to eliminate FAS enzymes which consume malonyl-CoA. The mf-Lon protease degrades proteins carrying a specific C-terminal tag (pdt) . To construct the mf- Lon protease expression vector, we

introduced the codon optimised mf-Lon gene and strong ribosome binding site from pECL27545 into the pBbA2c60 BglBrick backbone. The resulting plasmid pmf-Lon contains a

chloramphenicol resistance cassette. The derivative plasmid pmf-Lon-bis contains an a picillin resistance cassette

instead. All the strains and plasmids constructed in this work are listed in Table 1. We appended a tag that confers a fast degradation rate (pdt#3) to chromosomally-encoded fatty acid synthesis enzymes (FabB, FabF, and FabD) , and induced

expression of the mf-Lon protease. Similar to cerulenin treatment, induction of the mf-Lon protease arrested growth while leading to accumulation of Malonyl-CoA in BL21 fabD- pdt#3 (Fig. 7a) and increased carboxymethylproline production in BL21 fabD-pdt#3 pCarCBAE_ProB ( I69E) A. Growth curves of BL21 (DE3) pCarCBAE_ProB ( I 69E ) A after induction indicate lysis (45% ODeoo decrease} in BL21(DE3) in Fig. 7a, which is reduced in fabD-pdt#3 pmf-Lon strain (19% ODeoo decrease). Error bars represent the standard deviation of biological triplicates grown from 3 separate colonies. Protease-driven depletion of FabD in the strain fabD-pdt#3 pmf-Lon was simultaneously induced with Car production. Induction of FabD degradation reduced both cell lysis and membrane permeability of Car- producing cells, indicating that FAS inhibition via FabD degradation decreases Car toxicity (Fig. 7a, 7b) . Furthermore, FabD degradation increased Car production {normalized to culture volume) by 50% (Fig. 7c) . Inhibition of FAS by FabD degradation also increases tolerance against the complex carbapene antibiotic imipenem.

To confirm that improved tolerance can directly lead to improved Car titers, we tested the stability of Car production in FAS-inhibited cells by supplementing cultures with fresh medium 1.5 h after induction. We hypothesized that addition of fresh medium would prolong productivity of metabolically- active cultures, either by restoring depleted nutrients or by diluting inhibitory waste products. No additional Car was produced in control cultures after medium supplementation, suggesting that the cultures had been metabolically

inactivated by lysis. However, biosynthesis activity continued in FAS-inhibited cultures, and total amount of hCar increased by 40% (Fig. 7c) . Overall, Car production in FAS-arrested cultures supplemented with fresh medium improved by 2-fold compared to control cultures. We attribute this increase to a combination of antibiotic tolerance and increased

concentrations of malonyl-CoA available for synthesis of carboxymethylproline by CarB.

The degradation tag pdt#3 was fused to the C terminus of the genes of interest in E. coli BL21(DE3) chromosomal DNA. For each targeted gene ( fabB, fabD and fabF) , we generated PCR products that contained the pdt#3 tag amplified from pECT3 and 37-42 bp 5' extensions with homology to the C terminus, and 3' extensions with homology to the immediate 3' untranslated region of the gene of interest. The PI and P2 primer sequences and full-Page length primers used to target fabB, fabD and fabF are found in Table 2. Genomic pdt#3 insertions were performed using homologous recombination by transforming the PCR products into E. coli BL21(DE3) containing pKD46.

Successful insertions were verified by PCR. The kanamycin resistance cassette was subsequently removed using the plasmid pCP20. The resulting strains, fabB-pdt#3, fabD-pdt#3 and fabF- pdt#3 were screened by PCR and verified by DNA sequencing.

Figure 8 shows Car production limits growth, causes lysis, and decreases achievable antibiotic titres. (a) Growth curves of engineered strains after induction of Car production. Dots represent 25 mL-culture biological replicates (b) Photographs of cultures 24 h after induction exhibiting significant cell debris and poor growth in Car-producing strains (c) Cell permeability measurements in Car-producing cultures 24 h after induction. As optical density is not an accurate measure of total biomass produced in lysed cultures, propidium iodide (PI) fluorescence was normalized instead to total protein precipitated by methanol-chloroform extraction from whole cultures. Error bars represent the standard deviation of analytical triplicates, (d) LC/MS analysis of hCar titres after induction. Dots represent 25 mL-culture biological replicates, (e) Productivity comparison at 2 h after induction with final titres achieved at 24 h. Productivity of lysed cultures was estimated by hCar titres per total protein extracted in culture samples collected 2 h after induction (dark bars) . In addition it is found that mutations of

cysteine residues (C43S and C46S) that participate in the FeS cluster of CarE (BL21 pCarCBAEmut) eliminate the high- production phenotype. Productivity is calculated from hCar LC/MS counts divided by the cell density (OD600) recorded in culture supernatants 1.5 h after induction.

Figure 9 shows Engineering antibiotic tolerance and improved Car pathway flux (a) Growth curves of

pCarCBAE_ProABmut cultures after induction indicating lysis (45% OD600 decrease) in BL21 strains, which is reduced in fabD-pdt#3 strain (17% OD600 decrease) . (b) Cell permeability measurements 24 h after induction indicates that FAS

inhibition in fabD-pdt#3 reduces Car-induced lysis, (c) Titres of 3, 4, and 6 (left, centre, and right, respectively) in culture supernatants 24 h after induction. FAS inhibition and malonyl-CoA accumulation increases Car pathway flux. Error bars represent the standard deviation of biological triplicates grown from 3 separate colonies.

The invention is further detailed by the accompanying example, which is exemplary and explanatory of nature and are not limiting the scope of the invention. To the person skilled in the art it may be clear that many variants, being obvious or not, may be conceivable falling within the scope of

protection, defined by the present claims.

EXAMPLE

Example of an experiment for carbapene production.

Strains and growth medium.

E. coli BL21(DE3) was used for Car production experiments. For all Car production experiments, cells freshly-transformed with plasmids encoding the Car pathway were used.

Transformants were grown overnight on selective media agar plates at 37°C. Colonies grown for more than 48 h on agar plates showed poor growth when inoculated into liquid medium. Car production cultures were grown in MOPS-based minimal medium (8.372 g L ^-1 MOPS, 0.717 g L ^-1 Tricine, 2.92 g L ^-1 NaCl, 11 mg L ^-1 MgCl _2* 7H ₂ 0, 0.56 pg L ^-1 CaCl ₂ , 200 pL micronutrient stock41) supplemented with 4 g L ^-1 D-glucose, 28.5 mM NH ₄ C1, 10 mM FeSCk and 5 g L ^-1 potassium glutamate. The antibiotics kanamycin (25 pg/mL) , ampicillin (50 pg/mL} and

chloramphenicol (17.5 pg/mL) were added when appropriate.

Plasmid construction .

All plasmids were constructed using Gibson assembly in E. coli DH5a. Genes encoding the Car enzymes from P. carotovorum ( carABCDE) were codon-optimized for expression in E. coli . The proAB genes were obtained by PCR amplification from E. coli BL21(DE3) genomic DNA. The mutant variants I69E of ProB, and C43S/C46S of CarE were constructed by PCR site-directed mutagenesis using the primers PI and P2 in Supplementary Table 2. Biosynthetic operons were assembled and cloned into the pBbE5k BglBrick backbone. The plasmid pCarCBA_E was

constructed from pCarCBA, by addition of the CarE expression unit under control of the inducible PTet promoter. The reverse sequence of the CarE inducible expression unit was placed at the 3' end of the bi-directional terminator present on the pBbE5k BlgBrick backbone. hipA was cloned from E. coli MG1655 genomic DNA and inserted into the pBbS2c BglBrick backbone to make pHipA. To construct the mf-Lon protease expression vector, we introduced the codon optimised mf-Lon gene and strong ribosome binding site from pECL275 into the pBbA2c

BglBrick backbone. The resulting plasmid pmf-Lon contains a chloramphenicol resistance cassette. The derivative plasmid pmi-Lon-bis contains an ampicillin resistance cassette

instead. All the strains and plasmids constructed in this work are listed in Supplementary Table 1.

Construction of strains with tuneable protein degradation.

The degradation tag pdt#339 at the C terminus of the genes of interest in E. coli BL21(DE3) chromosomal DNA. For each targeted gene { fabB, fabD and fabF) , PCR products were

generated that contained the pdt#3 tag amplified from pECT3 and 37-42 bp 5' extensions with homology to the C terminus, and 3' extensions with homology to the immediate 3 ^r

untranslated region of the gene of interest. The Pi and P2 primer sequences and full- length primers used to target fabB, fabD and fabF. Genomic pdt#3 insertions were performed using homologous recombination by transforming the PCR products into E. coli BL21(DE3) containing pKD46. Successful insertions were verified by PCR. The kanamycin resistance cassette was subsequently removed using the plasmid pCP20. The resulting strains, fabB-pdt#3, fabD-pdt#3 and

fabF-pdt#3 were screened by PCR and verified by DNA

sequencing .

Genetic manipulations.

The specific nucleotide sequences as used are provided in the appendices to this application.

Growth conditions.

Production of Car in E. coli from the present synthetic operon, is achieved using the following growth conditions.

Analytical results show that Car was produced in detectable amounts .

Circumventing antibiotic toxicity to improve Car production and Car pathway flux

Toxicity of Car limits achievable cell density of

production cultures and severely limits antibiotic titres.

Inventors improved tolerance to antibiotic products without compromising productivity. An approach to mitigate biomass limitation caused by Car toxicity was to induce expression of the Car pathway once a sufficient amount of biomass is

produced, rather than at an early point during exponential phase. Induction of BL21 pProABmut CBAE at a higher cell density (ODeoo 1 rather than ODeoo 0.35) increased both maximum biomass and hCar titre by nearly 2-fold. However, lysis was still observed in late-induced cultures as decreasing OD600 from 3 to 24 h. A phenotype known as persistence, in which cells are temporarily immune to antibiotic exposure, is artificially induced by expression of growth-arresting toxin proteins. Overexpression of e.g. toxin HipA causes growth- arrest and confers b-lactam tolerance. HipA- arrested cultures survive b-lactam exposure while remaining metabolically active, and are able to sustain production of the isoprenoid precursor mevalonate from a heterologous pathway, while resisting phage-induced lysis.

b-lacta tolerance was, in an alternative approach, achieved by direct inhibition of fatty acid synthesis (FAS). Inhibition of FAS using mycotoxin cerulenin inhibits

phospholipid synthesis and confers b-lactam tolerance.

Cerulenin treatment was found to cause accumulation of

malonyl-CoA, a substrate of CarB. Inhibition of FAS by

cerulenin thus benefits carbapenem production in two ways: by decreasing lysis, and by increasing availability of a

precursor metabolite. Treatment of Car-producing cultures with 20 pg/mL cerulenin decreased Car-induced lysis. Cerulenin was found to increase titres of CMP by nearly 5-fold. Although malonyl-CoA accumulation did not significantly improve hCar titres, FAS inhibition greatly improved flux into the Car pathway while alleviating Car-induced lysis. In an alternative to cerulenin a synthetic protein degradation system to target FAS enzymes which consume malonyl-CoA was used. pdt#3 was appended to chromoso ally-encoded fatty acid synthesis enzymes which use malonyl-CoA as a substrate (FabB, FabF, and FabD) , and induced expression of the mf-Lon protease. Similar to cerulenin treatment, induction of the mf-Lon protease caused both growth arrest and malonyl-CoA accumulation in BL21 FabD- pdt#3 and increased CMP production in BL21 FabD- pdt#3_pCarCBAE_ProABmut . Simultaneous induction of the Car pathway and FabD degradation reduced both cell lysis and membrane permeability. While hCar titers were not significantly increased by FabD degradation, malonyl-CoA accumulation substantially improved flux into the Car pathway, increasing titres of carbapenam 4 by 5-fold.

Table 1. List of strains and plasmids

Plasmid name Description

Plasmids

pCarAB Codon optimized CarAB enzymes in pBbaA5k backbone

pCarCBA Codon optimized CarCBA enzymes in pBbaASk backbone

pCarCBAE Codon optimized CarCBAE enzymes in pBbaASk

backbone

pCarCBAE ProB ( I 69E ) A ProB(I69E)A and codon optimized

CarCBAE enzymes (in that order) in pBbaASk backbone

pCarCBADE Codon optimized CarCBADE enzymes in pBbaASk

backbone

pCarCBADE ProB(l69E)A ProB(l69E)A and codon optimized

CarCBADE enzymes (in that order) in pBbaASk backbone

pCarCBADE ProBwtA ProBwtA and codon optimized CarCBADE enzymes (in that order) in pBbaASk backbone pCarCBA E Codon optimized CarCBA enzymes under the control of pLacUVS, and CarE under control of pTet pCarE Codon optimized CarE enzyme in pBbaASk backbone pCarE (C43S/C46S) Mutant variant of CarE (C43S/C46S) in pBbaASk backbone

pCarCBAE (C43S/C46S) Codon optimized CarCBA enzymes and mutant variant of CarE (C43S/C46S) in pBbaA5k backbone

pCarBD Codon optimized CarBD enzymes in pBbaA5k backbone

pCarBDE Codon optimized CarBDE enzymes in pBbaA5k backbone

pCarBE Codon optimized CarBE enzymes in pBbaA5k backbone

pHipA HipA toxin in pBbS2c

pmf-Lon Codon optimized mf-Lon protease in pBbA2c pmf-Lon-bis Codon optimized mf-Lon protease in pBbA2a pECL275 Source of codon optimized mf-Lon protease pECT3 Source of pdt#3 tag

pCFR Malonyl-CoA biosensor

Strains

Escherichia coli DH5a E. coli strain for cloning and plasmid amplification

Escherichia coli BL21(DE3) E. coli strain for antibiotic production and HipA overexpression . Source of proBA.

Escherichia coli MG1655 Source of hipA

Escherichia coli fabD-pdt#3 E. coli strain BL21 (DE3) containing FabDpdt#3 fusion carrying pmf-Lon

Escherichia coli fabB-pdt#3 E. coli strain BL21 (DE3) containing FabBpdt#3 fusion carrying pmf-Lon

Escherichia coli fabF-pdt#3 E. coli strain BL21(DE3) containing FabFpdt#3 fusion carrying pmf-Lon

Table 2 List of primers

Pl-fabB

GGCGGCACCAACGCCACGCTGGTAATGCGCAAGCTGAAAGATGCGGCGAACAAAA

ACGAA

P2-fabB

GATGCGACGCTGGCGCGCCTTACCCGACCTACGGCGAATTATGTAGGCTGGAGCT

GCTT

Pl-fabD

TGAACGAACCTTCAGCGATGGCAGCGGCGCTCGAGCTTGCGGCGAACAAAAACGA

A

P2-fabD

CAGTGCGATTTTTCCTTCAAAATTCATGATTTTCCTCTTTTATGTAGGCTGGAGC

TGCTT

Pl-fabF

GCTTCGGTGGCACTAATGGTTCTTTGATCTTTAAAAAGATCGCGGCGAACAAAAA CGAA

P2-fabF

CGCAAGCGGACCTTTTATATGGGTGGGAAATGACAACTTATGTAGGCTGGAGCTG

CTT