ROSENFELD HENNING (DE)
ILMBERGER NELE (DE)
PLAMBECK TANJA (DE)
RUPRECHT CONSTANTIN (DE)
BÖNISCH FRIEDERIKE (DE)
WO2014191524A1 | 2014-12-04 | |||
WO2014191524A1 | 2014-12-04 |
EP1867729A1 | 2007-12-19 | |||
KR101629503B1 | 2016-06-10 | |||
US20110123481A1 | 2011-05-26 |
OHASHI TAKAO ET AL: "Substrate preference of citrus naringenin rhamnosyltransferases and their application to flavonoid glycoside production in fission yeast", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER, DE, vol. 100, no. 2, 3 October 2015 (2015-10-03), pages 687 - 696, XP035597070, ISSN: 0175-7598, [retrieved on 20151003], DOI: 10.1007/S00253-015-6982-6
YANG SO-MI ET AL: "Production of kaempferol 3-O-rhamnoside from glucose using engineered Escherichia coli", JOURNAL OF INDUSTRIAL MICROBIOLOGY & BIOTECHNOLOGY, vol. 41, no. 8, August 2014 (2014-08-01), pages 1311 - 1318, XP002758666
JONES P ET AL: "UGT73C6 and UGT78D1, Glycosyltransferases Involved in Flavonol Glycoside Biosynthesis in Arabidopsis thaliana", JOURNAL OF BIOLOGICAL CHEMISTRY 20031107 AMERICAN SOCIETY FOR BIOCHEMISTRY AND MOLECULAR BIOLOGY INC. US, vol. 278, no. 45, 7 November 2003 (2003-11-07), pages 43910 - 43918, XP002758667, DOI: 10.1074/JBC.M303523200
U. RABAUSCH ET AL: "Functional Screening of Metagenome and Genome Libraries for Detection of Novel Flavonoid-Modifying Enzymes", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 79, no. 15, 1 August 2013 (2013-08-01), pages 4551 - 4563, XP055131425, ISSN: 0099-2240, DOI: 10.1128/AEM.01077-13
BOWLES DIANNA ET AL: "Glycosyltransferases of lipophilic small molecules", ANNUAL REVIEW OF PLANT BIOLOGY, vol. 57, 2006, pages 567 - 597, XP002758668, ISSN: 1040-2519
VERVERIDIS, BIOTECH. J., vol. 2, no. 10, 2007, pages 1214 - 1234
DE BRUYN, MICROB CELL FACT, vol. 14, 2015, pages 138
OHASHI, APPL MICROBIOL BIOTECHNOL, vol. 100, 2016, pages 687 - 696
YANG, J IND MICROBIOL BIOTECH, vol. 41, 2014, pages 1311 - 18
JONES, J BIOL CHEM, vol. 278, 2003, pages 43910 - 18
HEDIN, J AGRIC FOOD CHEM, vol. 38, no. 8, 1990, pages 1755 - 7
HIRAYAMA, PHYTOCHEMISTRY, vol. 69, no. 5, 2008, pages 1141 - 1149
JUNG, FOOD CHEM TOXICOL, vol. 50, no. 6, 2012, pages 2171 - 2179
CHAUHAN, PHYTOCHEMISTRY, vol. 23, no. 10, 1984, pages 2404 - 2405
CHAUHAN, PHYTOCHEMISTRY, vol. 17, 1978, pages 334
SRIVASTAVA, PHYTOCHEMISTRY, vol. 18, 1979, pages 2058 - 2059
SRIVASTAVA, INDIAN J CHEM SECT B, vol. 18, 1979, pages 86 - 87
SHRIVASTAVA, INDIAN J CHEM SECT B, vol. 21, no. 6, 1982, pages 406 - 407
YADAVA, J INDIAN CHEM SOC, vol. 74, no. 5, 1997, pages 426 - 427
COUTINHO, J MOL BIOL, vol. 328, no. 2, 2003, pages 307 - 317
HUGHES, MIT DNA, vol. 5, no. 1, 1994, pages 41 - 49
RABAUSCH, APPL ENVIRON MICROBIOL, vol. 79, no. 15, 2013, pages 4551 - 4563
JANVARY, J AGRIC FOOD CHEM, vol. 57, no. 9, 2009, pages 3512 - 3518
LORENC-KUKALA, J AGRIC FOOD CHEM, vol. 53, no. 2, 2005, pages 272 - 281
TOHGE, THE PLANT J, vol. 42, no. 2, 2005, pages 218 - 235
HE, JBC, vol. 281, no. 45, 2006, pages 34441 - 7
DAIMON, PNAS, vol. 107, no. 25, 2010, pages 11471 - 11476
XU, MOL BIOL REP, vol. 40, no. 5, 2013, pages 3631 - 3639
XIE, BIOCHEMISTRY, vol. 78, no. 5, 2013, pages 536 - 541
NOGUCHI, J AGRIC FOOD CHEM, vol. 56, no. 24, 2008, pages 12016 - 12024
SHIMODA, NUTRIENTS, vol. 2, no. 2, 2010, pages 171 - 180
T. E. CREIGHTON: "ProteinsStructure and Molecular Properties, 2nd ed.", 1993, W. H. FREEMAN AND COMPANY
B. C. JOHNSON: "Posttranslational Covalent Modification of Proteins", 1983, ACADEMIC PRESS, pages: 1 - 12
VAN LEEN ET AL., BIO/TECHNOLOGY, vol. 9, 1991, pages 47 - 52
SRINIVASAN ET AL., APPL. ENVIRON. MICROBIOL., vol. 68, 2002, pages 5925 - 5932
BELANGER ET AL., FEMS MICROBIOL LETT., vol. 231, no. 2, 2004, pages 197 - 204
ODDONE ET AL., PLASMID, vol. 62, no. 2, 2009, pages 108 - 18
SAMBROOK: "Molecular Cloning", 2012, COLD SPRING HARBOR LABORATORY PRESS
SAMBROOK; RUSSELL: "Molecular Cloning: A Laboratory Manual, 4th ed.", 2012, COLD SPRING HARBOR LABORATORY PRESS
AUSUBEL ET AL.: "Short Protocols in Molecular Biology, 52nd ed.", 2002, CURRENT PROTOCOLS
WOOD ET AL., J. BACTERIOL., vol. 14, 1981, pages 1448
COHEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 69, 1972, pages 2110 - 2114
HANAHAN, J. MOL. BIOL., vol. 166, 1983, pages 557 - 580
MANDEL; HIGA, J. MOL. BIOL., vol. 53, 1970, pages 159 - 162
SHIGEKAWA; DOWER, BIOTECHNIQUES, vol. 6, 1988, pages 742 - 751
SAUNDERS; SAUNDERS: "Microbial Genetics Applied to Biotechnology Principles and Techniques of Gene Transfer and Manipulation", 1987, CROOM HELM
PUHLER: "Genetic Engineering of Microorganisms", 1993
LEE ET AL.: "Metabolic Engineering", 1999, MARCEL DEKKER
ADOLPH: "Microbial Genome Methods", 1996, CRC PRESS
BIRREN; LAI: "Nonmammalian Genomic Analysis : A Practical Guide", 1996, ACADEMIC PRESS
SHIMODA; HAMADA, NUTRIENTS, vol. 2, 2010, pages 171 - 180
PARK, BIOSCI BIOTECHNOL BIOCHEM, vol. 70, no. 4, 2006, pages 940 - 948
AKIYAMA ET AL., BIOSCI BIOTECHNOL BIOCHEM, vol. 64, no. 10, 2000, pages 2246 - 2249
KIM ET AL., ENZYME MICROB TECHNOL, vol. 50, 2012, pages 50 - 56
KOK, ACS SYNTH BIOL, vol. 3, no. 2, 2014, pages 97 - 106
BEYER, PLOS ONE, vol. 10, no. 9, 2015, pages E0137652
SHRIVASTAVA, IND J CHEM SECT B, vol. 21, no. 6, 1982, pages 406 - 407
SIMKHADA, MOL. CELLS, vol. 28, 2009, pages 397 - 401
WERNER, BIOPROCESS BIOSYST ENG, vol. 33, 2010, pages 863 - 871
BIESALSKI, CURR OPIN CLIN NUTR METAB CARE, vol. 10, no. 6, 2007, pages 724 - 728
SANTANGELO, ANN 1ST SUPER SANITA, vol. 43, no. 4, 2007, pages 394 - 405
KOREAN J DERMATOLOGY, vol. 41, 2003, pages 445 - 450
YANO, J CLIN INVEST, vol. 107, 2001, pages 409 - 417
VINCENTI, ARTHRITIS RES, vol. 4, 2002, pages 157 - 164
HENCKELS, F1000RESEARCH, vol. 2, 2013, pages 229
CALEY, ADV WOUND CARE, vol. 4, 2015, pages 225 - 234
VINCENTI; BRINCKERHOFF, ARTHRITIS RESEARCH, vol. 4, no. 3, 2002, pages 157 - 164
SANCHO, MOL PHARMACOL, vol. 63, 2003, pages 429 - 438
PRASAD, PLANTA MED, vol. 76, 2010, pages 1044 - 1063
ROMIER, BRIT J NUTR, vol. 100, 2008, pages 542 - 551
J NEUROSCI, vol. 32, 2012, pages 10662 - 10673
CAO, SCI. REP., vol. 6, 2016, pages 21731
Claims 1. A method for the production of rhamnosylated flavonoids, the method comprising (a) contacting/incubating a giycosyi transferase with a flavonoid; and (b) obtaining a rhamnosylated flavonoid, wherein the giycosyi transferase (a) comprises the amino acid sequence of SEQ ID NO: 1 ; comprises amino acid sequences having at least 80% sequence identity with SEQ ID NOs: 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 56, 58, or 61 ; is encoded by a polynucleotide comprising the nucleic acid sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 57, 59, 60, 62, or 63; is encoded by a polynucleotide having at least 80% sequence identity with SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 57, 59, 60, 62, or 63; or is encoded by a polynucleotide hybridizable under stringent conditions with a polynucleotide comprising SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 57, 59, 60, 62, or 63, and wherein the flavonoid is a compound or a solvate of the following Formula (I) wherein: is a double bond or a single bond; R1 and R2 are independently selected from hydrogen, Ci-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, heteroalkyl, cycloalkyi, heterocycloalkyi, aryl, heteroaryl, -Ra-Rb, -Ra-ORb, -Ra-ORd, -Ra-ORa-ORb, -Ra-ORa-ORd, -Ra-SRb, -Ra-SRa-SRb, -Ra-NRbRb, -Ra-halogen, -Ra-(C1-5 ha!oalkyl), -Ra-CN, -Ra-CO-Rb, -Ra-CO-0-Rb, -Ra-O-CO-Rb, -Ra-CO-NRbRb, -Ra-NRb-CO-Rb, -Ra-S02-NRbRb and -Ra-NRb-S02-Rb; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyi, said heterocycloalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups Rc; wherein R2 is different from -OH; or R1 and R2 are joined together to form, together with the carbon atom(s) that they are attached to, a carbocyclic or heterocyclic ring being optionally substituted with one or more substituents Re; wherein each Re is independently selected from Ci-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, heteroalkyl, cycloalkyi, heterocycloalkyi, aryl, heteroaryl, -Ra-Rb, -Ra-ORb, -Ra-ORd, -Ra-ORa-ORb, -Ra-ORa-ORd, -Ra-SR , -Ra-SRa-SRb, -Ra-NR Rb, -Ra-haiogen, -Ra-(C1-5 haloalkyl), -Ra-CN, -Ra-CO-R , -Ra-CO-O-Rb, -Ra-O-CO-Rb, -Ra-CO-NRbRb, -Ra-NRb-CO-Rb, -Ra-SO2-NRbRb and -Ra-NRb-SO2-Rb; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyi, said heterocycloalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups Rc; R4, R5 and R6 are independently selected from hydrogen, C1-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, heteroalkyl, cycloalkyi, heterocycloalkyi, aryl, heteroaryl, -Ra-Rb, -Ra-ORb, -Ra-ORd, -Ra-ORa-ORb, -Ra-ORa-ORd, -Ra-SRb, -Ra-SRa-SRb, -Ra-NRbR , -Ra-halogen, -Ra-(C1-5 haloalkyl), -Ra-CN, -Ra-CO-Rb, -Ra-CO-O-R , -Ra-O-CO-R , -Ra-CO-NR Rb, -Ra-NR -CO-Rb, -Ra-SO2-NRbRb and -Ra-NRb-SO2-R ; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyi, said heterocycloalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups Rc; or alternatively, R4 is selected from hydrogen, C-i-5 alkyl, C2-s alkenyl, C2-5 alkynyl, heteroalkyl, cycloalkyi, heterocycloalkyi, aryl, heteroaryl, -Ra-R , -Ra-ORb, -Ra-ORd, -Ra-ORa-ORb, -Ra-ORa-ORd, -Ra-SRb, -Ra-SRa-SRb, -Ra-NRbRb, -Ra-halogen, -Ra-(C1-5 haioalkyl), -Ra-CN, -Ra-CO-Rb, -Ra-CO-0-Rb, -Ra-0-CO-Rb, -Ra-CO-NRbRb, -Ra-NRb-CO-Rb, -Ra-S02-NRbRb and -Ra-NRb-S02-Rb; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyi, said cycloalkyl, said heterocycloalkyi, said aryi and said heteroaryi are each optionally substituted with one or more groups Rc; and R5 and R6 are joined together to form, together with the carbon atoms that they are attached to, a carbocyclic or heterocyclic ring being optionally substituted with one or more substituents Rc; or alternatively, R4 and R5 are joined together to form, together with the carbon atoms that they are attached to, a carbocyclic or heterocyclic ring being optionally substituted with one or more substituents Rc; and R6 is selected from hydrogen, Ci-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, heteroalkyi, cycloalkyl, heterocycloalkyi, aryi, heteroaryi, -Ra-Rb, -Ra-ORb, -Ra-ORd, -Ra-ORa-ORb, -Ra-ORa-ORd, -Ra-SRb, -Ra-SRa-SRb, -Ra-NRbRb, -Ra-halogen, -Ra-(Ci-5 haioalkyl), -Ra-CN, -Ra-CO-Rb, -Ra-CO-0-Rb, -Ra-0-CO-Rb, -Ra-CO-NRbRb, -Ra-NRb-CO-Rb, -Ra-S02-NRbRb and -Ra-NRb-S02-Rb; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyi, said cycloalkyl, said heterocycloalkyi, said aryi and said heteroaryi are each optionally substituted with one or more groups Rc; each Ra is independently selected from a single bond, Ci-5 alkylene, C2-5 alkenylene, arylene and heteroarylene; wherein said alkylene, said alkenylene, said aryiene and said heteroarylene are each optionally substituted with one or more groups Rc; each Rb is independently selected from hydrogen, Ci-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, heteroalkyi, cycloalkyl, heterocycloalkyi, aryi and heteroaryi; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyi, said cycloalkyl, said heterocycloalkyi, said aryi and said heteroaryi are each optionally substituted with one or more groups Rc; each Rc is independently selected from Ci-5 alkyl, C2-5 alkenyl, C2-5 alkynyl, -(C0-3 alkylene)-OH, -(C0-3 alkylene)-0-Rd, -(C0-3 alkylene)-0(C -5 alkyl), -(C0-3 alkylene)-0- aryl, -(C0.3 alkylene)-0(Ci-5 alkylene)-OH, -(C0-3 alkylene)-0(Ci-5 alkylene)-0-Rd, -(Co-3 alkylene)-0(Ci-5 alkylene)-0(C -5 alkyl), -(C0-3 alkylene)-SH, -(C0.3 alkylene>S(Ci.5 alkyl), -(C0-3 aikylene)-S-aryl, -(C0-3 alkylene)-S(C1-5 alkylene)-SH, -(Co-3 alkylene)-S(Ci-5 alkylene)-S(Ci-5 alkyl), -(C0-3 alkylene)-NH2, -(C0-3 aikylene)-NH(C1-5 alkyl), -{C0-3 alkyiene)-N(C1-5 alkyl)(C1-5 alkyl), -(C0-3 alkylene)-halogen, -(C0-3 alkylene)-(Ci-5 haloaikyi), -{C0-3 alkyIene)-CN, -(C0-3 alkylene)-CHO, -(C0-3 alkylene)-CO-(C1-5 alkyl), -{C0-3 alkylene)-COOH, -(C0.3 alkylene)-CO-0-(Ci-5 alkyl), -(C0-3 alkylene)-0-CO-(C1-5 alkyl), -(C0.3 alkylene)-CO-NH2, -(C0-3 alkylene)-CO-NH(C1-5 alkyl), -(C0-3 alkylene)-CO-N(C1-5 alkyl)(Ci-5 alkyl), -(C0-3 alkylene)-NH-CO-(C1-5 alkyl), -(C0-3 alkylene)-N(Ci-5 alkyl)-CO-(Ci-5 alkyl), -(C0-3 alkylene)-S02-NH2, -(C0-3 alkylene)-S02-NH(Ci-5 alkyl), -(C0-3 alkylene)-S02-N(C1-5 alkyl)(C1-5 alkyl), -(C0-3 alkylene)-NH-S02-(C1.5 alkyl), and -(C0-3 alkylene)-N(C1-5 aIkyl)-S02-(Ci-5 alkyl); wherein said alkyl, said aikenyl, said alkynyi and the alkyl or alkylene moieties comprised in any of the aforementioned groups Rc are each optionally substituted with one or more groups independently selected from halogen, -CF3, -CN, -OH, -O- Rd, -O-C1-4 alkyl and -S-C -4 alkyl; each Rd is independently selected from a monosaccharide, a disaccharide and an oligosaccharide; and R3 is rhamnoslyated by said method. 2. The method of claim 1 , wherein the flavonoid is contacted/incubated with said glycosyl transferase at a final concentration above its solubility in aqueous solutions, preferably above about 200 μΜ, more preferably above about 500 μΜ, and even more preferably above about 1 mM. 3. The method of claims 1 or 2, wherein the method further comprises a step of providing a host cell transformed with said glycosyl transferase. 4. The method of claim 3, wherein said host cell is incubated prior to contacting/incubating said host cell with a flavonoid. 5. The method of claims 3 or 4, wherein said host cell is Escherichia coli. 6. The method of any one of claims 1 to 5, wherein contacting and/or incubating is/are done at a temperature from about 20° C to about 37°C, preferably at a temperature from about 24 °C to about 30°C, and more preferably at a temperature of about 28°C. 7. The method of any one of claims 1 to 6, wherein contacting/incubating is/are done at a pH of about 6.5 to about 8.5, preferably at a pH of about 7 to about 8, and more preferably at a pH of about 7.4. 8. The method of any one of claims 1 to 7, wherein contacting/incubating is/are done at a concentration of dissolved oxygen (DO) of about 30% to about 50%. 9. The method of any one of claims 1 to 8, wherein, when the concentration of dissolved oxygen is above about 50%, a nutrient is added, preferably wherein the nutrient is glucose, sucrose, maltose or glycerol. 10. The method of any one of claims 1 to 9, wherein contacting/incubating is/are done in a complex nutrient medium. 1 1 . The method of any one of claims 1 to 9, wherein contacting/incubating is/are done in minimal medium. 12. The method of any one of claims 3 to 1 1 , wherein the method further comprises a step of harvesting said incubated host cell prior to contacting/incubating said host cell with a flavonoid. 13. The method of claim 12, wherein harvesting is done using a membrane filtration method, preferably a hollow fibre membrane device, or centrifugation. 14. The method of claim 12 or 13, wherein the method further comprises solubilization of the harvested host cell in a buffer prior to contacting/incubating said host cell with a flavonoid, preferably wherein the buffer is phosphate-buffered saline (PBS), preferably supplemented with a carbon and energy source, preferably glycerol, glucose, maltose, and/or sucrose, and growth additives, preferably vitamins including biotin and/or thiamin. 15. The method of any one of claims 1 to 14, wherein the flavonoid is a flavanone, flavone, isoflavone, flavonol, flavanonol, chalcone, flavanol, anthocyanidine, aurone, flavan, chromene, chromone or xanthone. 16. The method of any one of claims 1 to 15, wherein rhamnosylating is the addition of -O-(rhamnosyl) at position R3 of Formula (I) of claim 1 , wherein said rhamnosyl is substituted at one or more of its -OH groups with one or more groups independently selected from C1-5 alkyl, C-2-5 alkenyl, C2-5 alkynyl, a monosaccharide, a disaccharide and an oligosaccharide. |
The present invention relates to methods for the production of rhamnosylated flavonoids comprising the steps of contacting/incubating a glycosyl transferase with a flavonoid and obtaining a rhamnosylated flavonoid. In addition, the invention relates to glycosyl transferases suitable for use in such methods and kits comprising said glycosyl transferases.
Flavonoids are a class of polyphenol compounds which are commonly found in a large variety of plants. Flavonoids comprise a subclass of compounds such as anthoxanthins, flavanones, flavanonols, flavans and anthocyanidins. Flavonoids are known to possess a multitude of beneficial properties which make these compounds suitable for use as antioxidants, anti-inflammatory agents, anti-cancer agents, antibacterials, antivirals, antifungals, antiallergenes, and agents for preventing or treating cardiovascular diseases. Furthermore, some flavonoids have been reported to be useful as flavor enhancing or modulating agents.
Due to this wide variety of possible applications, flavonoids are compounds of high importance as ingredients in cosmetics, food, drinks, nutritional and dietary supplements, pharmaceuticals and animal feed. However, use of these compounds has often been limited due to the low water solubility, low stability and limited availability. A further factor which has severely limited use of these compounds is the fact that only a few flavonoids occur in significant amounts in nature while the abundance of other flavonoids is nearly negligible. As a result, many flavonoids and their derivatives are not available in amounts necessary for large-scale industrial use.
Glycosylation is one of the most abundant modifications of flavonoids, which has been reported to significantly modulate the properties of these compounds. For example, glycosylation may lead to higher solubility and increased stability, such as higher stability against radiation or temperature. Furthermore, glycosylation may modulate pharmacological activity and bioavailability of these compounds.
Glycosylated derivatives of flavonoids occur in nature as O-glycosides or C-glycosides, while the latter are much less abundant. Such derivatives may be formed by the action of glycosyl transferases (GTs) starting from the corresponding aglycones.
Examples of naturally occurring O-glycosides are quercetin-3-0- -D-glucoside (Isoquercitrin) and genistein-7-0- -glucoside (Genistin). However, f!avonoids constitute the biggest class of polyphenols in nature (Ververidis (2007) Biotech. J. 2(10):1214-1234). The high variety of flavonoids originates from addition of various functional groups to the ring structure. Herein, glycosylation is the most abundant form and the diversity of sugar moieties even more leads to a plethora of glycones.
But in nature only some flavonoid glycones prevail. As described above, among these are the 3-0- β-D-glucosides, e.g. isoquercitrin, the flavonoid-7-P-D-glucosides, e.g. genistin, and the 3- and 7- rhamnoglucosides, e.g. rutin and naringin. Generally, glucosides are the most frequent glycosidic forms with 3- and 7-0-p-D-glucosides dominating. In contrast, glycosides concerning other sugar moieties, e.g. rhamnose, and other glycosylation positions than C3 and C7 rarely occur and are only present in scarce quantities in specific plant organs. This prevents any industrial uses of such compounds. For example, De Bruyn (2015) Microb Ceil Fact 14:138 describes methods for producing rhamnosyiated flavonoids at the 3-0 position. Also, 3-0 rhamnosylated versions of naringenin and quercetin are described by Ohashi (2016) Appl Microbiol Biotechnol 100:687-696. Metabolic engineering of the 3-0 rhamnoside pathway in E. coli with kaempferol as an example is described by Yang (2014) J Ind Microbiol Biotech 41 :131 1-18. Finally, the in vitro production of 3-0 rhamnosylated quercetin and kaempferol is described by Jones (2003) J Biol Chem 278:43910-18. None of these documents describes or suggests the production of 5-0 rhamnosylated flavonoids.
In fact, very few examples of 5-0 rhamnosylated flavonoids are known in the art. The few examples are quercetin-5-0-P-D-glucoside, luteolin-5-O-glucoside, and chrysin-5-0^-D-xyloside (Hedin (1990) J Agric Food Chem 38(8): 1755-7; Hirayama (2008) Phytochemistry 69(5):1141- 1 149; Jung (2012) Food Chem Toxicol 50(6):2171-2179; Chauhan (1984) Phytochemistry 23(10):2404-2405). Up to now, only four flavonoid-5-0-rhamnosides were described. Taxifolin-3,5- di-O-a-L-rhamnoside was extracted from the Indian plant Cordia obliqua which also contains low amounts of Hesperetin-7-O-a-L-rhamnoside (Chauhan (1978) Phytochemistry 17:334; Srivastava (1979) Phytochemistry 18:2058-2059). Eriodictyol-5-rhamnoside was isolated from Cleome viscose (Srivastava (1979) Indian J Chem Sect B 18:86-87). Another flavanone, Naringenin-5-O-ct-L- rhamnoside (N5R) was isolated from Himalayan cherry (Prunus cerasoides) seeds (Shrivastava (1982) Indian J Chem Sect B 21 (6):406-407). Extraction from 2 kg of air dried powdered seeds resulted in 800 mg N5R. The absolute rare occurrence inhibits the commercial use also of other flavanone rhamnosides like naringenin-4'-0-a-L-rhamnoside that was isolated from the stem of a tropical Fabaceae plant (Yadava (1997) J Indian Chem Soc 74{5):426-427).
WO 2014/191524 relates to enzymes catalyzing the glycosylation of polyphenols, in particular flavonoids, benzoic acid derivatives, stilbenoids, chalconoids, chromones, and coumarin derivatives. In addition, WO 2014/191524 discloses methods for preparing a glycoside of polyphenols. However, glycosylation is limited to C3, C3', C4' and C7 of polyphenols. Moreover, the disclosure is silent with regard to the possibility of rhamnosylating polyphenols.
Accordingly, there is an urgent need for reliable methods for the large-scale production of 5-0 rhamnosylated fiavonoids to allow commercial use.
Thus, the technical problem underlying the present invention is the provision of reliable means and methods for efficient rhamnosylation of fiavonoids at C5, corresponding to the R 3 position of Formula I.
The technical problem is soived by provision of the embodiments characterized in the claims.
Accordingly, the present invention relates to methods for the production of rhamnosylated fiavonoids comprising contacting/incubating a giycosyl transferase with a flavonoid and obtaining a rhamnosylated flavonoid. In this regard, it has been surprisingly and unexpectedly found that giycosyl transferases are able to rhamnosylate fiavonoids at the C5-0H, i.e. R 3 position, in particular where the flavonoid is represented by the following formula (I):
In contrast to what could have been expected based on the prior art, giycosyl transferases are able to rhamnosylate compounds of formula I at the R 3 position, corresponding to C5 of polyphenols as described in WO 2014/191524. Accordingly, as illustrated in the appended Examples, the methods of the present invention allow the production of 5-0 rhamnosides, in particular at large-scale to allow the commercial use of the produced 5-0 rhamnosides. In this regard, it was surprisingly found that most efficient production of rhamnosylated fiavonoids can be observed in experiments using concentrations of the reactant, i.e. the flavonoid, above its solubility in aqueous solutions. That is, the present invention relates to methods for the production of rhamnosylated fiavonoids comprising contacting/incubating a giycosyl transferase with a flavonoid, wherein the flavonoid is contacted/incubated with said giycosyl transferase at a final concentration above its solubility in aqueous solutions, preferably above about 200 μΜ, more preferably above about 500 μΜ, and even more preferably above about 1 mM, and subsequently obtaining a rhamnosylated flavonoid. The skilled person will appreciate that the solubility varies depending on the flavonoid used as educt in the methods of the present invention. Thus, the above values can be altered depending on the used flavonoid.
In the methods of the present invention, a glycosyl transferase is used for efficient production of 5- O rhamnosylated flavonoids. In principle, any glycosyltransferase may be used, as is evidenced by the appended Examples; see e.g. Example A3, in particular Tables A7 and A8. However, it is preferred that a glycosyl transferase belonging to family GT1 is used. In this regard, the glycosyl transferases GTC, GTD, GTF, and GTS belong to the glycosyltransferase family GT1 (EC 2.4.1.x) (Coutinho (2003) J Mol Biol 328(2):307-317). This family comprises enzymes that mediate sugar transfer to small lipophilic acceptors. Family GT1 members uniquely possess a GT-B fold. They catalyze an inverting reaction mechanism concerning the giycosidic linkage in the sugar donor and the formed one in the acceptor conjugate, creating natural β-D- or a-L-glycosides.
Within the GT-B fold the enzymes form two major domains, one N-terminal and a C-terminal, with a Iinker region in between. Generally, the N-terminus constitutes the AA-residues responsible for acceptor binding and the residues determining donor binding are mainly located in the C-terminus. In family GT1 the C-terminus contains a highly conserved motif possessing the AA residues that take part in nucleoside-diphosphate (NDP)-sugar binding. This motif was also termed the plant secondary product glycosyltransferase (PSPG) box (Hughes (1994) Mit DNA 5(1 ):41-49.
Flavonoid-GTs belong to family GT1. Due to the natural biosynthesis of flavonoids in plants most of the enzymes are also known from plants. However, several enzymes from the other eukaryotic kingdoms fungi and animals and also from the domain of bacteria are described, in eucarya, sugar donors of GT1 enzymes are generally uridinyl-diphosphate (UDP)-activated. Of these so called UGTs or UDPGTs, most enzymes transfer glucose residues from UDP-glucose to the flavonoid acceptors. Other biological relevant sugars from UDP-galactose, -rhamnose, -xylose, -arabinose, and -glucuronic acid are less often transferred.
Also several bacterial GT1 s were discovered that are able to glycosylate also flavonoid acceptors. These enzymes all belong to the GT1 subfamily of antibiotic macrolide GTs (MGT). In bacteria GT1 enzymes use UDP-glucose or -galactose but also deoxythymidinyl-diphosphate (oTDP)- activated sugars as donor substrates. However, all the bacterial flavonoid active GT1 enzymes have UDP-glucose as the native donor. There is only one known exception with the metagenome derived enzyme GtfC that was the first bacterial GT1 reported to transfer rhamnose to flavonoids (Rabausch (2013) Appl Environ Microbiol 79(15):4551 -4563). However, until the present invention was made, it was established that this activity is limited to C3-OH or the C7-OH groups of flavonoids. Transfer to the C3'-OH and the C4'-OH of the flavonoid C-ring was already less commonly observed. Other positions are rarely glycosylated, if at all. Specifically, there are only few examples concerning the glycosylation of the C5-OH group, which is based on the fact that this group is sterically protected if a keto group at C4 is present. Therefore, the only examples relate to anthcyanidins (Janvary (2009) J Agric Food Chem 57(9):3512-3518; Lorenc-Kukala (2005) J Agric Food Chem 53(2):272-281 ; Tohge (2005) The Plant J 42(2):218-235). This class of flavonoids lacks the C4 keto group which facilitates nucleophilic attack. The C5-OH group of (iso)flavones and (iso)flavanones is protected through hydrogen bridges with the neighbored carbonyl group at C4. This was thought to even hinder chemical glycosyiation approaches at C5 of these classes.
Today, there are only three GT1 enzymes characterized that create 5-0-P-D-glucosides of flavones. One is UGT71 G1 from Medicago truncatula which was proven to be not regio-selective and showed a slight side activity in glucosylation of C5-OH on quercetin (He (2006) JBC 281 (45):34441 -7. An exceptional UGT was identified in the silkworm Bombyx mori capable of specifically forming quercetin-5-0- -D-glucoside (Daimon (2010) PNAS 107(25):11471-11476; Xu (2013) Mol Biol Rep 40(5):3631-3639). Finally, a mutated variant of MGT from Streptomyces lividans presented low activity at C5-OH of 5-hydroxyflavone after single AA exchange (Xie (2013) Biochemistry (Mosc) 78(5):536-541 ). However, the wild type MGT did not possess this ability nor did other MGTs.
F!avanoi-5-O-a-D-glucosides were synthesized through transglucosylation activity of hydrolases, i.e. a-amyiases (EC 3.2.1.x) (Noguchi (2008) J Agric Food Chem 56(24):12016-12024; Shimoda (2010) Nutrients 2(2):171-180). However, the flavanols also lack the C4=0-group and the enzymes create a "non-natural" a-D-glucosidic linkage.
It is noteworthy that all so far known 5-O-GTs mediated only glucosylation. The prior art is entirely silent with regard to rhamnosylation of flavonoids, much less using the method of the present invention.
Thus, GTC from Elbe river sediment metagenome, GTD from Dyadobacter fermentans, GTF from Fibrosoma limi, and GTS from Segetibacter koreensis and chimeras 1 , 3, and 4 are the first experimentally proved flavonoid-5-O-rhamnosyltransferases (FRTs). This is evidenced by the appended Examples. In particular, Example A3 provides results for all chimeras in Tables A7 and A8. Further production examples are shown in the further Examples, in particular using GTC. Furthermore, related enzymes from, Flavihumibacter solisilvae, Cesiribacter andamanensis, Niabella aurantiaca, Spirosoma radiotolerans, Fibreila aestuarina, F!avisolibacter sp. LCS9 and Aquimarina macrocephali, present the same functionality as they share important amino acid sequence features. In contrast to all other GT1 enzymes that use NDP-sugars FRTs possess several unique amino acid patterns. Accordingly, the present invention relates to a method for the production of 5-0, i.e. R 3 in formula I, rhamnosylated flavonoids using a glycosyl transferase comprising said conserved amino acids. These conserved amino acid sequences, which were surprisingly and unexpectedly identified by the present inventors, comprise the following motifs (ail amino acid positions are given with respect to the wild-type GTC amino acid sequence): (1 ) strictly conserved amino acids Asp (D 30 ) and aromatic Phe (F 33 ) in the motif 21 K/R ILFAXXPXDGHF N/S PLTX L/l A 40 both located around His 32 , i.e. the active site residue of GT1 enzymes, wherein the amino acid at position 30 is preferably a polar amino acid; (2) the motif 47 GXDVRW Y/F 53 comprising the loop before Νβ2 and strand Νβ2; (3) strictly conserved amino acid Arg (R 88 ) of motif 85 F/Y/L P E/D R 88 where Pro 86 and Glu 87 are reported for substrate binding in GT1 enzymes and neighboring Arg (R 88 ) is unique to Rhamnosyl- GTs; (4) strictly conserved amino acids Phe (F 100 ), Asp (D 101 ), Phe (F 106 ), Arg (R 109 ) and Asp (D 116 ) of the motif 0C FDXXXXFXXRXXE Y/F XXD 16 forming the long N-terminal helix Na3, wherein the amino acids at positions 103 and 108 preferably are non-polar amino acids; (5) the motif 124 F/W PFXXXXX D/E XXFXXXXF 140 comprising the loop before Νβ4, strand Νβ4, and the loop to the downstream N-a-helix, wherein amino acids at positions 128 to 130 are preferably non-polar amino acids; (6) the motif 156 PLXEXXXXL P/A PXGXGXXPXXXXXG K/R 180 comprising conserved amino acid Gly (G 170 ); (7) the motif 230 LQXGXXG FEYXR 241 before the linker region of the N- terminal domain with the C-terminal domain; (8) the motif 281 TQGTXE K/R XXXKXXXPTLEAF R/K 301 comprising the loop before Ca1 and helix Cert and strictly conserved amino acids Thr (T 284 ) and Glu (G 286 ) where Thr is involved in substrate binding and wherein the amino acid at position 285 preferably is a non-polar amino acid and amino acids at positions 292 to 294 preferably are non-polar amino acids; (9) the motif 306 LVXXTTGG 313 forming strand Οβ2, wherein amino acids at positions 308 and 309 preferably are non-polar amino acids; and (10) the motif
330 l E/D DFIPFXX V/l MPXXDV Y/F l/V T/S NGG Y/F GGV M/L LXIX N/H XL XVX AGXH EG KN E 376 comprising conserved acidic amino acids Glu/ As (E/D 331 ), Asp (D 332 ), conserved aromatic amino acid Phe (F 336 ) instead of Gin (Q) in other GT1 enzymes at start of helix Ca2, strictly conserved amino acid Asn (N 349 ) involved in substrate binding, and strictly conserved amino acid Gly (G 369 ) instead of Pro (P) in other GT1 enzymes, wherein the motif forms the conserved donor binding region of GT1 enzymes, wherein the amino acids at positions 367 and 372 preferably are non- polar amino acids and where the 371 HEGKNE 376 motif is absolutely unique to the 5-O-FRTs, as GT 1 enzymes usually show a D/E Q/N/K/R motif responsible for hexose sugar binding and catalytic activity.
The following alignment of said 5-O-FRTs illustrates the homologous AAs positions and shows consensus SEQ ID NO:1 (highlighted in grey boxes).
! I
45 55 65 75
GTC HFNPLTGLAV HLQWLGCDVR WYTSNKYADK LRRLNIPHFP GTD HFNPLTGLAK YLQELGCDVR WYASDVFKCK LEKLSIPHYG
GTF HFNPLTGLAV HLHNQGHDVR WYVGGHYGAK VKKLGLIHYP GTS HFNPLTGLAV HLKNIGCDVR WYTSKTYAEK IARLDIPFYG
GT from S . radiotolerans HFSPLTGLAV HLSNLGHDVR WYVGGEYGEK VRKLKLHHYP
GT from N. auran iaca HFNPLTGLAV RLKKAGHDVR WYTGASYAPR IEQLGIPFYL GT from F. solisilvae HFNPLTGIAV HLKQQGYDVR WYGSDVYSKK AAKLGIPYFP GT from F. aestuarina HFSPLTNLAV HLSQLGHDVR WFVGGHYGQK VTQLGLHHYP
GT from C. andamanensis HFNPLIPLAE FLKQQGHDVR WYSSRLYADK ISRMGIPHYP GT from A. macrocephali HFNPMTAIAI HLKTKGYDVR WYTGEGYKNT LHRIGIPYLP
GT from F. sp. LCS9 HFNPLTGLAM HLKQIGCDVR WYTAKKYANK LQQLDIPHYD Chimera 1 HFNPLTGLAK YLQELGCDVR WYASDVFKCK LEKLSIPHYG Chimera 3 HFNPLTGLAK YLQELGCDVR WYASDVFKCK LEKLSIPHYG Chimera 4 HFNPLTGLAK YLQELGCDVR WYASDVFKCK LEKLSIPHYG SEQ ID NO. HFNPLTXtA- GXDVR WY
alternate aa SEQ ID NO.l S I F
I .... I I
125 135 145 155
GTC RGPEYYVDLQ EIHKSFPFDV MVADCAFTGI PFVTDKMDIP GTD RAPEYYEDI L EIHESFPFDV FIADSCFSAI PLVSKLMSIP GIF RAPEFITDVT AIHKSFPFDL LICDTMFSAA PMLRHILNVP GTS RSTEYYEDIL EIYEEFPFQL MIADITFGAI PFVEEKMNIP
GT from S. radiotolerans RAPE VEDMK DIYQTWPFTL VVHDVAFIGG SFIKQLLPVK GT from N. aurantiaca RGTEFYEDIK DINKSFDFDV LICDSAFTGM SFVKEKLNKH GT from F. solisilvae RAPEYYADLI DIHREFPFDL LIADCMFTAI PFVKELMQIP GT from F. aestuarina RVPEQIDDLR AIYDEWPFDL IVQDLGFVGG TFLRELLPVK GT from C. andamanensis iRGPEYFEDIR DLHQEFPFDV LVAEISFTGI AFIRHLMHKP
GT from A. macrocephali RMKGYYEDIA EIHQVFPFDI LVCDNTFPGS -IVKKKLNI
GT from F. sp. LCS9 RGPEFYDDIK EIHQTFPFEV MIADVAFTGT PMVKEKMNIP Chimera 1 RAPEYYEDIL EIHESFPFDV FIADSCFSAI PLVSKLMSIP Chimera 3 RAPEYYEDTL EIHESFPFDV FIADSCFSAI PLVSKLMSIP Chimera 4 :RAPEYYEDIL EIHESFPFDV FIADSCFSAI PLVSKLMSIP SEQ ID NO. RXXE XXD— FPFXX XF
alternate aa SEQ ID NO.l F E
I
165 175 185 195
GTC VVSVGVFPLT ETSKDLPPAG LGITPSFSLP GKFKQSILRS GTD VVAVGVIPLA EESVDLAPYG TGLPPAATEE QRAMYFGMKD GTF VAAVGIVPLS ETSKELPPAG LGMEPATGFF GRLKQDFLRF GTS VISISVVPLP ETSKDLAPSG LGITPSYSFF GKIKQSFLRF
GT from S. radiotolerans TVAVGVVPL ESDDYLPPSG LGRQPMRGIA GRWIQHLMRY GT from N. aurantiaca AVAIGILPLC ASSKQLPPPI MGLTPAKTLA GKAVHSFLRF GT from F. solisilvae VLSIGIAPLL ESSRDLAPYG LGLHPARSWA GKFRQAGLRW
GT from F. aestuarina VVGVGV PLT ESDDWVPPTS LGMKPQSGRV GRLVSRLLNY GT from C. andamanensis VIAVGIFPNI ASSRDLPPYG LGMRPASGFL GRKKQDLLRF GT from A. macrocephali lASIGVVPLA LSAPDLPLYG IGHQPATTFF GKRKQNFIKL GT from F. sp. LCS9 VITVGILPLP ETSKDLAPYG LAITPNYSFW GKKKQTFLRF
Chimera 1 VVAVGVI LA EESVDLAPYG TGLPPAATEE QRAMYFGMKD Chimera 3 VVAVGVIPLA EESVDLAPYG TGLPPAATEE QRAMYFGMKD Chimera 4 VVAVGVIPL EESVDLAPYG TGLPPAATEE QRAMYFGMKD SEQ ID NO. PLX ESXXXLPPXG XFXXPXXXXX GK
alternate aa SEQ ID NO.l Ά R
205 215 225 235
GTC VADLVLFRES NKVMRKMLTE HGIDHLYTN- VFDLMVKKST
GTD ALANVVFKTA IDSFSAILDR YQVPHEKAI- LFDTLIRQSD GTF MTTRILFKPC DDLYNEIRQR YNMEPARDF- VFDSFIRTAD GTS IADELLFAQP TKVMWGLLAQ HGIDAGKAN- IFDILIQKST
GT from S. radiotolerans MVQQVMFKPI NVLHNQLRQV YGLPPEPDS- VFDSIVRSAD GT from N. aurantiaca LTNKVLFKKP HALINEQYRR AGMLTNGKN- LFDLQIDKAT
GT from F. solisilvae VADNILFRKS INVMYDLFEE YNIPHNGEN- FFDMCVRKAS GT from F. aestuarina LVQDVMLKPA NDLHNELRAQ YGLRPVPGF- IFDATVRQAD GT from C. andamanensis LTDKLVFGKQ NELNRQILRS WGIEAPGHLN LFDLQTQHAS GT from A. macrocephali MADKLIFDET KVVYNQLLRS LDLSEEENLT IFDIAPLQSD GT from F. sp. LCS9 VADQVLFRKP YLVMKEMLAD YGIKP-DGN- LFSTLIRKSS Chimera 1 ALANVVFKTA IDSFSAILDR YQVPHEKAI- LFDTLIRQSD Chimera 3 ALANVVFKTA IDSFSAILDR YQVPHEKAI- LFDTLIRQSD Chimera 4 ALANVVFKTA IDSFSAILDR YQVPHEKAI- LFDTLIRQSD SEQ ID NO. I
245 255 265 275
GTC LLLQSGTPGF EYYRSDLGKN IRFIGSLLPY QSKKQTT GTD LFLQIGAKAF EYDRSDLGEN VRFVGALLPY SESKSRQ GTF LYLQSGVPGF EYKRSKMSAN VRFVGPLLPY SSGIKPN GTS LVLQSGTPGF EYKRSDLSSH VHFIGPLLPY TKKKERE
GT from S. radiotolerans VYLQSGVPSF EYPRKRISAN VQFVGPLLPY AKGQKHP GT from N, aurantiaca IiFLQSCTPGF EYQRAHMSRH IHFIGPLLPS HSDAPAP GT from F, solisilvae LFLQSGTPGF EYNRSDLSEH IRFIGALLPY AGERKEE
GT from F. aestuarina LYLQSGVPGF EFPRKRISPN VRFIGPMLPY SRANRQP GT from C. andamanensis VVLQNGTPGF EYTRSDLSPN LVFAGPLLPL VKKVRED GT from A. macrocephali VFLQNGIPEI DYPRYSLPES IKYVGALQVQ TNNNNNQKLK
GT from F. sp. LCS9 LVLQSGTPGF EYFRSDLGHN IRFAGALLPY TTQKQTT Chimera 1 LFLQIGAKAF EYDRSDLGKN IRFIGSLLPY QSKKQTT Chimera 3 LFLQIGAKAF EYDRSDLGEN VRFVGALLPY SESKSRQ Chimera 4 LFLQIGAKAF EYDRSDLGEN VRFVGALLPY SESKSRQ SEQ ID NO. --LQXGXFGF ETXR
alternate aa SEQ ID NO.l G K D
I I I
285 295 305 315
GTC AWSDERLNRY EKIVVVTQGT VEKNIEKILV PTLEAFR-DT GTD PWFDQKLLQY GRIVLVTQGT VEHDINKILV PTLEAFK-NS GTF FAHAAKLKQY KKVILATQGT VERDPEKILV PTLEAFK-DT
GTS SWYNEKLSHY DKVILVTQGT IEKDIEKLIV PTLEAFK-NS
GT from S radiotolera FIQAKKALQY KKVILVTQGT IERDVQKIIV PTLEAFKNEP GT from N aurantiaca FHFEDKLHQY AKVLLVTQGT FEGDVRKLIV PAIEAFK-NS GT from F solisilvae P FDSRLNKF DRVILVTQGT VERDVTKIIV PVLKAFR-DS GT from aestuarina FEQAIKTLAY KRVVLVTQGT VERNVEKIIV PTLEAYKKDP GT from andamanensi LPLQEKLRKY KNVILVTQGT AEQNTEKILA PTLEAFK-DS GT from macrocephal KDWSAILDTS KKIILVSQGT VEKNLDKLII PSLEAFK-DS GT from sp. LCS9 PWYNKKLEQY DKVILVTQGT VEKDVEKIIV PTLEAFK-DS Chimera AWSDERLNRY EKIVVVTQGT VEKNIEKILV PTLEAFR-DT Chi mera PWFDQKLLQY GRIVLVTQGT VEHDINKILV PTLEAFK-NS Chimera PWFDQKLLQY GQTVVVTQGT VEKNIEKILV PTLEAFR-DT SEQ ID NO TQGT ΧΞΚΧΧΧΚΧΧΧ PTLEAFR
alternate aa SEQ ID NO.l R K
I I
325 335 345 355
GTC DLLVIATTGG SGTAELKKRY PQ- GNI.I TED FIPFGDIMPY GTD ETLVIATTGG NGTAELRARF FF- ■ ENLIIED FIPFDDVMPR GTF DHLVVITTGG SKTAELRARY PQ- • KNVIIED FIDFNLIMPH GTS DCLVI TTGG AYTEELRKRY PE- ■ ENIIIED FIPFDDVMPY
GT from S, radiotolerans TTLVIVTTGG SQTSELRARF PQ- ■ ENFIIDD FIDFNAVMPY GT from N, aurantiaca RHLVVVTTAG WHTHKLRQRY KAFANVVIED FIPFSQIMPF GT from F. solisilvae NYLVVATTGG NGTKLLREQY KA- • DNIIIED FIPFTDIMPY GT from F. aestuarina DTLVIVTTGG SGTLALRKRY PQ- • ANFIIED FIDFNAVMPY GT from C. andamanensis TWLVVATTGG AGTEALRARY PQ- ■ ENFLIED YIPFDQIMPN GT from A. macrocephali DYIVLVATGY TDTKGLQKRY PQ- QHFYIED FIAYDAVMPH GT from F. sp. LCS9 DCLVVVTTGG SRTLELRLRY PQ- NNIIIED FIPFGDVMPY Chimera 1 DLXVIATTGG SGTAELKKRY PQ- GNLIIED FIPFGDIMPY Chimera 3 ETLVIATTGG NGTAELRARF Q- ■ GNLIIED FIPFGDIMPY Chimera 4 DLLVIATTGG SGTAELKKRY Q ■ GNLIIED FIPFGDIMPY SEQ ID NO —LVXXTTGG ' ■ ' IED FIPFXXVMPX alternate aa SEQ ID NO.l .1 365 375 385 395
GTC ADVYITNGGY GGVMLGIENQ LPLWAGIHE GKNEINARIG GTD ADVYVTNGGY GGTLLSIHNQ LPMVAAGVHE GKNEVCSRIG GTF ADVYVTNSGF GGVMLSIQHG LPMVAAGVHE GKNEIAARIG
GTS ADVYVSNGGY GGVLLSIQHQ LPMVVAGVHE GKNEINARVG
GT from S. radiotolerans ASVYVTNGGY GGVMLALQHN LPIVVAGIHE GKNEIAARID
GT from N. aurantiaca ADVFISNGGY GGVMQSISNK LPMVVAGIHE GKNEICARVG GT from F. solisilvae TDVYVTNGGY GGVMLGIENQ LPLVVAGVHE GKNEINARIG GT from F. aestuarina VSVYVTNGGY GGVMLALQHK LPIVAAGVHE GKNEIAARIG GT from C. andamanensis ADVYVSNGGF GGVLQAISHQ LPMVVAGVHE GKNEICARVG GT from A macrocephali IDVFIMNGGY GSALLSIKHG VPMITAGVNE GKNEICSRMD GT from F sp. LCS9 ADVYITNGGY GGVMLGIENQ LPMVVAGVHE GKNEICARVG Chimera 1 ADVYITNGGY GGVMLGIENQ LPLWAGIHE GKNEINARIG Chimera 3 ADVYITNGGY GGVMLGIENQ LPLWAGIHE GKNEINARIG Chimera 4 ADVYITNGGY GGVMLGIENQ LPLWAGIHE GKNEINARIG SEQ ID NO XDVYITNQGY GGVMLXIXNX LPXVXAGXHE GKNEi alternate aa SEQ ID NO .1 FVS F L H
405 415 425 435
GTC YFELGINLKT EWPKPEQMKK AIDEVIGNKK YKENITKLAK
GTD HFGCGINLET ETPTPDQIRE SVHKILSNDI FKKNVFRIST
GTF YFKLGMNLKT ETPTPDQIRT SVETVLTDQT YRRNLARLRT
GTS YFDLGINLKT ERPTVLQLRK SVDAVLQSDS YAKNVKRLGK
GT from S. radiotolerans YCKVGIDLKT ETPSPTRIRH AVETVLTNDM YRQNVRQMGQ
GT from N, aurantiaca YFKTGINMRT EHPKPEKIKT AVNEILSNPL YRKSVERLSK
GT from F, solisilvae YFRLGIDLRN ERPTPEQMRN AIEKVIANGE YRRNVQALAR
GT from F. aestuarina YCQVGVDLRT ETPTPDQIRR AVATILGDET YRRQVRRLSD
GT from C. andamanensis YFKLGLDLKT ETPKPAQIRA AVEQVLQDPQ YRHKVQALSA
GT from A. . macrocephali YSGVGIDLKT EKPRAVTIQN ATERILGTDK YLDTIQKIQQ
GT from F. . sp. LCS9 YFQLGINLKT EQPIPAQIRN SVEEILSNVV YKKNVVKLSK
Chimera 1 YFELGINLKT EWPKPEQMKK AIDEVIGNKK YKENITKLAK
Chimera 3 YFELGINLKT EWPKPEQMKK AIDEVIGNKK YKENITKLAK
Chimera 4 YFELGINLKT EWPKPEQMKK AIDEVIGNKK YKENITKLAK
SEQ ID NO. ,1
445 455 465 475
GTC EFSNYHPNEL CAQYISEVLQ KTGRLYISSK KEEEKIY
GTD HLD-VDANEK SAGHILDLLE ERVVCG
GTF EFAQYDPMAL SERYINELLA KQPRKQHEAV EAI
GTS EFKQYDPNEI CEKYVAQLLE NQISYKEKAN SYQAEVL —
GT from S. radiotolerans EFSQYQPTEL AEQYINALLI QEKSSRLAVV A
GT from N. aurantiaca EFSEYDPLAL CEKFVNALPV LQKP
GT from F. solisilvae EFKTYAPLEL TERFVTELLL SRRHKLVPVN DDALIY
GT from F. aestuarina EFGRYNPNQL AEQYINELLA QSVGEPVAAL S
GT from C. andamanensis EFRQYNPQQL CEHWVQRLTG GRRAAAPAPQ SAGGQLLSLT
GT from A. macrocephali RMNSYNTLDI CEQHISRLIS E
GT from F. sp. LCS9 EFAQYKPNEL CAKYVAQLVQ -QESSSQKVN VAAVEAVLEA
Chimera 1 EFSNYHPNEL CAQYISEVLQ KQAG-FISAV KRKKKRYTKD
Chimera 3 EFSNYHPNEL CAQYISEVLQ KTGRLYISSK KEEEKIY
Chimera 4 EFSNYHPNEL CAQYISEVLQ KTGRLYISSK KEEEKIY
SEQ ID NO. 1 485
GTC
GTD
GTF
GTS
GT from S. radiotolerans
GT from N. aurantiaca
GT from F. solisi Ivae
GT from F. aestuarina
GT from C. andamanensis LN
GT from A. macr ocephali
GT from F. sp. LCS9
Chimera 1 PAANKARKEA
Chimera 3
Chimera 4
SEQ ID NO .1 —
Accordingly, in the methods of the present invention, it is preferred that a glycosyl transferase comprising some or preferably all of the above conserved amino acids/sequence motifs is used as long as the glycosyl transferase maintains its desired function of rhamnosyiating flavonoids at position R3 of formula (I). These amino acids/sequence motifs are comprised in SEQ ID NO:1. Thus, in one preferred embodiment of the present invention, a glycosyl transferase is used, which comprises the amino acid sequence of SEQ ID NO:1 and which shows the desired activity of rhamnosyiating flavonoids at position R3 of Formula (I) as shown above, corresponding to 5-0 rhamnosylation of flavonoids. The invention furthermore relates to a method for rhamnosylation of flavonoids using a glycosyl transferase comprising an amino acid sequence of the known glycosyl transferases GTC, GTD, GTF or related enzymes from Segetibacter koreensis, Flavihumibacter soiisilvae, Cesiribacter andamanensis, Niabeila aurantiaca, Spirosoma radiotolerans, Fibrella aestuarina, or Aquimarina macrocephali. Accordingly, in one embodiment, a glycosyl transferase having the amino acid sequence as shown in any one of SEQ ID NOs: 3, 5, 7, 9, 1 1 , 13, 15, 17, 19, 21 , 23, 25, 56, 58, or 61 is used in the methods of the present invention. In this regard, the skilled person is we 11 -aware that these sequences may be altered without altering the function of the polypeptide. For example, it is known that enzymes such as glycosyl transferases generally possess an active site responsible for the enzymatic activity. Amino acids outside of the active site or even within the active site may be altered while the enzyme in its entirety maintains a similar or identical activity. It is known that enzymatic activity may even be increased by alterations to the amino acid sequence. Therefore, in the methods of the present invention, glycosyl transferases may be used comprising an amino acid sequence having at least 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity with SEQ ID NOs: 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 , 23, 25, 56, 58, or 61 , respectively, as long as the function of rhamnosyiating flavonoids at position R3 of Formula (I) is maintained. Methods how to test this activity are described herein and/or are known to the person skilled in the art. In the methods of the present invention, glycosyl transferases may be used that are encoded by a polynucleotide comprising the nucleic acid sequences encoding the above glycosyl transferases. In particular, a glycosyl transferase encoded by a polynucleotide comprising any of the nucleic acid sequences of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 57, 59, 60, 62, or 63 may be used. As is known in the art, the genetic code is degenerated, which allows alterations to the sequence of nucleic acids comprised in a polynucleotide without altering the polypeptide encoded by the polynucleotide. Accordingly, in the methods of the present invention, glycosyl transferases may be used that are encoded by a polynucleotide having at least 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99 or 100% sequence identity with SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 57, 59, 60, 62, or 63. Because further alterations to the polynucleotide may be made without altering the structure/function of the encoded polypeptide, glycosyl transferases may be used in the methods of the present invention that are encoded by a polynucleotide hybridizable under stringent conditions with a polynucleotide comprising SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 27, 28, 29, 30, 31 , 32, 33, 34, 35, 36, 37, 38, 57, 59, 60, 62, or 63.
Within the meaning of the present invention, the term "polypeptide" or "enzyme" refers to amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain modified amino acids other than the 20 gene-encoded amino acids. The polypeptides may be modified by either natural processes, such as post-translational processing, or by chemical modification techniques which are weli known in the art. Modifications can occur anywhere in the polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyi termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also a given polypeptide may have many types of modifications. Modifications can include, but are not limited to, acetylation, acylation, ADP- ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of a phosphytidylinositol, cross-linking cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristolyation, oxidation, pergylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, and/or transfer-RNA mediated addition of amino acids to protein such as arginylation. (See Proteins— Structure and Molecular Properties 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993); Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, pp. 1-12 (1983)). While the glycosyl transferase used in the methods of the present invention may be contacted/incubated with a flavonoid directly, it is preferred that the method further comprises a step of providing a host cell transformed with a gene encoding said glycosyl transferase. As such, the glycosyl transferase is recombinantly expressed by the host cell and provided by the host cell for being contacted/incubated with the flavonoid. It is preferred that the host cell is incubated prior to contacting/incubating said host cell with a flavonoid. That is, it is preferred that the host ceil is allowed to recombinantly express the glycosyl transferase prior to addition of a flavonoid for production of a rhamnosylated version thereof.
The type of host cell is not particularly limited. In principle, any cell may be used as host cell to recombinantly express a glycosyl transferase. For example, the organism may be used from which the glycosyl transferase gene is derived. However, it is preferred in the methods of the present invention that the host cell is a prokaryotic host cell.
As used herein, "prokaryote" and "prokaryotic host cell" refer to cells which do not contain a nucleus and whose chromosomal material is thus not separated from the cytoplasm. Prokaryotes include, for example, bacteria. Prokaryotic host cells particularly embraced by the present invention include those amenable to genetic manipulation and growth in culture. Exemplary prokaryotes routinely used in recombinant protein expression include, but are not limited to, E. coli, Bacillus licheniformis (van Leen, et al. (1991 ) Bio/Technology 9:47-52), Ralstonia eutropha (Srinivasan, et al. (2002) Appl. Environ. Microbiol. 68:5925-5932), Methylobacterium extorquens (Belanger, et al. (2004) FEMS Microbiol Lett. 231 (2): 197-204), Lactococcus lactis (Oddone, et al. (2009) Plasmid 62(2): 108-18) and Pseudomonas sp . (e.g., P. aerugenosa, P. fluorescens and P. syringae) . Prokaryotic host cells can be obtained from commercial sources (e.g., Clontech, Invitrogen, Stratagene and the like) or repositories such as American Type Culture Collection (Manassas, VA).
In the methods of the present invention, it is preferred that the prokaryotic host cell, in particular the bacterial host cell, is E. coli. The expression of recombinant proteins in E. coli is well-known in the art. Protocols for E. coii-based expression systems are found in Sam brook "Molecular Cloning" Cold Spring Harbor Laboratory Press 2012.
The host ceils of the invention are recombinant in the sense that they have been genetically modified for the purposes of harboring polynucleotides encoding a glycosyi transferase. Generally, this is achieved by isolating nucleic acid molecules encoding the protein or peptide of interest and introducing the isolated nucleic acid molecules into a prokaryotic cell.
Nucleic acid molecules encoding the proteins of interest, i.e. a glycosyl transferase, can be isolated using any conventional method. For example, the nucleic acid molecules encoding the giycosyl transferase may be obtained as restriction fragments or, alternatively, obtained as polymerase chain reaction amplification products. Techniques for isolating nucleic acid molecules encoding proteins such as glycosyl transferases are routinely practiced in the art and discussed in conventional laboratory manuals such as Sambrook and Russell (Molecular Cloning: A Laboratory Manual, 4th Edition, Cold Spring Harbor Laboratory press (2012)) and Ausubel et al. (Short Protocols in Molecular Biology, 52nd edition, Current Protocols (2002)).
To facilitate the expression of proteins (including enzymes) or peptides in the prokaryotic host cell, in particular the glycosyl transferase, the isolated nucleic acid molecules encoding the proteins or peptides of interest are incorporated into one or more expression vectors. Expression vectors compatible with various prokaryotic host cells are well-known and described in the art cited herein. Expression vectors typically contain suitable elements for cioning, transcription and translation of nucleic acids. Such elements include, e.g., in the 5' to 3' direction, a promoter (unidirectional or bidirectional), a multiple cloning site to operatively associate the nucleic acid molecule of interest with the promoter, and, optionally, a termination sequence including a stop signal for RNA polymerase and a polyadenylation signal for polyadenylase. In addition to regulatory control sequences discussed herein, the expression vector can contain additional nucleotide sequences. For example, the expression vector can encode a selectable marker gene to identify host cells that have incorporated the vector. Nucleic acids encoding a selectable marker can be introduced into a host cell on the same vector as that containing the nucleic acid of interest or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e.g., cells that have incorporated the selectable marker gene will survive, while the other cells die). Expression vectors can be obtained from commercial sources or be produced from plasmids routinely used in recombinant protein expression in prokaryotic host cells. Exemplary expression vectors include, but are not limited to pBR322, which is the basic plasmid modified for expression of heterologous DNA in E. coii; RSF1010 (Wood, et al. (1981 ) J. Bacteriol. 14:1448); pET3 (Agilent Technologies); pALEX2 vectors (Dualsystems Biotech AG); and pETIOO (Invitrogen).
The regulatory sequences employed in the expression vector may be dependent upon a number of factors including whether the protein of interest, i.e. the glycosyl transferases, is to be constitutively expressed or expressed under inducible conditions (e.g., by an external stimulus such as IPTG) . In addition, proteins expressed by the prokaryotic host cell may be tagged {e.g., his6-, FLAG- or GST-tagged) to facilitate detection, isolation and/or purification.
Vectors can be introduced into prokaryotic host cells via conventional transformation techniques. Such methods include, but are not limited to, calcium chloride (Cohen, et al. (1972) Proc. Natl. Acad. Sci. USA 69:21 10- 21 14; Hanahan (1983) J. Mol. Biol. 166:557-580; Mandei & Higa (1970) J. Mol. Biol. 53:159-162), electroporation (Shigekawa & Dower (1988) Biotechniques 6:742-751 ), and those described in Sambrook et al. (2012), supra. For a review of laboratory protocols on microbial transformation and expression systems, see Saunders & Saunders (1987) Microbial Genetics Applied to Biotechnology Principles and Techniques of Gene Transfer and Manipulation, Croom Helm, London; Puhler (1993) Genetic Engineering of Microorganisms, Weinheim, NY; Lee, et al. (1999) Metabolic Engineering, Marcel Dekker, NY; Adolph (1996) Microbial Genome Methods, CRC Press, Boca Raton; and Birren & Lai (1996) Nonmammalian Genomic Analysis : A Practical Guide, Academic Press, San Diego.
As an alternative to expression vectors, it is also contemplated that nucleic acids encoding the proteins (including enzymes) and peptides disclosed herein can be introduced by gene targeting or homologous recombination into a particular genomic site of the prokaryotic host cell so that said nucleic acids are stably integrated into the host genome .
Recombinant prokaryotic host cells harboring nucleic acids encoding a glycosyl transferase can be identified by conventional methods such as selectable marker expression, PGR amplification of said nucleic acids, and/or activity assays for detecting the expression of the glycosyl transferase. Once identified, recombinant prokaryotic host cells can be cultured and/or stored according to routine practices.
With regards to culture methods of recombinant host cells, the person skilled in the art is well- aware how to select and optimize suitable methods for efficient culturing of such cells.
As used herein, the terms "culturing" and the like refer to methods and techniques employed to generate and maintain a population of host cells capable of producing a recombinant protein of interest, in particular the glycosyl transferase, as well as the methods and techniques for optimizing the production of the protein of interest, i.e. the glycosyl transferase. For example, once an expression vector has been incorporated into an appropriate host, preferably E. coli, the host can be maintained under conditions suitable for high level expression of the relevant polynucleotide. When using the methods of the present invention, the protein of interest, i.e. the glycosyl transferase, may be secreted into the medium. Where the protein of interest is secreted into the medium, supernatants from such expression systems can be first concentrated using a commercially available protein concentration filter, e.g., an Amicon™ or Millipore Pellicon™ ultrafiltration unit, which can then be subjected to one or more additional purification techniques, including but not limited to affinity chromatography, including protein A affinity chromatography, ion exchange chromatography, such as anion or cation exchange chromatography, and hydrophobic interaction chromatography. Culture media used for various recombinant host cells are well known in the art. Generally, a growth medium or culture medium is a liquid or gel designed to support the growth of microorganisms or cells. There are different types of media for growing different types of cells.
Culture media used to culture recombinant bacterial cells will depend on the identity of the bacteria. Culture media generally comprise inorganic salts and compounds, amino acids, carbohydrates, vitamins and other compounds that are either necessary for the growth of the host cells or improve health or growth or both of the host cells. In particular, culture media typically comprise manganese (Mn 2+ ) and magnesium (Mg 2+ ) ions, which are co-factors for many, but not all, glycosyltransferases. The most common growth/culture media for microorganisms is LB medium (Lysogeny Broth). LB is a nutrient medium.
Nutrient media contain all the elements that most bacteria need for growth and are non-selective, so they are used for the general cultivation and maintenance of bacteria kept in laboratory culture collections.
In this regard, an undefined medium (also known as a basal or complex medium) is a medium that contains: a carbon source such as glucose for bacterial growth, water, various salts needed for bacterial growth, a source of amino acids and nitrogen (e.g., beef, yeast extract). In contrast, a defined medium (also known as chemically defined medium or synthetic medium) is a medium in which all the chemicals used are known and no yeast, animal or plant tissue is present. In the methods of the present invention, either defined or undefined nutrient media may be used. However, it is preferred that lysogeny broth (LB) medium, terrific broth (TB) medium, Rich Medium (RM), Standard I medium or a mixture thereof be used in the methods of the present invention.
Alternatively, minimal media may be used in the methods of the present invention. Minimal media are those that contain the minimum nutrients possible for colony growth, generally without the presence of amino acids. Minimal medium typically contains a carbon source for bacterial growth, which may be a sugar such as glucose, or a less energy-rich source like succinate, various salts, which may vary among bacteria species and growing conditions; these generally provide essential elements such as magnesium, nitrogen, phosphorus, and sulfur to allow the bacteria to synthesize protein and nucleic acid and water. Supplementary minimal media are a type of minimal media that also contains a single selected agent, usually an amino acid or a sugar. This supplementation allows for the culturing of specific lines of auxotrophic recombinants. Accordingly, in one embodiment the methods of the present invention are done in minimal medium. Preferably, the minimal medium is a mineral salt medium (MSM) or M9 medium supplemented with a carbon source and an energy source, preferably wherein said carbon and energy sources are glycerol, glucose, maltose, sucrose, starch and/or molasses. Media used in the methods of the present invention are prepared following methods well-known in the art. In this regard, a method for preparing culture medium generally comprises the preparation of a "base medium". The term "base medium" or broth refers to a partial broth comprising certain basic required components readily recognized by those skilled in the art, and whose detailed composition may be varied while still permitting the growth of the microorganisms to be cultured. Thus in embodiments and without limitation, base medium may comprise salts, buffer, and protein extract, and in embodiments may comprise sodium chloride, monobasic and dibasic sodium phosphate, magnesium sulphate and calcium chloride. In embodiments a liter of core medium may have the general recipe known in the art for the respective medium, but in alternative embodiments core media will or may comprise one or more of water, agar, proteins, amino acids, caesein hydrolysate, salts, lipids, carbohydrates, salts, minerals, and pH buffers and may contain extracts such as meat extract, yeast extract, tryptone, phytone, peptone, and malt extract, and in embodiments medium may be or may comprise luria bertani (LB) medium; low salt LB medium (1 % peptone, 0.5% yeast extract, and 0.5% NaCI), SOB medium (2% peptone, 0.5% Yeast extract, 10 mM NaCI, 2.5 mM KCI, 10 mM MgCI 2 , 10 mM MgS0 4 ), SOC medium (2% peptone, 0.5% Yeast extract, 10 mM NaCI, 2.5 mM KCI, 10 mM MgCI 2 , 10 mM MgS0 4 , 20 mM Glucose), Superbroth (3.2% peptone, 2% yeast extract, and 0.5% NaCI), 2x TY medium (1.6% peptone, 1% yeast extract, and 0.5% NaCI), TerrificBroth (TB) (1.2% peptone, 2.4% yeast extract, 72 mM K2HP04, 17 mM KH2P04, and 0.4% glycerol), LB Miller broth or LB Lennox broth (1% peptone, 0.5% yeast extract, and 1% NaCI). It will be understood that in particular embodiments one or more components may be omitted from the base medium.
In the methods of the present invention, the host cell may be cultured in the medium prior to incubating/contacting the host cell with an agent for inducing expression of the foreign gene, i.e. the glycosyl transferase, and prior to addition of the fiavonoid to be bioconverted. Alternatively, the fiavonoid may be added to the culture together with the host cell, thus, prior to amplifying the number of host cells in the culture medium.
The person skilled in the art will readily understand that the growth of a desired microorganism, in particular E. coli, will be best promoted at selected temperatures suited to the microorganism in question. In particular embodiments culturing may be carried out at about 28° C and the broth to be used may be p re-warmed to this temperature preparatory to inoculation with a sample for testing. However, in the methods of the present invention culturing may be carried out at any temperature suitable for the desired purpose, i.e. the production of a rhamnosylated fiavonoid. However, it is preferred that culturing is done at a temperature between about 20° C and about 37° C. That is, culturing is preferably done at a temperature of about 20° C, about 21 ° C, about 22°C, about 23° C, about 24° C, about 25° C, about 26°C, about 27°C, about 28° C, about 29°C, about 30° C, about 31 ° C, about 32° C, about 33° C, about 34° C, about 35° C, about 36° C or about 37° C. More preferably, culturing may be carried out at a temperature between about 24° C to about 30°C. Most preferably, culturing in the methods of the present invention is done at a temperature of about 28° C.
Similarly, contacting/incubating the cultured host cell with a flavonoid may be done at any temperature suitable for efficient production of a rhamnosylated flavonoid. Preferably, the temperature for culturing the host ceil and the temperature for contacting/incubating the host cell and the giycosyl transferase with a flavonoid are about identical. That is, it is preferred that contacting/incubating the host eel! and the expressed giycosyl transferase with a flavonoid is done at a temperature between about 20° C and about 37° C. Contacting/incubating the host cell and the expressed giycosyl transferase with a flavonoid is preferably done at a temperature of about 20° C, about 21 ° C, about 22°C, about 23° C, about 24° C, about 25° C, about 26°C, about 27°C, about 28° C, about 29°C, about 30° C, about 31 ° C, about 32° C, about 33° C, about 34° C, about 35° C, about 36° C or about 37° C. More preferably, contacting/incubating the host cell and the expressed giycosyl transferase with a flavonoid may be carried out at a temperature between about 24°C to about 30°C. Most preferably, contacting/incubating the host cell and the expressed giycosyl transferase with a flavonoid in the methods of the present invention is done at a temperature of about 28° C.
In the methods of the present invention, the pH of culture medium is generally set at between about 6.5 and about 8.5 and for example in particular embodiments is or is about 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1 , 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1 , 8.2, 8.3, 8.4 or 8.5 or may be in ranges delimited by any two of the foregoing values. Thus, in particular embodiments the pH of culture medium is in ranges with lower limits of about 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, 7.1 , 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1 , 8.2, 8.3, or 8.4 and with upper limits of about 6.6, 6.7, 6.8, 6.9, 7.0, 7.1 , 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1 , 8.2, 8.3, 8.4 or 8.5. In a preferred embodiment the culture medium has a pH between about 7.0 and 8.0. In a more preferred embodiment of the present invention, the medium has a pH of about 7.4. However, it will be understood that a pH outside of the range pH 6.5-8.5 may still be useable in the methods of the present invention, but that the efficiency and selectivity of the culture may be adversely affected.
A culture may be grown for any desired period following inoculation with a recombinant host cell, but it has been found that a 3 hour culture period above 20° C and starting from an optical density (OD) of 0.1 at 600 nm is sufficient to enrich the content of E. coli sufficiently to permit efficient expression of the giycosyl transferase and subsequent contacting/incubating with the flavonoid for successful bioconversion. However, the culture period may be longer or shorter and may be up to or less than 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14 or more hours. Those skilled in the art will readily select a suitable culture period to satisfy particular requirements.
In the methods of the present invention, the culture medium may be further enriched/supplemented. That is, it is preferred that during culturing of the host cell and/or during contacting/incubating the host cell and the expressed glycosyl transferase with a flavonoid, the concentration of dissolved oxygen (DO) is monitored and maintained at a desired value. Preferably, in the methods of the present invention, the concentration of dissolved oxygen (DO) is maintained at about 30% to about 50%. Moreover, when the concentration of dissolved oxygen is above about 50%, a nutrient may be added, preferably wherein the nutrient is glucose, sucrose, maltose or glycerol. That is, the medium may be supplemented/enriched during culturing/contacting/incubating to maintain conditions that allow efficient production of the glycosyl transferase and/or efficient bioconversion of the flavonoid.
In one embodiment, the methods of the present invention may be done as fed-batch culture or semi-batch culture. These terms are used interchangeably to refer to an operational technique in biotechnological processes where one or more nutrients (substrates) are fed (supplied) to the bioreactor during cultivation and in which the product(s) remain in the bioreactor until the end of the run. In some embodiments, ali the nutrients are fed into the bioreactor.
In the methods of the present invention, a step of harvesting the incubated host cell prior to contacting/incubating said host cell with a flavonoid may be added. That is, the methods of the present invention may comprise culturing the host cell in a culture medium until a desired optical density (OD) and harvesting the host cell when the desired OD is reached. The OD may be between about 0.6 and 1.0, preferably about 0.8. Expression of the glycosyl transferase may either be induced prior to harvesting or subsequently to harvesting, for example together with addition of the flavonoid. The culture medium may be changed subsequently to harvesting or the host cell may be resuspended in culture medium used for growth of the host cell. That is, in one embodiment, methods of the present invention further comprise solubilization of the harvested host cell in a buffer prior to contacting/incubating said host cell with a flavonoid, preferably wherein the buffer is phosphate-buffered saline (PBS), preferably supplemented with a carbon and energy source, preferably glycerol, glucose, maltose, and/or sucrose, and growth additives, preferably vitamins including biotin and/or thiamin.
In the methods of the present invention, harvesting may be done using any method suitable for that purpose. It is preferred that harvesting is done using a membrane filtration method, preferably a hollow fibre membrane device, or centrifugation. In the methods of the present invention, the flavonoid to be rhamnosylated is not particularly limited as iong as the flavonoid belongs to the class of flavonoids as known in the art and, as such, is a member of a group of compounds widely distributed in plants, fulfilling many functions. Flavonoids are the most important plant pigments for flower coloration, producing yellow or red/blue pigmentation in petals designed to attract pollinator animals, in higher plants, flavonoids are involved in UV filtration, symbiotic nitrogen fixation and floral pigmentation.
As such, the flavonoid preferably is a flavanone, flavone, isofiavone, flavonol, flavanonol, chaicone, flavanol, anthocyanidine, aurone, flavan, chromene, chromone or xanthone. Within the meaning of the present invention, the latter three are comprised in this class. As such, the term "flavonoid" refers to any compounds failing under the general formula (I) and is thus not limited to compounds which are generally considered flavonoid-type compounds.
It is preferred that the flavonoid used in the methods of the present invention is a compound or a s ing Formula (I)
wherein: is a double bond or a single bond;
R 1 and R 2 are independently selected from hydrogen, C 1-5 alkyi, C 2-5 aikenyl, C 2 -s alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, -R a -R b , -R a -OR b , -R a -OR d , -R a -OR a -OR b , -R a -OR a -OR d -R a -SR b , -R a -SR a -SR , -R a -NR b R , -R a -halogen, -R a -(C 1-5 ha!oalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R a -0-CO-R b , -R a -CO-NR b R b , -R a -NR b -CO-R b , -R a -S0 2 -NR b R b and -R a -NR b -S0 2 -R b ; wherein said alkyl, said aikenyl, said alkynyl, said heteroalkyl, said cycloalkyl, said heterocycloalkyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R c ; wherein R 2 is different from -OH;
or R 1 and R 2 are joined together to form, together with the carbon atom(s) that they are attached to, a carbocyclic or heterocyclic ring being optionally substituted with one or more substituents R e ; wherein each R e is independently selected from C 1-5 alkyl, C 2 . 5 aikenyl, C 2-5 alkynyl, heteroalkyl, cycloalkyi, heterocycioalkyi, aryl, heteroaryl, -R a -R b , -R a -OR b , -R a -OR d , -R a -OR a -OR b , -R a -OR a -OR d . -R a -SR b , -R a -SR a -SR b , -R a -NR b R b , -R a -halogen, -R a -(Ci -5 haloalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R a -0-CO-R b , -R a -CO-NR b R b , -R a -NR b -CO-R b , -R a -S0 2 -NR b R b and -R a -NR b -S0 2 -R ; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyi, said cycloalkyi, said heterocycioalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R c ;
R 4 , R 5 and R 6 are independently selected from hydrogen, C 1 5 alkyl, C 2 . 5 alkenyl, C 2 . 5 alkynyl, heteroalkyi, cycloalkyi, heterocycioalkyi, aryl, heteroaryl, -R a -R , -R a -OR b , -R a -OR d , -R a -OR a -OR b , -R a -OR a -OR d , -R a -SR b , -R a -SR a -SR b , -R a -NR b R b , -R a -halogen, -R a -(C 1-5 haloaikyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R , -R a -0-CO-R b , -R a -CO-NR b R b , -R a -NR b -CO-R , -R a -S0 2 -NR R b and -R a -NR b -S0 2 -R b ; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyi, said cycloalkyi, said heterocycioalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R°; or alternatively, R 4 is selected from hydrogen, C 1-5 alkyi, C 2 . 5 alkenyl, C 2-5 alkynyl, heteroalkyi, cycloalkyi, heterocycioalkyi, aryl, heteroaryl, -R a -R b , -R a -OR b , -R a -OR d , -R a -OR a -OR b , -R a -OR a -OR d , -R a -SR b , -R a -SR a -SR , -R a -NR°R b , -R a -halogen, -R a -(C 1-5 haloalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R , -R a -0-CO-R b , -R a -CO-NR b R b , -R a -NR b -CO-R b , -R a -S0 2 -NR b R b and -R a -NR b -S0 2 -R b ; wherein said alkyl, said alkenyl, said aikynyl, said heteroalkyi, said cycloalkyi, said heterocycioalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R°; and
R 5 and R 6 are joined together to form, together with the carbon atoms that they are attached to, a carbocyciic or heterocyclic ring being optionally substituted with one or more substituents R c ; or alternatively, R 4 and R 5 are joined together to form, together with the carbon atoms that they are attached to, a carbocyciic or heterocyclic ring being optionally substituted with one or more substituents R c ; and
R 6 is selected from hydrogen, C 1-5 alkyi, C 2 5 alkenyl, C 2 . 5 alkynyl, heteroalkyi, cycloalkyi, heterocycioalkyi, aryl, heteroaryl, -R a -R , -R a -OR b , -R a -OR d , -R a -OR a -OR , -R a -OR a -OR d , -R a -SR , -R a -SR a -SR b , -R a -NR R b , -R a -halogen, -R a -(C 1-5 haloalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R a -0-CO-R , -R a -CO-NR b R b , -R a -NR b -CO-R b , -R a -S0 2 -NR b R b and -R a -NR -S0 2 -R b ; wherein said alkyl, said alkenyi, said alkynyl, said heteroalkyi, said cycloalkyi, said heterocycioalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R°; each R a is independently selected from a single bond, C 1-5 alkylene, C 2 . 5 alkenyiene, arylene and heteroarylene; wherein said alkylene, said alkenyiene, said arylene and said heteroarylene are each optionally substituted with one or more groups R c ; each R b is independently selected from hydrogen, C 1-5 alkyl, C 2 . 5 alkenyl, C 2- 5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, aryl and heteroaryl; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyl, said heterocycloalkyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R° ; each R° is independently selected from . 5 alkyl, C 2 5 alkenyl, C 2 - 5 alkynyl, -(C 0 - 3 alkylene)-OH, -(C 0 3 alkylene)-0-R d , -{C 0-3 alkylene)-0(d-5 alkyl), -(C 0 3 alkylene)-0-aryl, -(C 0 - 3 alkylene)-0(d-5 alkylene)-OH, -(C 0 . 3 alkylene)-0(Ci -5 alkylene)-0-R d , -(C 0 . 3 a!kylene)-0(Ci. 5 alkylene)-0(C 1-5 alkyl), -(Co-3 aikylene)-SH, -(C 0-3 alkylene)-S(C 1-5 alkyl), -(C 0 . 3 alkylene)-S-aryl, -(C 0-3 alkyIene)-S(d„ 5 alkylene)-SH, -(C 0 . 3 alkylene)-S(d. 5 alkylene)-S(C 1-5 alkyl), -(C 0-3 alkylene)-NH 2 , -(C 0 . 3 alkyiene)-NH(d. 5 alkyl), -(C 0 . 3 alkylene)-N(d-s alkyl)(d 5 alkyl), -(C 0 . 3 alkylene)-halogen, -(C 0 . 3 alkylene)-(Ci. 5 haloalkyi), -(C 0 . 3 alkylene)-CN, -(C 0-3 alkylene)-CHO, -(C 0-3 alkylene)-CO-(C,. 5 alkyl), -(Co-3 alkylene)-COOH, -(C 0-3 alkylene)-CO-0-(C 1-5 alkyl), -(C 0 . 3 alkylene)-0-CO-(C 1-5 alkyl), -(C 0 . 3 alkyiene)-CO-NH 2 , -(C 0 . 3 alkylene)-CO-NH(C 1-5 alkyl), -(C 0 - 3 alkylene)-CO-N(d. 5 alkyl)(d 5 alkyl), -(Co-3 alkylene)-NH-CO-(d -5 alkyl), -(C 0 . 3 alkylene)-N(d- 5 alkyl)-CO-(C 1-5 alkyl), -(C 0-3 alkylene)-S0 2 -NH 2 , -(C 0 . 3 alkylene)-S0 2 -NH(d-5 alkyl), -(C 0 . 3 alkylene)-S0 2 -N(C,. 5 alkyl )(C 1-5 alkyl), -(Co-3 alkylene)-NH-S0 2 -(Ci.5 alkyl), and -(C 0 . 3 alkylene )-N(d. 5 alkyl )-S0 2 -(d. 5 alkyl); wherein said alkyl, said alkenyl, said alkynyl and the alkyl or alkylene moieties comprised in any of the aforementioned groups R c are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-d -4 alkyl and -S-d. 4 alkyl; each R d is independently selected from a monosaccharide, a disaccharide and an oligosaccharide; and
R 3 is rhamnoslyated by the method of the present invention.
In this regard, rhamnosylating/rhamnosylation preferably is the addition of -O-(rhamnosyl) at position R 3 of Formula (I) as shown above, wherein said rhamnosyl is substituted at one or more of its -OH groups with one or more groups independently selected from C 1-5 alkyl, C 2 . 5 alkenyl, C 2-5 alkynyl, a monosaccharide, a disaccharide and an oligosaccharide. As used herein, the term "hydrocarbon group" refers to a group consisting of carbon atoms and hydrogen atoms. Examples of this group are aikyl, alkenyl, alkynyl, alkylene, carbocyl and aryl. Both monovalent and divalent groups are encompassed.
As used herein, the term "alkyl" refers to a monovalent saturated acyclic (i.e., non-cyclic) hydrocarbon group which may be linear or branched. Accordingly, an "alkyl" group does not comprise any carbon-to-carbon double bond or any carbon-to- carbon triple bond. A "C 1-5 alkyl" denotes an alkyl group having 1 to 5 carbon atoms. Preferred exemplary alkyl groups are methyl, ethyl, propyl (e.g., n-propyl or isopropyl), or butyl (e.g., n-butyl, isobutyi, sec-butyl, or tert-butyl). Unless defined otherwise, the term "alkyl" preferably refers to C -4 alkyl, more preferably to methyl or ethyl, and even more preferably to methyl.
As used herein, the term "alkenyl" refers to a monovalent unsaturated acyclic hydrocarbon group which may be linear or branched and comprises one or more (e.g., one or two) carbon-to-carbon double bonds while it does not comprise any carbon-to-carbon triple bond. The term "C 2 . s alkenyl" denotes an alkenyl group having 2 to 5 carbon atoms. Preferred exemplary alkenyl groups are ethenyl, propenyl (e.g., prop-1-en-1-yl, prop-1-en-2-yi, or prop-2-en-1-yl), butenyl, butadienyl (e.g., buta-1 ,3-dien-1-yl or buta-1 ,3-dien-2-yl), pentenyl, or pentadienyl (e.g., isoprenyl). Unless defined otherwise, the term "alkenyl" preferably refers to C 2 . 4 aikenyl.
As used herein, the term "alkynyl" refers to a monovalent unsaturated acyclic hydrocarbon group which may be linear or branched and comprises one or more (e.g., one or two) carbon-to-carbon triple bonds and optionally one or more carbon-to-carbon double bonds. The term "C 2 - 5 alkynyl" denotes an alkynyl group having 2 to 5 carbon atoms. Preferred exemplary alkynyl groups are ethynyl, propynyl, or butynyl. Unless defined otherwise, the term "alkynyl" preferably refers to C 2 -4 alkynyl.
As used herein, the term "alkylene" refers to an aikanediyi group, i.e. a divalent saturated acyclic hydrocarbon group which may be linear or branched. A "Ci -5 alkylene" denotes an alkylene group having 1 to 5 carbon atoms, and the term "C 0-3 alkylene" indicates that a covalent bond (corresponding to the option "C 0 alkylene") or a C -3 alkylene is present. Preferred exemplary alkylene groups are methylene (-CH 2 -), ethylene (e.g., -CH 2 -CH 2 - or -CH(-CH 3 )-), propylene (e.g., -CH 2 -CH 2 -CH 2 -, -CH(-CH 2 -CH 3 )-, -CH 2 -CH(-CH 3 )-, or -CH(-CH 3 )-CH 2 -), or butyiene (e.g., -CH 2 -CH 2 -CH 2 -CH -). Unless defined otherwise, the term "alkylene" preferably refers to d- 4 alkylene (including, in particular, linear C 1-4 alkylene), more preferably to methylene or ethylene, and even more preferably to methylene. As used herein, the term "carbocycly!" refers to a hydrocarbon ring group, including monocyclic rings as well as bridged ring, spiro ring and/or fused ring systems (which may be composed, e.g., of two or three rings), wherein said ring group may be saturated, partially unsaturated (i.e., unsaturated but not aromatic) or aromatic. Unless defined otherwise, "carbocycly!" preferably refers to aryl, cycloalkyi or cycloalkenyl.
As used herein, the term "heterocyclyl" refers to a ring group, including monocyclic rings as well as bridged ring, spiro ring and/or fused ring systems (which may be composed, e.g., of two or three rings), wherein said ring group comprises one or more (such as, e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) may optionally be oxidized, wherein one or more carbon ring atoms may optionally be oxidized (i.e., to form an oxo group), and further wherein said ring group may be saturated, partially unsaturated (i.e., unsaturated but not aromatic) or aromatic. Unless defined otherwise, "heterocyclyl" preferably refers to heteroaryl, heterocycloalkyl or heterocycloalkenyl.
As used herein, the term "heterocyclic ring" refers to saturated or unsaturated rings containing one or more heteroatoms, preferably selected from oxygen, nitrogen and sulfur. Examples include heteroaryl and heterocycloalkyl as defined herein. Preferred examples contain, 5 or 6 atoms, particular examples, are 1 ,4-dioxane, pyrrole and pyridine.
The term "carbocyclic ring" means saturated or unsaturated carbon rings such as aryi or cycloalkyi, preferably containing 5 or 6 carbon atoms. Examples include aryl and cycloalkyi as defined herein.
As used herein, the term "aryl" refers to an aromatic hydrocarbon ring group, including monocyclic aromatic rings as well as bridged ring and/or fused ring systems containing at least one aromatic ring (e.g., ring systems composed of two or three fused rings, wherein at least one of these fused rings is aromatic; or bridged ring systems composed of two or three rings, wherein at least one of these bridged rings is aromatic). "Aryl" may, e.g., refer to phenyl, naphthyi, dialinyl (i.e., 1 ,2-dihydronaphthyl), tetralinyl (i.e., 1 ,2,3,4-tetrahydronaphthyl), anthracenyl, or phenanthrenyl. Unless defined otherwise, an "aryl" preferably has 6 to 14 ring atoms, more preferably 6 to 10 ring atoms, and most preferably refers to phenyl.
As used herein, the term "heteroaryl" refers to an aromatic ring group, including monocyclic aromatic rings as well as bridged ring and/or fused ring systems containing at least one aromatic ring (e.g., ring systems composed of two or three fused rings, wherein at least one of these fused rings is aromatic; or bridged ring systems composed of two or three rings, wherein at least one of these bridged rings is aromatic), wherein said aromatic ring group comprises one or more (such as, e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) may optionally be oxidized, and further wherein one or more carbon ring atoms may optionally be oxidized (i.e., to form an oxo group). "Heteroaryl" may, e.g., refer to thienyl (i.e., thiophenyl), benzo[b]thienyl, naphtho[2,3-b]thienyi, thianthrenyl, fury I (i.e., furanyl), benzofuranyl, isobenzofuranyl, chromenyl, xanthenyl, phenoxathiinyl, pyrrolyl (e.g., 2H-pyrrolyl), imidazolyl, pyrazolyl, pyridyl (i.e., pyridinyl; e.g., 2-pyridyl, 3-pyridyl, or 4-pyridyl), pyrazinyl, pyrimidinyl, pyridazinyl, indolizinyl, isoindolyl, indolyl (e.g., 3H-indolyl), indazolyl, purinyl, isoquinolyl, quinolyl, phthalazinyl, naphthyridinyl, quinoxalinyl, cinnolinyi, pteridinyl, carbazolyl, beta-carbolinyl, phenanthridinyl, acridinyl, perimidinyl, phenanthroiinyi (e.g., [1 ,10]phenanthrolinyl, [1 ,7]phenanthrolinyi, or [4,7]phenanthrolinyl), phenazinyl, thiazolyl, isothiazolyl, phenothiazinyl, oxazolyi, isoxazolyl, furazanyl, phenoxazinyl, pyrazolo[1 ,5-a]pyrimidinyl (e.g., pyrazolo[1 ,5-a]pyrimidin-3-yl), 1 ,2-benzoisoxazol-3-yl, benzothiazolyl, benzoxazolyl, benzisoxazolyl, benzimidazolyl, 1H-tetrazolyl, 2H-tetrazolyl, coumarinyl, or chromonyl. Unless defined otherwise, a "heteroaryl" preferably refers to a 5 to 14 membered (more preferably 5 to 10 membered) monocyclic ring or fused ring system comprising one or more (e.g., one, two, three or four) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized; even more preferably, a "heteroaryl" refers to a 5 or 6 membered monocyclic ring comprising one or more (e.g., one, two or three) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized.
The term "heteroalkyl" refers to saturated linear or branched-chain monovalent hydrocarbon radical of one to twelve carbon atoms, including from one to six carbon atoms and from one to four carbon atoms, wherein at least one of the carbon atoms is replaced with a heteroatom selected from N, O, or S, and wherein the radical may be a carbon radical or heteroatom radical (i.e., the heteroatom may appear in the middle or at the end of the radical). The heteroalkyl radical may be optionally substituted independently with one or more substituents described herein. The term "heteroalkyl" encompasses alkoxy and heteroalkoxy radicals.
As used herein, the term "cycloalkyl" refers to a saturated hydrocarbon ring group, including monocyclic rings as well as bridged ring, spiro ring and/or fused ring systems (which may be composed, e.g., of two or three rings; such as, e.g., a fused ring system composed of two or three fused rings). "Cycloalkyl" may, e.g., refer to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycioheptyl, or adamantyl. Unless defined otherwise, "cycloalkyl" preferably refers to a C 3 .n cycloalkyl, and more preferably refers to a C 3 . 7 cycloalkyl. A particularly preferred "cycloalkyl" is a monocyclic saturated hydrocarbon ring having 3 to 7 ring members.
As used herein, the term "heterocycloa!kyi" refers to a saturated ring group, including monocyclic rings as well as bridged ring, spiro ring and/or fused ring systems (which may be composed, e.g., of two or three rings; such as, e.g., a fused ring system composed of two or three fused rings), wherein said ring group contains one or more (such as, e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, and the remaining ring atoms are carbon atoms, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) may optionally be oxidized, and further wherein one or more carbon ring atoms may optionally be oxidized (i.e., to form an oxo group). "Heterocycloalkyl" may, e.g., refer to oxetanyl, tetrahydrofuranyl, piperidinyl, piperazinyl, aziridinyl, azetidinyl, pyrrolidinyl, imidazolidinyl, morpholinyl (e.g., morpholin-4-yl), pyrazolidinyl, tetrahydrothienyl, octahydroquinolinyl, octahydroisoquinolinyl, oxazo!idinyi, isoxazolidinyl, azepanyl, diazepanyl, oxazepanyl or 2-oxa-5-aza-bicyclo[2.2.1]hept-5-yl. Unless defined otherwise, "heterocycloalkyl" preferably refers to a 3 to 11 membered saturated ring group, which is a monocyclic ring or a fused ring system (e.g., a fused ring system composed of two fused rings), wherein said ring group contains one or more (e.g., one, two, three, or four) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized; more preferably, "heterocycloalkyl" refers to a 5 to 7 membered saturated monocyclic ring group containing one or more (e.g., one, two, or three) ring heteroatoms independently selected from O, S and N, wherein one or more S ring atoms (if present) and/or one or more N ring atoms (if present) are optionally oxidized, and wherein one or more carbon ring atoms are optionally oxidized.
As used herein, the term "halogen" refers to fluoro (-F), chloro (-CI), bromo (-Br), or iodo (-I).
As used herein, the term "haloalkyl" refers to an a Iky I group substituted with one or more (preferably 1 to 6, more preferably 1 to 3) halogen atoms which are selected independently from fluoro, chloro, bromo and iodo, and are preferably all fluoro atoms. It will be understood that the maximum number of halogen atoms is limited by the number of available attachment sites and, thus, depends on the number of carbon atoms comprised in the alkyl moiety of the haloalkyl group. "Haloalkyl" may, e.g., refer to -CF 3 , -CHF 2 , -CH 2 F, -CF 2 -CH 3 , -CH 2 -CF 3 , -CH 2 -CHF 2 , -CH 2 -CF 2 -CH 3 , -CH 2 -CF 2 -CF 3 , or -CH(CF 3 ) 2 . As used herein, the term "rhamnosyl" refers to a substituted or unsubstituted rhamnose residue which is preferably connected via the C1-OH group of the same.
The term "monosaccharide" as used herein refers to sugars which consist of only a single sugar unit. These include all compounds which are commonly referred to as sugars and includes sugar alcohols and amino sugars. Examples include tetroses, pentoses, hexoses and heptoses, in particular aldotetroses, aldopentoses, aldohexoses and aldoheptoses.
Aldotetroses include erythrose and threose and the ketotetroses include erythrulose.
Aldopentoses include apiose, ribose, arabinose, lyxose, and xylose and the ketopentoses include ribulose and xylulose. The sugar alcohols which originate in pentoses are called pentitols and include arabitol, xylitol, and adonitol. The saccharic acids include xylosaccharic acid, ribosaccharic acid, and arabosaccharic acid.
Aldohexoses include galactose, talose, altrose, allose, glucose, idose, mannose, rhamnose, fucose, olivose, rhodinose, and guiose and the ketohexoses include tagatose, psicose, sorbose, and fructose. The hexitols which are sugar alcohols of hexose include talitol, sorbitol, mannitol, iditol, allodulcitol, and dulcitol. The saccharic acids of hexose include mannosaccharic acid, glucosaccharic acid, idosaccharic acid, talomucic acid, alomucic acid, and mucic acid.
Examples of aidoheptoses are idoheptose, galactoheptose, mannoheptose, glucoheptose, and taloheptose. The ketoheptoses include alloheptulose, mannoheptulose, sedoheptulose, and taloheptulose.
Examples of amino sugars are fucosamine, galactosamine, glucosamine, sialic acid, N- acetyiglucosamine, and N-acetylgalactosamine.
As used herein, the term "disaccharide" refers to a group which consists of two monosaccharide units. Disaccharides may be formed by reacting two monosaccharides in a condensation reaction which involves the elimination of a small molecuie, such as water.
Examples of disaccharides are maltose, isomaltose, lactose, nigerose, sambubiose, sophorose, trehalose, saccharose, rutinose, and neohesperidose.
As used herein, the term "oligosaccharide" refers to a group which consists of three to eight monosaccharide units. Oligosaccharide may be formed by reacting three to eight monosaccharides in a condensation reaction which involves the elimination of a small molecule, such as water. The oligosaccharides may be linear or branched.
Examples are dextrins as maltotriose, maltotetraose, maltopentaose, maltohexaose, maltoheptaose, and maltooctaose, fructo-oligosaccharides as kestose, nystose, fructosylnystose, bifurcose, inuiobiose, inulotriose, and inulotetraose, galacto-oligosaccharides, or mannan- oligosaccharides.
As used herein, the expression "the compound contains at least one OH group in addition to any OH groups in R 3 " indicates that there is at least one OH group in the compound at a position other than residue R 3 . Examples of the OH groups in R 3 are OH groups of the rhamnosyl group or of any substituents thereof. Consequently, for the purpose of determining whether the above expression is fulfilled, the residue R 3 is disregarded and the number of the remaining OH groups in the compound is determined.
As used herein, the expression "an OH group directly linked to a carbon atom being linked to a neighboring carbon or nitrogen atom via a double bond" indicates a group of the following partial structure:
in which Q is N or C which may be further substituted. The double bond between C and Q may be part of a larger aromatic system and may thus be delocalized. Examples of such OH groups include OH groups which are directly attached to aromatic moieties, such as, aryl or heteroaryl groups. One specific example is a phenolic OH group.
As used herein, the term "substituted at one or more of its -OH groups" indicates that a substituent may be attached to one or more of the "-OH" groups in such a manner that the resulting group may be represented by "-O-substituent".
Various groups are referred to as being "optionally substituted" in this specification. Generally, these groups may carry one or more substituents, such as, e.g., one, two, three or four substituents. It will be understood that the maximum number of substituents is limited by the number of attachment sites available on the substituted moiety. Unless defined otherwise, the "optionally substituted" groups referred to in this specification carry preferably not more than two substituents and may, in particular, carry only one substituent. Moreover, uniess defined otherwise, it is preferred that the optional substituents are absent, i.e. that the corresponding groups are unsubstituted.
As used herein, the terms "optional", "optionally" and "may" denote that the indicated feature may be present but can also be absent. Whenever the term "optional", "optionally" or "may" is used, the present invention specifically relates to both possibilities, i.e., that the corresponding feature is present or, alternatively, that the corresponding feature is absent. For example, the expression "X is optionally substituted with Y" (or "X may be substituted with Y") means that X is either substituted with Y or is unsubstituted. Likewise, if a component of a composition is indicated to be "optional", the invention specifically relates to both possibilities, i.e., that the corresponding component is present (contained in the composition) or that the corresponding component is absent from the composition.
When specific positions in the compounds of formula (I) or formula (II) are referred to, the positions are designated as follows:
A skilled person will appreciate that the substituent groups comprised in the compounds of formula (I) may be attached to the remainder of the respective compound via a number of different positions of the corresponding specific substituent group. Unless defined otherwise, the preferred attachment positions for the various specific substituent groups are as illustrated in the examples.
As used herein, the term "about" preferably refers to ±10% of the indicated numerical value, more preferably to ±5% of the indicated numerical value, and in particular to the exact numerical value indicated. Accordingly, it is preferred that a compound of the following formula (I) or a solvate thereof i present invention as starting compound
(I)
Many specific examples of the compound of following formula (I) are disclosed herein, such as, compounds of formulae (II), (lla), (lib), (lie), (lid), (III) and (IV). It is to be understood that, if reference is made to the compound of formula (I), this reference also includes any of the compounds of formulae (II), (lla), (lib), (lie), (lid), (III), (IV) etc.
In the present invention, the sign represents a double bond or a single bond. In some examples, the sign represents a single bond. In other examples, the sign represents a double bond.
is preferred that L be
In preferred compounds of formula (I), R 1 and R 2 are independently selected from hydrogen, C 1-5 alkyl, C 2-5 alkenyl, C 2 . 5 alkynyl, heteroalkyl, cycioalkyl, heterocycloalkyl, aryl, heteroary!, -R a -R b , -R 3 -0R , -R a -OR d , -R a -OR a -OR b , -R a -OR a -OR d -R a -SR b , -R a -SR a -SR , -R a -NR b R b , -R a -halogen, -R a -(C 1-5 haloaikyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R a -0-CO-R , -R a -CO-NR b R b , -R a -NR b -CO-R b , -R a -S0 2 -NR b R b and -R a -NR b -SO 2 -R 0 ; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycioalkyl, said heterocycloalkyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R c ; wherein R 2 is different from -OH. In preferred compounds of formula (I), R 1 is selected from Ci_ 5 alkyl, C 2- 5 alkenyl, C 2-5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyi, aryl, heteroaryl, -R a -R b , -R a -OR b , -R a -OR d , -R a -OR a -OR b , -R a -OR a -OR d , -R a -SR b , -R a -SR a -SR b , -R a -NR b R b , -R a -haiogen, -R a -(C 1-5 haloalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R a -0-CO-R b , -R a -CO-NR b R b , -R a -NR b -CO-R , -R a -S0 2 -NR b R b and -R a -NR b -S0 2 -R b ; wherein said alkyl, said alkenyl, said alkynyi, said heteroalkyl, said cycloalkyl, said heterocycloalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R°. In more preferred compounds of formula (I), R 1 is selected from cycloalkyl, heterocycloalkyi, aryl and heteroaryl; wherein said cycloalkyl, said heterocycloalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R c . In even more preferred compounds of formula (I), R 1 is selected from aryl and heteroaryl; wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R c . In still more preferred compounds of formula (I), R 1 is selected from aryl and heteroaryl; wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R°. In still more preferred compounds of formula (I), R 1 is aryl which is optionally substituted with one or more groups R c . In one compound of formula (I), R 1 is aryl which is optionally substituted with one, two or three groups independently selected from -OH, -0-R d and -O-C 1 -4 alkyl. Still more preferably, R 1 is phenyl, optionally substituted with one, two or three groups independently selected from -OH, -0-R d and -O-d-4 alkyl.
In other preferred compounds of formula (I), R 2 is selected from C 1-5 alkyl, C2-5 alkenyl, C25 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyi, aryl, heteroaryl, -R a -R b , -R a -OR b , -R a -OR d , -R a -OR a -OR b , -R a -OR a -OR d , -R a -SR , -R a -SR a -SR b , -R a -NR R b , -R a -halogen, -R a -(C 1-5 haloalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R s -0-CO-R b , -R a -CO-NR b R , -R a -NR b -CO-R b , -R a -S0 2 -NR b R b and -R a -NR b -S0 2 -R b ; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyl, said heterocycloalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R c , and wherein R 2 is different from -OH. In more preferred compounds of formula (I), R 2 is selected from cycloalkyl, heterocycloalkyi, aryl and heteroaryl; wherein said cycloalkyl, said heterocycloalkyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R c . in even more preferred compounds of formula (I), R 2 is selected from aryl and heteroaryl; wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R°. In still more preferred compounds of formula (I), R 2 is selected from aryl and heteroaryl; wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R c . Still more preferably, R 2 is aryl which is optionally substituted with one or more groups R c . In some compounds of formula (I), R 2 is aryl which is optionally substituted with one, two or three groups independently selected from -OH, -0-R d and -O-d. alkyl. Still more preferably, R 2 is phenyl, optionally substituted with one, two or three groups independently selected from -OH, -0-R d and -0-C 1-4 alkyl. Alternatively, R 1 and R 2 are joined together to form, together with the carbon atom(s) that they are attached to, a carbocyclic or heterocyclic ring being optionally substituted with one or more substituents R e ; wherein each R e is independently selected from C 1-5 alkyl, C 2 . 5 alkenyl, C 2 5 alkynyl, heteroa!kyl, cycloalkyl, heterocycloalkyi, aryl, heteroaryi, -R a -R b , -R a -OR b , -R a -OR d , -R a -OR a -OR b , -R a -OR a -OR d . -R a -SR B , -R a -SR a -SR b , -R a -NR b R b , -R a -halogen, -R a -(Ci. 5 haioalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R 3 -0-CO-R b , -R a -CO-NR b R b , -R a -NR -CO-R b , -R a -S0 2 -NR b R b and -R a -NR b -S0 2 -R b ; wherein said alkyl, said alkenyi, said alkynyl, said heteroalkyl, said cycioalkyi, said heterocycloalkyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R°.
Preferably, each R e is independently selected from C 1-5 alkyl, C 2 . 5 alkenyl, heteroalkyl, heterocycloalkyi, aryl, heteroaryi, -R a -R°, -R a -OR b , -R a -OR d , -R a -OR a -OR and -R a -OR a -OR d ; wherein said alkyl, said alkenyl, said heteroalkyl, said heterocycloalkyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R c . More preferably, each R e is independently selected from C 1-5 a!kyl, C 2-5 alkenyl, heteroalkyl, heterocycloalkyi, aryl, heteroaryi, -R a -OR b and -R a -OR d ; wherein said alkyl, said alkenyi, said heteroalkyl, said heterocycloalkyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R c . Even more preferably, each R e is independently selected from C 1-5 alkyl, C 2 5 alkenyl, heteroalkyl, heterocycloalkyi, -R a -OR b and -R a -OR d ; wherein said alkyl, said alkenyl, said heteroalkyl and said heterocycloalkyi are each optionally substituted with one or more groups R c . Still more preferably, each R e is independently selected from C -5 alkyl, C 2 . 5 alkenyl, heteroalkyl, heterocycloalkyi, -OR b and -OR d ; wherein said alkyl, said alkenyl, said heteroalkyl and said heterocycloalkyi are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN -OH and -0-R d . Still more preferably, each R' is independently selected from -OH, -0-0,-5 alkyl, C 1-5 alkyl, C 2-5 alkenyl, heteroalkyl, heterocycloalkyi and -0R d ; wherein said alkyl, said alkenyl, said heteroalkyl, said heterocycloalkyi and the alkyl in said -0-0 -5 alkyl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN -OH and -0-R d . Still more preferably, each R 6 is independently selected from -OH, -0-R d , C -5 alkyi, C 2 . 5 alkenyl and -O-Ci-s alkyl; wherein said alkyl, said alkenyl, and the alkyl in said -0-C -5 alkyl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN -OH and -0-R d . Most preferably, each R e is independently selected from -OH, -0-R°, -0-C 1-5 alkyl and C 2-5 alkenyl wherein the alkyl in said -0-C 1-5 alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d .
R 4 , R 5 and R 6 can independently be selected from hydrogen, C 1-5 alkyl, C 2-5 alkenyl, C 2-5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyi, aryl, heteroaryi, -R a -R , -R a -0R b , -R a -OR c , -R a -OR a -OR b , -R a -OR a -OR d -R a -SR b , -R a -SR a -SR b , -R a -NR b R b , -R a -halogen, -R a -(C 1-5 haloalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R a -0-CO-R b , -R a -CO-NR b R b , -R a -NR b -CO-R b , -R a -S0 2 -NR b R b and -R a -NR b -S0 2 -R ; wherein said alkyl, said alkenyl, said alkynyi, said heteroaikyi, said cycloalkyl, said heterocycloaikyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R c .
Alternatively, R 4 is selected from hydrogen, C 1-5 alkyl, C 2 . 5 alkenyl, C 2 - 5 alkynyi, heteroaikyi, cycloalkyl, heterocycloaikyi, aryl, heteroaryi, -R a -R b , -R a -OR b , -R a -OR d , -R a -0R 3 -0R b , -R a -OR a -OR d -R a -SR , -R a -SR a -SR b , -R a -NR b R b , -R a -halogen, -R 3 -(C 1 . 5 haloalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R , -R a -0-CO-R b , -R a -CO-NR b R b , -R a -NR b -CO-R b , -R a -S0 2 -NR R and -R a -NR b -S0 2 -R b ; wherein said alkyl, said alkenyl, said alkynyi, said heteroaikyi, said cycloalkyl, said heterocycloaikyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R c ; and R 5 and R 6 are joined together to form, together with the carbon atoms that they are attached to, a carbocyclic or heterocyclic ring being optionally substituted with one or more substituents R c .
In a further alternative, R 4 and R 5 are joined together to form, together with the carbon atoms that they are attached to, a carbocyclic or heterocyclic ring being optionally substituted with one or more substituents R c ; and R 6 is selected from hydrogen, C 1-5 alkyl, C 2 . 5 alkenyl, C 2 . 5 alkynyi, heteroaikyi, cycloalkyl, heterocycloaikyi, aryl, heteroaryi, -R a -R , -R a -OR b , -R a -OR d , -R a -0R 3 -0R b , -R a -OR a -OR d , -R a -SR b , -R a -SR a -SR b , -R a -NR b R b , -R a -halogen, -R a -(d.5 haloalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R a -0-CO-R b , -R a -CO-NR R b , -R a -NR b -CO-R b , -R a -S0 2 -NR b R b and -R a -NR -S0 2 -R ; wherein said alkyl, said alkenyl, said alkynyi, said heteroaikyi, said cycloalkyl, said heterocycloaikyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R c .
R 4 is preferably selected from hydrogen, C 1-5 alkyi, C 2 . 5 alkenyl, heteroaikyi, heterocycloaikyi, aryl, heteroaryi, -R a -R b , -R a -OR b , -R a -OR , -R a -OR a -OR b and -R a -OR a -OR d ; wherein said alkyl, said alkenyl, said heteroaikyi, said heterocycloaikyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R°. More preferably, R 4 is selected from hydrogen, C 1-5 alkyl, C2-5 aikenyl, heteroaikyi, heterocycloaikyi, aryl, heteroaryi, -R a -OR° and -R a -OR d ; wherein said alkyl, said alkenyl, said heteroaikyi, said heterocycloaikyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R c . Even more preferably, R 4 is selected from hydrogen, C 1-5 alkyl, C 2-5 alkenyl, heteroaikyi, heterocycloaikyi, -R a -OR b and -R a -OR d ; wherein said alkyl, said alkenyl, said heteroaikyi and said heterocycloaikyi are each optionally substituted with one or more groups R c . Still more preferably, R 4 is selected from hydrogen, C 1-5 alkyl, C 2 . 5 alkenyl, heteroaikyi, heterocycloaikyi, -OR b and -OR d ; wherein said alkyl, said alkenyl, said heteroaikyi and said heterocycioaikyi are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN -OH and -0-R d . Still more preferably, R 4 is selected from hydrogen, -OH, -0-C 1-5 alkyl, C 1-5 alkyl, C 2 . 5 alkenyl, heteroalkyi, heterocycioaikyi and -OR d ; wherein said alkyl, said alkenyl, said heteroalkyi, said heterocycioaikyi and the alkyl in said -O-C .5 alkyl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN -OH and -0-R d . Still more preferably, R 4 is selected from hydrogen, -OH, -0-R d , Ci -5 alkyl, C 2 . 5 alkenyl and -0-C -5 alkyl; wherein said alkyl, said alkenyl, and the alkyl in said -0-C 1-5 alkyl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN -OH and -0-R d . Most preferably, R 4 is selected from hydrogen, -OH, -0-R d , -0-C 1-5 alkyl and C2-5 alkenyl wherein the alkyl in said -O-C 1 .5 alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R .
R 5 is preferably selected from hydrogen, Ci 5 alkyl, C 2 -s alkenyl, heteroalkyi, heterocycioaikyi, aryl, heteroaryl, -R a -R°, -R a -OR , -R a -OR d , -R a -OR a -OR b and -R a -OR a -OR ; wherein said alkyl, said alkenyl, said heteroalkyi, said heterocycioaikyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R c . More preferably, R 5 is selected from hydrogen, d.5 alkyl, C2-5 alkenyl, heteroalkyi, heterocycioaikyi, aryl, heteroaryl, -R a -OR b and -R a -OR d ; wherein said alkyl, said alkenyl, said heteroalkyi, said heterocycioaikyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R°. Even more preferably, R 5 is selected from hydrogen, C -5 alkyl, C 2-5 alkenyl, heteroalkyi, heterocycioaikyi, -R a -OR b and -R a -OR d ; wherein said alkyl, said alkenyl, said heteroalkyi and said heterocycioaikyi are each optionally substituted with one or more groups R c . Still more preferably, R 5 is selected from hydrogen, C1.5 alkyl, C 2 . 5 alkenyl, -R a -OR b and -R a -OR d ; wherein said alkyl and said alkenyl are each optionally substituted with one or more groups R c . Still more preferably, R 5 is selected from hydrogen, C 1-5 alkyl, C 2 5 alkenyl, -OR" and -OR d ; wherein said alkyl and said alkenyl are each optionally substituted with one or more groups R c . Still more preferably, R 5 is selected from hydrogen, -OH, -0-R d , C 1-5 alkyl, C 2 . 5 alkenyl, -O-C 1 -5 alkyl and -O-aryl; wherein said alkyl, said alkenyl, the alkyl in said -0-C 1-5 alkyl and the aryl in said -O-aryl are each optionally substituted with one or more groups R c ; Most preferably, R 5 is selected from hydrogen, -OH, -0-R d , -0-C -5 alkyl and C2-5 alkenyl, wherein the alkyl in said -0-0 1-5 alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
R 6 is preferably selected from hydrogen, C1 5 alkyl, C 2 . 5 alkenyl, heteroalkyi, heterocycioaikyi, aryl, heteroaryl, -R a -R b , -R a -OR b , -R a -OR d , -R a -OR a -OR b and -R a -OR a -OR d ; wherein said alkyl, said alkenyl, said heteroalkyi, said heterocycioaikyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R c . More preferably, R 6 is selected from hydrogen, C 1-5 alkyl, C2-5 alkenyl, heteroalkyi, heterocycioaikyi, aryl, heteroaryl, -R a -OR b and -R a -OR d ; wherein said alkyl, said alkenyl, said heteroalkyl, said heterocycioaikyi, said aryl and said heteroaryl are each optionally substituted with one or more groups R°. Even more preferably, R 6 is selected from hydrogen, C 1-5 alkyl, C 2 . 5 alkenyl, heteroalkyl, heterocycioaikyi, -R a -OR b and -R a -OR d ; wherein said alkyi, said alkenyl, said heteroalkyl and said heterocycioaikyi are each optionally substituted with one or more groups R c . Still more preferably, R 6 is selected from hydrogen, -OH, C 1-5 alkyi, C 2-5 aikenyl, heterocycioaikyi and -R a -OR d ; wherein said alkyl, said alkenyl and said heterocycioaikyi are each optionally substituted with one or more groups R°. Still more preferably, R 6 is selected from hydrogen, -OH, C 1-5 alkyl, C 2 . 5 alkenyl and -R a -OR d ; wherein said alkyl and said aikenyl and said heterocycioaikyi are each optionally substituted with one or more groups R c . Still more preferably, R 6 is selected from hydrogen, -OH, -0-R d , Ci. 5 alkyl and C 2-5 alkenyl, wherein said alkyl and said alkenyl are each optionally substituted with one or more groups R°. Still more preferably, R 6 is selected from hydrogen, -OH, -0-R d , -C 1-5 alkyl and C 2 . 5 alkenyl, wherein said alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN -OH and -0-R d . Most preferably, R 6 is selected from hydrogen, -OH, -0-R d , -C 1-5 alkyi and C 2 . 5 alkenyl, wherein said alkyl and said alkenyl are each optionaliy substituted with one or more groups independently selected from halogen, -OH and -0-R°;
In all compounds of the present invention, each R 3 is -O-(rhamnosyl), i.e. the residue to be rhamnosylated by the methods of the present invention, wherein said rhamnosyl is optionally substituted at one or more of its -OH groups with one or more groups independently selected from C 1-5 alkyl, C 2 . 5 alkenyl, C 2 . 5 alkynyl, a monosaccharide, a disaccharide and an oligosaccharide. The rhamnosyl group in -O-R 3 may be attached to the -O- group via any position. Preferably, the rhamnosyl group is attached to the -O- group via position C1. The optional substituents may be attached to the rhamnosyl group at any of the remaining hydroxy I groups.
In preferred embodiments of the present invention, R 3 is -O-a-L-rhamnopyranosyl, -O-a-D-rhamnopyranosyl, -Ο-β-L-rhamnopyranosyl or -Ο-β-D-rhamnopyranosyl.
In the present invention, each R a is independently selected from a single bond, Ci_ 5 alkyiene, C 2 . 5 alkenylene, arylene and heteroarylene; wherein said alkyiene, said alkenylene, said arylene and said heteroarylene are each optionally substituted with one or more groups R c . Preferably, each R a is independently selected from a single bond, Ci 5 alkyiene and C 2 . 5 alkenyiene; wherein said alkyiene and said alkenylene are each optionaliy substituted with one or more groups R c . More preferably, each R a is independently selected from a single bond, C 1-5 alkyiene and C 2 . 5 alkenylene; wherein said alkyiene and said alkenylene are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH and -O-C1.4 alkyl. Even more preferably, each R a is independently selected from a single bond, C -5 alkyiene and C 2 . 5 alkenylene; wherein said alkylene and said alkenylene are each optionally substituted with one or more groups independently selected from -OH and -0-C 1-4 aikyl. Still more preferably, each R a is independently selected from a single bond and C 1-5 alkylene; wherein said alkylene is optionally substituted with one or more groups independently selected from -OH and -0-C 1-4 alkyl. Most preferably, each R a is independently selected from a single bond and C 5 alkylene.
In the present invention, each R b is independently selected from hydrogen, C 1-5 alkyl, C 2-5 alkenyl, C 2 -5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyi, aryl and heteroaryi; wherein said alkyl, said alkenyl, said alkynyl, said heteroalkyl, said cycloalkyl, said heterocycloalkyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R c Preferably, each R b is independently selected from hydrogen, C 1-5 alkyl, C2.5 alkenyl, cycloalkyl, heterocycloalkyi, aryl and heteroaryi; wherein said alkyl, said alkenyl, said cycloalkyl, said heterocycloalkyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R° More preferably, each R b is independently selected from hydrogen, C 1-5 alkyl, C 2 . 5 alkenyl, heterocycloalkyi, aryl and heteroaryi; wherein said alkyl, said alkenyl, said heterocycloalkyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R c Even more preferably, each R b is independently selected from hydrogen, C 1-5 alkyl, C 2 5 alkenyl, heterocycloalkyi, aryl and heteroaryi; wherein said alkyl, said alkenyl, said heterocycloalkyi, said aryl and said heteroaryi are each optionally substituted with one or more groups R c Still more preferably, each R b is independently selected from hydrogen, C 1-5 alkyl, C 2 - 5 alkenyl, heterocycloalkyi, aryl and heteroaryi; wherein said alkyl, said alkenyl, said heterocycloalkyi, said aryl and said heteroaryi are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH and -0-C 1-4 alkyl. Still more preferably, each R b is independently selected from hydrogen, C 1-5 aikyl, C 2 - 5 alkenyl and aryl; wherein said alkyl, said alkenyl and said aryl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH and -0-C 1-4 alkyl. Still more preferably, each R b is independently selected from hydrogen, C 1-5 alkyl and aryl; wherein said alkyl and said aryl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH and -0-Ci. 4 alkyl. Still more preferably, each R b is independently selected from hydrogen and C 1-5 alkyl; wherein said alkyl is optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH and -O-C 1 .4 alkyl. Most preferably, each R b is independently selected from hydrogen and C 1-5 alkyl; wherein said alkyl is optionally substituted with one or more groups independently selected from halogen.
In the present invention, each R° is independently selected from C 1-5 alkyl, C 2 . 5 alkenyl, C 2- 5 alkynyl, -(C 0-3 alkylene)-OH, -(C 0 . 3 alkylene)-0-R d , -(C 0 . 3 alkyfene)-0(Ci -5 alkyl), -(C 0 . 3 alkylene)-0-aryl, -(C 0 . 3 alkylene)-0(C V 5 alkylene)-OH, -(C 0 3 alkylene)-0(C,. 5 alkylene)-0-R d , -(C 0 . 3 alkylene)-0(C 5 alkylene)-0(Ci. 5 alkyl), -(C 0 . 3 alkylene)-SH, -(C 0 . 3 alkylene)-S(Ci-5 alkyi), -(C 0 . 3 alkyiene)-S-aryl, -{C 0 - 3 alkylene)-S(C 1-5 alkyiene)-SH, -(C 0 - 3 alkylene)-S(C-i.5 alkylene)-S(C 1-5 alkyl), -(Co-3 alkylene)-NH 2 , -(C 0-3 aIkyIene)-NH(C 1 -5 alkyl), -(C 0 . 3 alkylene)-N(d-5 alkyi)(d. 6 alkyl), -(C 0 - 3 alkylene)-halogen, -(C 0 . 3 aiky!ene)-(Ci 5 haloalkyl), -(C c-3 aikylene)-CN, -(C 0 . 3 alkylene)-CHO, -(C 0 . 3 alkylene)-CO-(d. 5 alkyl), -{C 0-3 alkylene)-COOH, -(C 0 . 3 alkylene)-CO-0-(C 1-5 alkyl), -(C 0-3 alkylene)-0-CO-(C 1-5 alkyl), -<C 0 . 3 alkylene)-CO-NH 2 , -(C 0-3 alkylene)-CO-NH(d 5 aikyl), -{C 0 3 alkylene)-CO-N(C 1-5 alkyl)(C,. 5 alkyl), -(C 0 . 3 alkylene)-NH-CO-(d_ 5 alkyl), -(C 0 . 3 alkylene)-N(d. 5 alkyl)-CO~(C 1-5 alkyl), -(C 0-3 alkylene)-S0 2 -NH 2 , -(C 0 . 3 alkylene)-S0 2 -NH(C 1-5 alkyl), -(Co-3 alkylene)-S0 2 -N(Ci. 5 alkyl)(C 1-5 alkyl), -(C 0 . 3 alkylene)-NH-S0 2 -(d. 5 alkyl), and -(C 0-3 alkylene)-N(d-5 alkyl)-S0 2 -(C 1 . 5 alkyl); wherein said alkyl, said alkenyl, said alkynyl and the alkyl or aikyiene moieties comprised in any of the aforementioned groups R° are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0- _4 alkyl and -S-d-4 alkyl.
Preferably, each R c is independently selected from d-s alkyl, C 2 -5 alkenyl, -(C 0-3 alkylene)-OH, -(Co-3 alkylene)-0-R d , -(C 0-3 alkylene)-0(C 1-5 alkyl), -(C 0 . 3 alkylene)-0-aryi, -(C 0 . 3 alkylene)-0(d. 5 alkylene)-OH, -(C 0 . 3 alkylene)-0(d. 5 alkylene)-0-R d , -(C 0 . 3 alkylene)-0(C 1-5 alkylene)-0(d. 5 alkyl), -(Co-3 alkylene)-NH 2 , -(C 0 . 3 alkylene)-NH(C 1-5 alkyl), -(C 0 . 3 alkylene)-N(C 1-5 alkyi)(d. 5 alkyl), -(C 0 . 3 alkylene)-halogen, -(C 0 . 3 alkylene)-(d. 5 haloalkyl), -(C 0 . 3 alkylene)-CN, -(C 0 . 3 alkylene)-CHO, -(C 0-3 alkyiene)-CO-(d. 5 alkyl), -(C 0-3 alkylene)-COOH, -(C 0-3 alkylene)-CO-0-(C 1 5 alkyl), -(C 0 . 3 alkylene)-0-CO-(C 1-5 alkyl), -(C 0 . 3 alkylene)-CO-NH 2 , -(C 0 . 3 alkylene)-CO-NH(d 5 alkyl), -(C 0 . 3 alkylene)-CO-N(d. 5 aikyl)(d 5 alkyi), -(C 0-3 alkylene)-NH-CO-(d. 5 alkyl), -(d-s alkylene)-N(d- 5 alkyl)-CO-(d. 5 alkyl), -(C 0-3 alkylene)-S0 2 -NH 2 , -(C 0-3 alkylene)-S0 2 -NH(d. 5 alkyl), -(d- 3 alkylene)-S0 2 -N(d. 5 alkyl)(d-5 alkyl), -(d- 3 aikyiene )-NH-S0 2 -(C 1-5 alkyl) and -(C C -3 alkylene)-N(d- 5 alkyl)-S0 2 -(C 1 . 5 alkyl); wherein said alkyl, said alkenyl and the alkyl or aikyiene moieties comprised in any of the aforementioned groups R° are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-d. 4 alkyi and -S-C1.4 alkyl.
More preferably, each R° is independently selected from d 5 alkyl, C 2-5 alkenyl, -(Ο 0 . 3 alkyiene)-OH, -(C 0 . 3 alkylene)-0-R d , -(C 0 . 3 alkylene)-0(C 1-5 alkyl), -(C 0 . 3 alkylene)-0-aryl, -(d-s alkylene)-0(d. 5 alkylene)-OH, -(C 0 . 3 alkylene)-0(C 1-5 alkylene)-0-R d and -(C 0 . 3 alkylene)-0(C 1-5 alkylene)-0(d. 5 alkyl); wherein said alkyi, said alkenyl and the alkyl or aikyiene moieties comprised in any of the aforementioned groups R c are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-C 1-4 alkyl and -S-C1.4 alkyl.
Even more preferably, each R c is independently selected from d„ 5 alkyl, C 2-5 alkenyl, -(C 0 . 3 alkylene)-OH and -(C 0-3 alkylene)-0-R d ; wherein said alkyl, said alkenyl and the alkyl or aikyiene moieties comprised in any of the aforementioned groups R° are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d and -0-C M alkyl.
Still more preferably, each R c is independently selected from C 1-5 alkyl and C 2 5 aikenyl; wherein said alkyl and said aikenyl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d and -0-C 1-4 alkyl.
Still more preferably, each R c is independently selected from C 1-5 alkyl and C 2 . 5 aikenyl; wherein said alkyl and said aikenyl are each optionally substituted with one or more groups independently selected from halogen.
In the present invention, each R d is independently selected from a monosaccharide, a disaccharide and an oligosaccharide.
R d may, e.g., be independently selected from arabinosidyl, galactosidyl, galacturonidyl, mannosidyl, glucosidyl, rhamnosidyl, apiosidyl, allosidyi, glucuronidyl, N-acetyl-glucosamidyl, N-acetyl-mannosidyl, fucosidyl, fucosaminyl, 6-deoxytalosidyi, olivosidyl, rhodinosidy!, and xylosidyl.
Specific examples of R d include disaccharides such as maltoside, isomaltoside, lactoside, melibioside, nigeroside, rutinoside, neohesperidoside glucose(1 ->3)rhamnoside, glucose(1 ->4)rhamnoside, and galactose(1 ->2)rhamnoside.
Specific examples of R d further include oligosaccharides as maltodextrins (maltotrioside, maltotetraoside, maltopentaoside, maltohexaoside, maltoseptaoside, maltooctaoside), galacto- oligosaccharides, and fructo-oligosaccharides.
In some of the compound of the present invention, each R d is independently selected from arabinosidyl, galactosidyl, galacturonidyl, mannosidyl, glucosidyl, rhamnosidyl, apiosidyl, allosidyi, glucuronidyl, N -acetyl-g I u cosa m i n y I , N-acetyl-mannosaminyl, fucosidyi, fucosaminyl, 6-deoxytalosidyl, olivosidyl, rhodinosidyl, and xylosidyl.
The compound of formula (I) may contain at least one OH group in addition to any OH groups in R 3 , preferably an OH group directly linked to a carbon atom being linked to a neighboring carbon or nitrogen atom via a double bond. Examples of such OH groups include OH groups which are directly attached to aromatic moieties, such as, aryl or heteroaryl groups. One specific example is a phenolic OH group. Procedures for introducing additional monosaccharides, disaccharides or oligosacha rides at R 3 , in addition to the rhamnosyl residue, are known in the literature. Examples therefore include the use of cyclodextrin-glucanotranferases (CGTs) and glucansucrases (such as described in EP 1867729 A1 ) for transfer of glucoside residues at positions C4"-OH and C3"-OH (Shimoda and Hamada 2010, Nutrients 2:171-180, doi:10.3390/nu2020171 , Park 2006, Biosci Biotechnol Biochem, 70(4):940-948, Akiyama et al. 2000, Biosci Biotechnol Biochem 64(10): 2246-2249, Kim et al. 2012, Enzyme Microb Technol 50:50-56).
A first preferred example of the compound of formula (I), i.e. a preferred example of a compound to be used as starting material in the methods of the present invention, is a compound of formula (II) or a solvate thereof:
Many examples of the compound of following formula (II) are disclosed herein, such as, compounds of formulae (Ha), (Mb), (lie) and (lid). It is to be understood that, if reference is made to the compound of formula (II), this reference also includes any of the compounds of formulae (Ma), (lib), (lie), (lid), etc.
In formula (II), R 1 , R 2 , R 3 , R 4 , R 5 and R 6 are as defined with respect to the compound of general formula (I) including the preferred definitions of each of these residues.
In a first proviso concerning the compound of formula (II), the compounds naringenin-5-O-a-L-rhamnopyranoside and eriodictyol-5-O-a-L-rhamnopyranoside are preferably excluded. In a second proviso, R 1 in the compound of formula (II) is preferably not methyl if R 4 is hydrogen, R 5 is -OH and " -^^ is a double bond.
In preferred compounds of formula (II), R 1 is selected from C 1 5 alkyl, C 2-5 alkenyl, C 2- 5 alkynyl, heteroalkyl, cycloalkyl, heterocycloalkyl, ary!, heteroaryl, -R a -R b , -R a -OR b , -R a -OR d , -R a -OR a -OR , -R 3 -0R a -0R d -R a -SR , -R a -SR a -SR b , -R a -NR R b , -R a -halogen, -R a -(C 1-5 haloalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R a -0-CO-R b , -R a -CO-NR b R b , -R a -NR b -CO-R , -R a -S0 2 -NR b R b and -R a -NR b -S0 2 - b ; wherein said alkyl, said alkenyl, said alkynyi, said heteroalkyl, said cycioaikyi, said heterocycloaikyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R c ; and R 2 is selected from hydrogen, C 1-5 alkyl and C 2 . 5 alkenyl. In more preferred compounds of formula (II), R 1 is selected from cycioaikyi, heterocycloaikyl, aryi and heteroaryl; wherein said cycioaikyi, said heterocycloaikyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R c ; and R 2 is selected from hydrogen and Ci -5 alkyl. In even more preferred compounds of formula (II), R 1 is selected from aryl and heteroaryl; wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R c ; and R 2 is selected from hydrogen and C -5 alkyl. In still more preferred compounds of formula (II), R 1 is selected from aryl and heteroaryl; wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R c ; and R 2 is selected from hydrogen and C-i -5 alkyl. Stil! more preferably, R 1 is aryl which is optionally substituted with one or more groups R c , and R 2 is -H. in some compounds of formula (II), R 1 is aryl which is optionally substituted with one, two or three groups independently selected from -OH, -0-R d and -0-C 1- alkyl, and R 2 is -H. Still more preferably, R 1 is phenyl, optionally substituted with one, two or three groups independently selected from -OH, -0-R d and -0-C 1-4 alkyl; and R 2 is -H. in alternatively preferred compounds of formula (II), R 2 is selected from C 1-5 alkyl, C 2 . 5 alkenyl, C 2 . 5 alkynyi, heteroalkyl, cycioaikyi, heterocycloaikyl, aryl, heteroaryl, -R a -R b , -R a -OR b , -R a -OR d , -R a -OR a -OR b , -R a -OR a -OR d , -R a -SR b , -R a -SR a -SR b , -R a -NR b R b , -R a -haiogen, -R a -(Ci. 5 haloalkyl), -R a -CN, -R a -CO-R b , -R a -CO-0-R b , -R a -0-CO-R b , -R a -CO-NR b R b , -R a -NR b -CO-R b , -R 3 -S0 2 -NR b R b and -R a -NR b -S0 2 -R b ; wherein said alkyl, said alkenyl, said alkynyi, said heteroalkyl, said cycioaikyi, said heterocycloaikyl, said aryl and said heteroaryi are each optionally substituted with one or more groups R°; wherein R 2 is different from -OH; and R 1 is selected from hydrogen, C 1-5 alkyl and C 2 . 5 alkenyl. In more preferred compounds of formula (II), R 2 is selected from cycioaikyi, heterocycloaikyl, aryl and heteroaryi; wherein said cycioaikyi, said heterocycloaikyl, said aryl and said heteroaryl are each optionally substituted with one or more groups R c ; and R 1 is selected from hydrogen and 0 1-5 alkyl. In even more preferred compounds of formula (II), R 2 is selected from aryl and heteroaryl; wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R°; and R 1 is selected from hydrogen and C 5 alkyl. In stili more preferred compounds of formula (II), R 2 is selected from aryl and heteroaryl; wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R c ; and R 1 is selected from hydrogen and C 1-5 alkyl. Still more preferably, R 2 is aryi which is optionally substituted with one or more groups R c , and R 1 is -H. In some of the compounds of formula (II), R 2 is aryl which is optionally substituted with one, two or three groups independently selected from -OH, -0-R d and -O-C^ alkyl, and R 1 is -H. Still more preferably, R 2 is phenyl, optionally substituted with one, two or three groups independently selected from -OH, -0-R d and -0-C 1-4 alkyl; and R 1 is -H. each R° can preferably independently be selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-C 1-4 alkyl, -O-aryl, -S-C 1-4 alkyl and -S-aryl.
In preferred compounds of formula (II) each R d is independently selected from arabinosidyl, ga!actosidyl, galacturonidyl, mannosidyl, glucosidyi, rhamnosidyl, apiosidyl, ailosidyl, glucuronidyl, N-acetyl-glucosamidyl, N-acetyl-mannosidyl, fucosidyl, fucosaminyl, 6-deoxytalosidyl, olivosidyl, rhodinosidyl, and xylosidyl.
The compound of formula (II) may contain at least one OH group in addition to any OH groups in R 3 , preferably an OH group directly linked to a carbon atom being linked to a neighboring carbon or nitrogen atom via a double bond. Examples of such OH groups include OH groups which are directly attached to aromatic moieties, such as, aryl or heteroaryl groups. One specific example is a phenolic OH group.
R 4 , R 5 and R 6 may each independently selected from hydrogen, C 1-5 alkyl, C 2-5 alkenyi, -(C 0 . 3 alkylene)-OH, -(C 0-3 alkylene)-0-R d , -(C 0 . 3 alkylene)-0(C 1-5 alkyl), -(C 0 . 3 alkylene^Ofd-s alkylene)-OH, -(C c-3 alkylene)-0(Ci . 5 alkylene)-0-R d and -(C c-3 alkylene)-0(C 1-5 alkylene)-0(d-5 alkyl).
In some compounds of formula (II), R 5 is -OH, -0-R d or -0-(Ci -5 alkyl). In some compounds of formula (II), R 4 and/or R 6 is/are hydrogen or -OH. Most preferably, R 2 is H or -(C 2-5 alkenyi).
Furthermore, R 1 and/or R 2 may independently be selected from aryl and heteroaryi, wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R c .
A first example of the compound of formula (II) is a compound of the following formula (Ha) or a solvate thereof:
wherein: R 2 , R 3 , R 4 , R 5 and R 6 are as defined with respect to the compound of general formula (I) including the preferred definitions of each of these residues;
each R 7 is independently selected from C 1-5 alkyl, C 2- 5 alkenyl, C 2 . 5 alkynyl, -(C 0 . 3 alkyiene)-OH, -(Co-3 alkylene)-0-R d , -{Co-3 alkylene)~0(d-5 alkyl), -(C 0 . 3 alkylene)-0-aryl, -(C 0 . 3 aSkylene)-0(Ci -5 alkylene)-OH, -(C 0 . 3 alkylene)-0(C 1-5 alkylene)-0-R d , -(C 0 . 3 alkylene)-0(C 1-5 alky!ene)-0(C 1-5 alkyl), -(Co-3 aikylene )-SH, -(C 0 . 3 alkylene)-S(Ci. 5 alkyl), -(C 0 . 3 alkylene)-S-aryl, -(C 0 . 3 alkylene)-S(C,. 5 alkylene)-SH, -(C 0 . 3 alkylene)-S(d-5 alkylene)-S(C . 5 alkyl), -(C 0 . 3 alkylene)-NH 2 , -(C 0 . 3 alkylene)-NH(d.5 alkyl), -(C 0-3 alkylene)-N(C 1-5 alkyl)<C 1-5 alkyl), -(C 0 . 3 alkylene)-halogen, -(C 0-3 alkylene)-(Ci.5 haloalkyl), -(C Q-3 alkylene)-CN, -(C 0 . 3 alkylene)-CHO, -(C 0-3 aikylene )-CO-(d. » alkyl), -(Co-3 alkylene)-COOH, -(C 0 . 3 alkylene)-CO-0-(Ci. 5 alkyl), -(C 0-3 alkylene)-0-CO-(d-5 alkyl), -(C 0 - 3 alkylene)-CO-NH 2) -(C 0 . 3 aikylene)-CO-NH(C,. ¾ alkyl), -(C 0 . 3 alkylene)-CO-N(d. 5 alkyl)(d. 5 alkyl), -(Co-3 alkylene)-NH-CO-(d. 5 alkyl), -(C 0 . 3 alkylene)-N(C 1-5 alkyl)-CO-(d. 5 alkyl), -(C 0 . 3 aikylene )-S0 2 -NH ? , -(C 0 . 3 alkylene)-S0 2 -NH(C 1-5 alkyl), -(C 0 . 3 aikylene )-S0 2 -N(d. 5 alkyl )(C 1 5 alkyl), -(Co-3 alkytene)-NH-S0 2 -(d. 5 alkyl), and -(C 0 . 3 alkylene)-N(d. 5 alkyl)-S0 2 -(C 1-5 alkyl); wherein said alkyl, said alkenyl, said alkynyl, said aryl and said aikylene and the alkyl or aikylene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-C 1-4 alkyl and -S-d_ alkyl; n is an integer of 0 to 5, preferably 1 , 2, or 3.
Preferably, each R 7 is independently selected from d. 5 alkyl, C 2 . 5 alkenyl, -(C 0 - 3 aSkylene)-OH, -(Co-3 alkylene)-0-R d , -(C 0 - 3 alkylene)-0(d. 5 alkyl), -(C 0 . 3 alkylene)-0-aryl, -(C 0 3 alkylene)-0(C 1-5 alkylene)-OH, -(C 0 3 alkylene)-0(d. 5 alkylene)-0-R d , -(C 0 . 3 alkylene)-0(d. 5 alkylene)-0(d. 5 alkyl), -(Co-3 alkylene)-NH 2 , -(C 0 . 3 alkylene)-NH(d. s alkyl), -(C 0 . 3 alkylene)-N(d. 5 alkyl)(d. 5 alkyi), -(C 0 . 3 alkylene)-halogen, -(C 0 . 3 alkylene)-(d. 5 haloalkyl), -(C 0 - 3 alkylene)-CN, -(C 0-3 alkylene)-CHO, -(C 0 . 3 alkylene)-CO-(C 1-5 alkyl), -(C 0 _ 3 alkylene)-COOH, -(C 0 . 3 alkylene)-CO-0-(d. 5 alkyl), -(C 0 . 3 alkylene)-0-CO-(d- 5 alkyl), -(C 0 . 3 alkylene)-CO-NH 2 , -(C 0-3 alkylene)-CO-NH(d- 5 alkyl), -(C 0 . 3 alkylene)-CO-N(d„ 5 alkylXd-5 alkyl), -(C 0 . 3 alkylene)-NH-CO-(d. 5 alkyl), -(C 0 . 3 alkylene)-N(Ci -5 alkyl)-CO-(d. 5 alkyl), -(C 0 . 3 alkylene)-S0 2 -NH 2 , -(C 0-3 alkylene)-S0 2 -NH(C,. 5 alkyl), -(Co-3 alkylene)-S0 2 -N(d-5 alkyl)(Ci.5 alkyl), -(C 0 . 3 alkylene)-NH-S0 2 -(C 1-s alkyl) and -(C 0 . 3 alkylene)-N(C 1 „5 alkyl )-S0 2 -(d. 5 alkyl); wherein said alkyl, said alkenyl and the alkyl or aikylene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3l -CN, -OH, -0-R d , -0~d. 4 alkyl and -S-d-4 alkyl.
More preferably, each R 7 is independently selected from C 1-5 alkyl, C 2 5 alkenyl, -(C 0 . 3 alkylene)-OH, -(C 0 . 3 alkylene)-0-R d , -(C 0 . 3 alkylene)-0(C 1-5 alkyl), -(C 0 . 3 alkylene)-0-aryl, -(C 0 . 3 alkylene)-0(d- 5 alkylene)-OH, -(C 0-3 alkylene)-0(C 1-5 alkylene)-0-R d and -(C 0-3 alkylene)-0(C 1-5 alkylene)-0(Ci. 5 alkyl); wherein said alkyl, said alkenyl and the alkyl or aikylene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-C 1 4 alkyl and -S-C 1-4 alkyl.
Even more preferably, each R 7 is independently selected from C 1-r , alkyl, C 2 . 5 alkenyl, -(C 0- 3 alkylene)-OH and -(C 0 . 3 alkylene)-0-R d ; wherein said alkyl, said alkenyl and the alkyl or aikylene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d and -0-C 1- alkyl.
The following combination of residues is preferred in compounds of formula (Ma),
R 2 is selected from hydrogen, C -5 alkyl, C 2-5 alkenyl, and -0-C 1-5 alkyl; wherein said alkyl, said alkenyl, and the alkyl in said -0-C 1-5 alkyl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH and -0-R d ;
R 4 is selected from hydrogen, -OH, -0-R d , C -5 aikyl, C 2 -s alkenyl and -0-C 1-5 alkyl; wherein said alkyl, said alkenyl and the alkyl in said -0-C,. 5 alkyl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH and -0-R d ;
R 5 is selected from hydrogen, -OH, -0-R d , C -5 alkyl, C 2-5 alkenyl, -0-C 1-5 alkyl and -O-aryl; wherein said alkyl, said alkenyl, the alkyl in said -0-C 1-5 alkyl and the aryl in said -O-aryl are each optionally substituted with one or more groups R°;
R 6 is selected from hydrogen, -OH, -0-R d , d -5 alkyl and C 2 . 5 alkenyl, wherein said alkyl and said alkenyl are each optionally substituted with one or more groups R c ;
each R c is independently selected from C 1-5 alkyl, -(C 0 3 alkylene)-OH, -(C 0 . 3 alkylene)-0-R d , -(C 0 . 3 a!kylene)-0(C 1-5 alkyl), -(C 0 . 3 alkylene)-0-aryf, -(C 0 _ 3 alkylene)-0(Ci. 5 alkylene)-OH, -(C 0 3 alkyleneJ-Oid.r, alkyieney-O-R" 1 , -(C 0 3 alkylene)-0(C 1-5 alkylene)-0(C 1-5 alkyl), -(C 0 . 3 alkylene)-NH 2 , -(Co-3 alkylene)-NH(Ci -5 alkyl), -(C 0-3 alkylene)-N(C 1-5 alkyl)(C 1-5 alkyl), -(C 0 . 3 alkylene)-halogen, -(Co-3 alkylene)-(C 1-5 haloalkyl), -(C 0 . 3 alkylene)-CN, -(C 0-3 alkylene)-CHO, -(C 0 . 3 alky!ene)-CO-(C 1-5 alkyl), -(C 0 . 3 alkylene)-COOH, -(C 0-3 alkylene)-CO-0-(Ci -5 alkyl), -(C 0 . 3 alkylene)-0-CO-(C 1-5 alkyl), -(Co-3 alkylene)-CO-NH 2 , -(C c-3 alkylene)-CO-NH(C 1-5 alkyl), -(C 0-3 alkylene)-CO-N(d. 5 alkyl)(C, 5 alkyl), -(C 0 . 3 a!kylene)-NH-CO-(d- 5 alkyl), -(C 0 . 3 alkylene)-N(C,. 5 alkyl)-CO-(d- 5 alkyl), -(C 0 . 3 alkylene)-S02-NH 2 , -(C 0 . 3 alkylene)-S0 2 -NH(C 1-5 alkyl), -(C 0 . 3 alky!ene)-S0 2 -N(C 1-5 alkyl)(Ci -5 alkyl), -(Co-3 alkylene)-NH-S0 2 -(C 1 . 5 alkyl), and -(C 0-3 alkylene)-N(C 1-5 alkyl)-S0 2 -(C 1-5 alkyl); wherein said alkyl and the alkyl, aryl or aikylene moieties comprised in any of the aforementioned groups R c are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -OH, -0-R a and -0-C 1-4 alkyl; and
n is an integer of 0 to 3.
The following combination of residues is more preferred in compounds of formula (lla), R 2 is selected from hydrogen, C 1-5 alkyl and C 2 . 5 alkenyl, wherein said alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
R 4 is selected from hydrogen, -OH, -0-R d , -0-C 1-5 alkyl and C 2-5 alkenyl wherein the alkyl in said -0-C 1-5 alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
R 5 is selected from hydrogen, -OH, -0-R d , -0-C 1-5 alkyl and C 2- 5 alkenyl, wherein the alkyl in said -0-Ci. 5 alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
R 6 is selected from hydrogen, -OH, -0-R d , -C 1-5 alkyl and C 2-5 alkenyl, wherein said alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
each R 7 is independently selected from C 1-5 alkyl, C 2 - 5 alkenyl, -(C 0- 3 aikylene)-OH, -(C 0 -3 a!kylene)-0-R d and -(C 0 . 3 alk leney-Oid.s alkyl); wherein the alkyi, alkenyl and alkylene in the group R 7 are each optionally substituted with one or more groups independently selected from halogen, -OH, and -0-R d ; and
n is 0, 1 or 2.
Even more preferably, the compound of formula (lia), is selected from the following compounds or solvates thereof:
wherein R 3 is as defined with respect to the compound of general formula (I). A second example of the compound of formula (II) is a compound of the following formula (lib) or a solvate thereof:
wherein;
R 2 , R 3 , R 4 , R 5 and R 6 are as defined with respect to the compound of general formula (I) including the preferred definitions of each of these residues.;
each R 7 is independently selected from C -5 alkyi, C 2 . 5 alkenyl, C 2-5 aikynyl, -(C 0 - 3 alkylene)-OH, -(Co-3 alkylene)-0-R d , -(C 0 . 3 alkylene)-0(d. 5 alkyi), -(C 0 . 3 alkylene)-0-aryl, -(C 0-3 alkylene)-0(d-5 alkyiene)-OH, -(C 0 . 3 alkylene)-0(C 1-5 alkylene)-0-R d , -(C 0 3 alkylene)-0(C 1-5 alkylene)-0(C 1-5 alkyi), -(Co-3 alkylene)-SH, -(C 03 aikylene)-S(C 1-5 alkyi), -(C 0 . 3 aikylene)-S-aryl, -(C 0 . 3 alkylene)-S(C 1-5 alkylene)-SH, -(C 0 . 3 alkylene)-S(C 1-5 alkylene)-S(Ci. 5 alkyi), -(C 0 . 3 alkylene)-NH 2 , -(C 03 alkylene)-NH(Ci -5 alkyi), -(C 0-3 alkylene)-N(C 1-5 alkyl)(C 1-5 alkyi), -(C 0 . 3 alkylene)-halogen, -(C 0 . 3 alkylene)-(C 1-5 haloalkyl), -(C 0 . 3 alkylene)-CN, -(C 0 . 3 alkylene)-CHO, -(C 0 . 3 alkylene)-CO-(Ci. 5 alkyi), -(Co-3 alkylene)-COOH, -(C 0 . 3 alkylene)-CO-0-(d- 5 alkyi), -(C 0 . 3 alkylene)-0-CO-(C 1-5 alkyi), -(C 0 3 alkylene)-CO-NH 2 , -(C 0 . 3 aikylene)-CO-NH(C 1 5 alkyi), -(C 0 . 3 alkylene)-CO-N(d-5 alkyl)(d. 5 aikyl), -(Co- 3 aikylene)-NH-CO-(d.5 alkyi), -(C 0-3 alkylene)-N(C 1-5 alkyl)-CO-(d- 5 alkyi), -(C 0 . 3 alkylene )-S0 2 -NH 2 , -(C 0-3 alkylene)-S0 2 -NH(d-5 alkyi), -(C 0 . 3 alkylene)-S0 2 -N(Ci. 5 alkyl)(d. 5 alkyi), -(C 0 - 3 alkylene)-NH-S0 2 -(d 5 alkyi), and -(C c-3 alkyiene)-N(d. 5 alkyl)-S0 2 -(C 1-5 alkyi); wherein said alkyi, said alkenyl, said aikynyl, said aryl and said alkylene and the alkyi or alkylene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-C 1-4 alkyi and -S-C 1-4 alkyi; and
n is an integer of 0 to 5, preferably 1 , 2, or 3.
Preferably, each R 7 is independently selected from C -5 alkyi, C 2 . 5 alkenyl, -(C 0 . 3 alkylene)-OH, -(Co-3 alkylene)-0-R d , -(C 0 . 3 alkylene)-0(d. 5 alkyi), -(C 0-3 alkylene)-0-aryl, -(Co-3 alkylene)-0(d -5 alkylene)-OH, -(C 0-3 alkylene)-0(d. 5 alkylene)-0-R d , -(C 0-3 alkylene)-0(d. 5 alkylene)-0(C 1-5 alkyi), -(Co-3 alkylene)-NH 2 , -(C 0 . 3 alkylene)-NH(d. 5 alkyi), -(C 0 . 3 alkyiene)-N(C 1-5 alkyl)(d. 5 alkyi), -(C 0 . 3 alkylene)-halogen, -(C 0 . 3 alkylene)-(C 1-5 haloalkyl), -(C 0-3 alkylene)-CN, -(C 0 . 3 alkyiene)-CHO, -(C 0-3 alkylene)-CO-(d. 5 alkyi), -(C 0-3 alkylene)-COOH, -(C c-3 alkylene)-CO-0-(Ci -5 alkyi), -(C 0-3 alkylene)-0-CO-(Ci -5 alkyi), -(C 0-3 alky!ene)-CO-NH 2> -(C 0-3 a j ky j ene)-CO-NH(d- 5 alkyi), -(C 0 . 3 alkylene)-CO-N(C 1-5 alkyl)(Ci_5 alkyi), -(C 0 . 3 alkylene)-NH-CO-(C 1-5 alkyi), -(C 0 . 3 alkylene)-N(d. 5 alkyl)-CO-(C 1-5 aikyl), -(C 0 . 3 alkylene)-S0 2 -NH 2 , -(C 0-3 alkylene)-S0 2 -NH(d. 5 alkyi), -(Co-3 alkylene)-S0 2 -N(C 1-5 alkyl)(C 1-5 alkyi), -(C 0-3 alkylene)-NH-S0 2 -(C,. 5 alkyi), and -(C 0 - 3 alkylene)-N(d-5 alkyi )-S0 2 -(C,. 5 alkyi); wherein said alkyi, said alkenyi and the alkyi or alkylene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-C 1-4 alkyi and -S-d-4 alkyi.
More preferably, each R 7 is independently selected from C,. 5 alkyi, C 2 . 5 alkenyi, -(C 0 . 3 alkyiene)-OH, -(C 0-3 alkylene)-0-R d , -(C 0-3 alkyiene)-0(d r> alkyi), -(C 0 . 3 alkylene)-0-aryl, -(C 0 . 3 alkylene)-0(d. 5 alkylene)-OH, -(C C - 3 alkylene)-0(d_ 5 alkylene)-0-R d and -(C 0 . 3 alkylene)-0(d. 5 aikylene)-0(d 5 alkyi); wherein said alkyi, said alkenyi and the alkyi or alkylene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-C 1- alkyi and -S-d-4 alkyi.
Even more preferably, each R 7 is independently selected from d. 5 alkyi, C 2-5 alkenyi, -(C 0 . 3 alkylene)-OH and -(C 0 . 3 alkylene)-0-R d ; wherein said alkyi, said alkenyi and the alkyi or alkylene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d and -0-C 1- alkyi.
The following combination of residues is preferred in compounds of formula (lib),
R 2 is selected from hydrogen, C 1-5 alkyi, C 2 . 5 alkenyi and -0-C 1-5 alkyi; wherein said alkyi, said alkenyi, and the alkyi in said -0-C 1-5 alkyi are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH and -0-R d ;
R 3 is as defined with respect to the compound of general formula (I);
R 4 is selected from hydrogen, -OH, -0-R d , C 1-5 alkyi, C 2 . 5 alkenyi and -O-d 6 aikyl; wherein said alkyi, said alkenyi, and the aikyl in said -O-C 1 s alkyi are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH and -0-R d ;
R 5 is selected from hydrogen, -OH, -0-R d , C -5 aikyl, C 2-5 alkenyi, -0-C 1-5 aikyl and -O-aryl; wherein said alkyi, said alkenyi, the alkyi in said -O-C1.5 aikyl and the aryl in said -O-aryl are each optionaily substituted with one or more groups R c ;
R 6 is selected from hydrogen, -OH, -0-R d , d-s alkyi and C 2 . 5 alkenyi; wherein said aikyl and said alkenyi are each optionaily substituted with one or more groups R c ;
each R° is independently selected from d 5 alkyi, -(C 0 . 3 alkylene)-OH, -(C 0-3 alkylene)-0-R d , -(C 0 - 3 aikylene)-0(d_5 aikyl), -(C 0 . 3 alkylene)-0-aryl, -{C 0 . 3 alkylene)-0(C,. 5 aikylene)-OH, -(C 0 . 3 aikylene)-0(C 1-5 alkylene)-0-R d , -(C 0 . 3 alkyiene)-0(d. 5 alkylene)-0(d. 5 alkyi), -(C 0 . 3 alkylene)-NH 2 , -(C 0- 3 alkylene)-NH(C 1 . 5 alkyl), -(C 0 . 3 alkylene)-N(d -5 alkyl)(C 1-5 alkyl), -(C 0 _ 3 alkylenej-halogen, -(Co-3 alkyleneHd.5 haloalkyl), -(C 0-3 alkylene)-CN, -(C 0 . 3 alkylene)-CHO, -(C 0 . 3 alkylene)-CO-(Ci. 5 alkyl), -(C 0 . 3 alkylene)-COOH, -(C 0-3 alkyleneJ-CO-O- Ci.s alkyl), -(C 0 . 3 alkylene)-0-CO-(Ci 5 alkyl), -(Co-3 alkyiene)-CO-NH 2 , -(C 0 . 3 alkyleneJ-CO-NHiCs alkyl), -(C 0 . 3 alkylene)-CO-N(C 1-5 alkyl)(C 1-5 alkyl), -(C 0-3 alkylene)-NH~CO-(Ci. 5 alkyl), -(C 0-3 alkylene)-N(d. 5 alkyl)-CO-(Ci. 5 alkyl), -(C 0 . 3 alkylene)-S0 2 -NH 2 , -(C 0-3 alkylene)-S0 2 -NH(C 1-5 alkyl), -(C 0-3 alkylene)-S0 2 -N(C 1-5 alkylKC 1-5 alkyl), -(Co-3 alkylene)-NH-S0 2 -(C 1-5 alkyl), and -(C 0-3 alkylene)-N(C 1-5 alkyl)-S0 2 -(C 1-5 alkyl); wherein said alkyl and the alkyl, aryl or alkylene moieties comprised in any of the aforementioned groups R c are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -OH, -0-R d and -0-C 1-4 alkyl; and
n is an integer of 0 to 3.
The following combination of residues is more preferred in compounds of formula (lib),
R 2 is selected from hydrogen, C 1 5 alkyl and C 2-5 alkenyl, wherein said alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and
-0-R d ;
R 3 is as defined with respect to the compound of general formula (I);
R 4 is selected from hydrogen, -OH, -0-R d , -0-C 1-5 alkyl and C 2-5 alkenyl, wherein the alkyl in said -O-C-,-5 alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
R 5 is selected from hydrogen, -OH, -0-R , -0-Ci -5 alkyl and C 2 . 5 alkenyl, wherein the alkyl in said -O-C-i-5 alkyi and said alkylene are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
R 6 is selected from hydrogen, -OH, -0-R d , C -5 alkyi and C 2 . 5 alkenyl, wherein said alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
each R 7 is independently selected from C -5 alkyl, C 2 . 5 alkenyl, -(C 0 . 3 alkylene)-OH, -(C 0-3 alkylene)-0-R d and -(Co-3 alkyleneJ-OfCvg alkyl); wherein the alkyl, alkenyl and alkylene in the group R 7 are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ; and
n is 0, 1 or 2.
Even more preferably, the compound is selected from the following compounds or solvates thereof:
wherein R 3 is as defined with respect to the compound of general formula (I).
A third example of the compound of formula (II) is a compound of the following formula (lie) or a solvate thereof:
wherein: R 1 , R 3 , R 4 , R 5 and R 6 are as defined with respect to the compound of general formula (I) including the preferred definitions of each of these residues;
each R 7 is independently selected from d 5 alkyl, C 2-5 alkenyl, C 2 . 5 alkynyl, -(C 0 . 3 alkylene)-OH, -(Co-3 alkylene)-0-R d , -(C 0-3 alkylene)-0(C 1-5 alkyl), -(C 0 . 3 alkylene)-0-aryl, -(C 0 - 3 alkylene)-0(Ci. 5 alkylene)-OH, -(C 0 . 3 alkylene)-0(Ci -5 alkylene)-0-R d , -(C c-3 aikyiene )-0(C 1-5 alkylene)-0(C 1-5 alkyl), -(Co-3 alkylene)-SH, -(C 0-3 alkylene)-S(C 1-5 alkyl), -(C 0 - 3 alkylene)-S-aryl, -(C 0 . 3 alkylene)-S(Ci. 5 alkylene)-SH, -(C 0 . 3 alkylene)-S(C 1-5 alkyiene)-S(d-5 alkyl), -(C 0 3 alkylene)-NH 2 , -(C 0-3 alkylene)-NH(C 1-5 alkyl), -(C 0 . 3 alkylene)-N(C 1-5 alkyl)(C 1-5 alkyl), -(C 0-3 aikyiene )-halogen, -(C 0-3 alkyleneHCi.5 haloalkyl), -(C 0 . 3 alkylene)-CN, -(C 0-3 alkylene)-CHO, -(C 0 . 3 alkylene)-CO-(Ci. 5 alkyl), -(Co-3 alkylene)-COOH, -(C 0 . 3 alkylene)-CO-0-(C 1-5 alkyl), -(C 0 - 3 alkylene)-0-CO-(C 1 5 alkyl), -(C 0 . 3 alkylene)-CO-NH 2 , -(C 0 . 3 alkylene)-CO-NH(Ci. 5 alkyl), -(C 0 . 3 alkylene)-CO-N(d. 5 alkyl)(C 1-5 alkyl), -(Co-3 alkylene)-NH-CO-(C 1-5 alkyl), -(C 0 . 3 alkylene)-N(C,. 5 alkyl)-CO-(d. 5 alkyl), -(C 0 . 3 alkylene)-S0 2 -NH 2 , -(C 0 . 3 alkylene)-S0 2 -NH(Ci- 5 alkyl), -(C 0 - 3 alkylene)-S0 2 -N(C 1-5 alkyl )(C V5 alkyl), -(Co-3 alkylene)-NH-S0 2 -(C 1 _5 alkyl), and -(C c . 3 alkylene)-N(Ci.5 alkyl)-S0 2 -(C 1-s alkyl); wherein said alkyl, said alkenyl, said alkynyl, said aryl and said aikyiene and the alkyl or aikyiene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -O-C^ alkyl and -S-C 1-4 alkyl; and
n is an integer of 0 to 5, preferably 1 , 2, or 3.
Preferably, each R 7 is independently selected from C 1-5 alkyl, C 2 . 5 alkenyl, -(C 0 . 3 alkylene)-OH, -(C 0-3 alkylene)-0-R d , -(C 0-3 alkylene)-0(d. 5 alkyl), -(C 0-3 alkylene)-0-aryl, -(C 0-3 alkylene)-0(d. 5 alkyiene)-OH, -(C 0 . 3 alkylene)-0(d. 5 aikylene)-0-R d , -(C 0 - 3 alkylene)-0(C 1-5 alkylene)-0(C,. 5 alkyl), -(Co-3 alkylene)-NH 2 , -(C 0 . 3 alkylene)-NH(C,. 5 alkyi), -(C 0-3 aikyiene )-N(C -5 alkyl)(d. 5 alkyl), -(C 0 . 3 alkylene)-halogen, -(C c . 3 alkylene)-(d-5 haloalkyl), -(C 0 - 3 alkylene)-CN, -(C 0 . 3 alkylene)-CHO, -(C 0 . 3 alkylene)-CO-(d. 5 alkyl), -(C 0 . 3 alkylene)-COOH, -(C 0 - 3 alkylene)-CO-0-(C 1-5 alkyl), -(C 0 . 3 alkylene)-0-CO-(d- 5 alkyl), -(C 0 . 3 alkylene)-CO-NH 2 , -(C 0-3 alkylene)-CO-NH(d. 5 alkyl), -(C 0 . 3 alkylene)-CO-N(C,-5 alkyl)(d. 5 alkyl), -(C H alkylene)-NH-CO-(d. 5 alkyl), -(C 0 . 3 aikylene)-N(d- 5 alkyl )-CO-(d. 5 alkyl), -(C 0 . 3 alkylene)-S0 2 -NH 2 , -(C 0 . 3 alkylene)-S0 2 -NH(d. 5 alkyl), -(Cc-3 alkylene)-S0 2 -N(C 1-5 alkyl)(d. 5 alkyl), -(C 0 . 3 alkylene)-NH-S0 2 -(d. 5 alkyl), and -(C 0 - 3 alkylene)-N(Ci- 5 alkyl)-S0 2 -(Ci_ 5 alkyl); wherein said alkyl, said alkenyl and the alkyl or aikyiene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -O-d-4 alkyl and -S-d-4 alkyl.
More preferably, each R 7 is independently selected from d„ 5 alkyl, C 2 . 5 alkenyl, -(C 0 . 3 alkylene)-OH, -(C 0 . 3 alkylene)-0-R d , -(C 0-3 alkylene)-0(Ci -5 alkyl), -(C 0 . 3 alkylene)-0-aryl, -(C 0 . 3 alkyiene)-0(Ci-5 alkylene)-OH, -(C 0-3 alkylene)-0(d. 5 alkylene)-0-R d and -(C 0 . 3 a!kylene)-0(d. 5 a!kylene)-0(Ci -5 alkyl); wherein said alkyl, said aikenyl and the alkyi or alkylene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -OC 1-4 alkyl and -S-C 1-4 alkyl.
Even more preferably, each R 7 is independently selected from C 1-5 alkyl, C 2 5 aikenyl, -(C 0 -3 alkylene)-OH, -(C 0 . 3 alkylene)-0-R d ; wherein said alkyl, said aikenyl and the alkyl or alkylene moieties comprised in any of the aforementioned groups R 7 are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH, -0-R d and -0-d- 4 alkyl.
The following combination of residues is preferred in compounds of formula (lie),
R 1 is selected from hydrogen, C 1-5 alkyl, C 2-5 aikenyl and -0-C 1-5 alkyl; wherein said alkyl, said aikenyl, and the alkyl in said -0-C 1-5 alkyl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN, -OH and -0-R d ;
R 3 is as defined with respect to the compound of general formula (I);
R 4 is selected from hydrogen, -OH, -0-R d , C 1-5 alkyl, C 2-5 aikenyl and -0-C 1-5 alkyl; wherein said alkyl, said aikenyl, and the alkyl in said -O-d 5 alkyl are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -CN -OH and -0-R d ;
R 5 is selected from hydrogen, -OH, -0-R d , C 1-5 alkyl, C 2-5 aikenyl, -0-C -5 alkyl and -O-aryl; wherein said alkyl, said aikenyl, the alkyl in said -O-d . 5 alkyl and the aryl in said -O-aryl are each optionally substituted with one or more groups R c ;
R 6 is selected from hydrogen, -OH, -0-R , d-s alkyl and C 2-5 aikenyl, wherein said alkyl and said aikenyl are each optionally substituted with one or more groups R°;
each R c is independently selected from C 1-5 alkyl, -(C 0 . 3 alkylene)-OH, -(C 0 . 3 alkylene)-0-R d , -(C C 3 alkylene)-0(d. 5 alkyl), -(C 0 - 3 alkylene)-0-aryl, -(C 0 . 3 alkylene)-0(C 1 5 alkylene)-OH, -(C 0 . 3 alkylene)-0(C 1-5 alkylene)-0-R d , -(C 0 - 3 alkylene)-0(C 1-5 alkyleneJ-Oid.g alkyl), -(C 0 . 3 alkyiene)-NH 2 , -(Co-3 alkylene)-NH(d. 5 alkyl), -(C 0-3 alkylene)-N(d. 5 alkyl)(C 1-5 alkyl), -(C 0-3 aikylene)-halogen, -(Co-s alkylene)-(d-5 haloalkyl), -(C c . 3 alkylene)-CN, -(C 0 . 3 alkylene)-CHO, -(C 0-3 alkylene)-CO-(Ci 5 alkyl), -(C 0 . 3 alkylene)-COOH, -(C 0 . 3 alkylene)-CO-0-(d 5 alkyl), -(C 0-3 aikyiene)-0-CO-(d. 5 alkyl), -(Co-3 alkylene)-CO-NH 2 , -(C 0 . 3 alkylene)-CO-NH(d. 5 alkyl), -(C 0 - 3 alkyiene)-CO-N(C 1-5 alkyl)(C,. 5 alkyl), -(C 0 . 3 alkylene)-NH-CO-(C 1-5 alkyl), -(C 0-3 alkylene )-N(d. 5 alkyl)-CO-(C 1-5 alkyl), -(Co-s alkylene)-S0 2 -NH 2 , -(C 0-3 alkylene)-S0 2 -NH(Ci. 5 alkyl), -(C 0-3 alkylene)-S0 2 -N(C 1-5 alkyl)(d. 5 alkyl), -(Co-3 alkylene)-NH-S02-(d-5 alkyl), and -(C 0-3 alkylene)-N(d. 5 alkyl)-S0 2 -(d. 5 alkyl); wherein said alkyl and the alkyl, aryl or alkylene moieties comprised in any of the aforementioned groups R c are each optionally substituted with one or more groups independently selected from halogen, -CF 3 , -OH, -0-R° and -0-C M alkyl; and
n is an integer of 0 to 3, The following combination of residues is more preferred in compounds of formula (lie),
R is selected from hydrogen, C -5 alkyl and C 2-5 alkenyl, wherein said alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and
-0-R d ;
R 3 is as defined with respect to the compound of general formula (I);
R 4 is selected from hydrogen, -OH, -0-R d , -0-C 1-5 alkyl and C 2-5 alkenyl, wherein the alkyl in said -O-C1.5 alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
R 5 is selected from hydrogen, -OH, -0-R d , -0-C 1-5 alkyl and C 2 . 5 alkenyl, wherein the alkyl in said -0-C 1-5 alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
R 6 is selected from hydrogen, -OH, -0-R d , C 1-5 alkyl and C 2 . 5 alkenyl, wherein said alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
each R 7 is independently selected from C 5 alkyl, C 2 . 5 alkenyl, -(C 0 . 3 aikylene)-OH, -(C 0 3 alkylene)-0-R d and -(C 0 . 3 alkylene)-0(C 1-5 alkyl); wherein the alkyl, alkenyl and alkylene in the group R 7 are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R a ; and
n is 0, 1 or 2.
Even more preferred are compounds of formula (He), which are is selected from the following compounds or solvates thereof:
wherein R 3 is as defined with respect to the compound of general formula (I).
A fourth example of the compound of formula (II) is a compound of the following formula (lid) or a solvate thereof:
wherein:
R 3 , R 4 , R 5 , R 6 and R e are as defined with respect to the compound of general formula (I) including the preferred definitions of each of these residues; and
m is an integer of 0 to 4, preferably 0 to 3, more preferably 1 to 3, even more preferably 1 or 2.
The following combination of residues is preferred in compounds of formula (lid),
R 3 is as defined with respect to the compound of general formula (I);
R 4 is selected from hydrogen, -OH, -0-R d , C 1-5 alkyl, C 2-5 alkenyi and -0-C -5 alkyl; wherein said alkyl, said alkenyi, and the alkyl in said -0-C 1-5 alkyl are each optionally substituted with one or more groups independently selected from haiogen, -CF 3 , -CN -OH and -0-R a ;
R 5 is selected from hydrogen, -OH, -0-R d , C 1-5 alkyl, C 2-5 alkenyi, -0-C 1-5 alkyl and -O-aryl; wherein said alkyl, said alkenyi, the alkyl in said -0-C 1-5 alkyl and the aryl in said -O-aryl are each optionally substituted with one or more groups R°;
R 6 is selected from hydrogen, -OH, -0-R d , C 1-5 alkyl and C 2-5 alkenyi, wherein said alkyl and said alkenyi are each optionally substituted with one or more groups R c ;
each R e is independently selected from -OH, -0-R d , d. 5 alkyl, C 2 . 5 alkenyi, -0-C -5 alkyl and -O-aryl; wherein said alkyl, said alkenyi, the alkyl in said -O-C1.5 alkyl and the aryl in said -O-aryl are each optionally substituted with one or more groups R c ; and
m is an integer of 0 to 3.
The following combination of residues is more preferred in compounds of formula (lid),
R 3 is as defined with respect to the compound of general formula (I);
R 4 is selected from hydrogen, -OH, -0-R d , -0-C-,. 5 alkyl and C 2 - 5 alkenyi, wherein the aikyl in said -0-Ci -5 alkyl and said alkenyi are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
R 5 is selected from hydrogen, -OH, -0-R d , -0-C 1-5 alkyl and C 2-5 alkenyi, wherein the alkyl in said -O-C1..5 alkyl and said alkenyi are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ;
R 6 is selected from hydrogen, -OH, -0-R d , C 1-5 alkyl and C 2 . 5 alkenyi, wherein said alkyl and said alkenyi are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ; each R e is independently selected from -OH, -0-R d , -0-0 1-5 alkyl and C 2 . 5 alkenyl, wherein the alkyl in said -O-C1.5 alkyl and said alkenyl are each optionally substituted with one or more groups independently selected from halogen, -OH and -0-R d ; and
m is 0, 1 or 2.
Even more preferred examples of the compound of formula (lid), are compounds selected from the following compounds or solvates thereof:
wherein R 3 is as defined with respect to the compound of general formula (I).
In preferred compounds of formulae (II), (lla), (lib), (lie) and (lid), R 3 is -O-a-L-rhamnopyranosyl, -O-a-D-rhamnopyranosyl , -Ο-β-L-rhamnopyranosyl or -Ο-β-D-rhamnopyranosyl.
A second example of a compound of formula (I) is a compound of formula (III) or a solvate thereof:
wherein R 1 , R 2 , R 3 , R 4 , R 5 and R 6 are as defined with respect to the compound of general formula (I) including the preferred definitions of each of these residues.
In a preferred example of the compounds of formulae (III), R 1 is selected from aryl and heteroaryl, wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R c .
In a preferred example of the compounds of formulae (III), each R c is independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-C 1 4 alkyl, -O-aryl, -S-C1.4 alkyl and -S-aryl.
In a preferred example of the compounds of formulae (III), the compound contains at least one OH group in addition to any OH groups in R 3 , preferably an OH group directly linked to a carbon atom being linked to a neighboring carbon or nitrogen atom via a double bond.
In a preferred example of the compounds of formulae (III), R 4 , R 5 and R 6 are each independently selected from hydrogen, C r 5 alkyl, C 2 . 5 alkenyl, -(C 0 . 3 alkylene)-OH, -(C 0 . 3 alkylene)-0-R d , -(C 0-3 alkylene)-0(C 1 -5 alkyl), -(C 0 3 alkylene)-0(C 1-5 alkylene)-OH, -(C 0 . 3 alkylene)-0(C 1 5 alkylene)-0-R d and -(Co-3 alkylene)-0(C 1-5 alkylene)-0(C 1-5 alkyl).
In a preferred example of the compounds of formulae (III), R 5 is -OH, -0-R d or -0-(C-i -5 alkyl).
In a preferred example of the compounds of formulae (III), R 4 and/or R 6 is/are hydrogen or -OH.
Particular examples of the compound of formula (III) include the following compounds or solvates thereof:
wherein R 3 is as defined with respect to the compound of general formula (I).
In a preferred example of the compounds of formula (III), R 3 is -O-a-L-rhamnopyranosyl, -O-a-D-rhamnopyranosyl, -Ο-β-L-rhamnopyranosyl or -Ο-β-D-rhamnopyranosyl. In a preferred example of the compounds of formula (III), each R d is independently selected from arabinosidyi, gaiactosidyl, gaiacturonidyl, mannosidyl, glucosidyl, rhamnosidyl, apiosidyl, allosidyl, glucuronidyl, N-acetyl-glucosamidyl, N-acetyl-mannosidyl, fucosidyl, fucosaminyl, 6-deoxytaiosidyl, olivosidyl, rhodinosidyl, and xylosidyl.
Yet a further example of a compound of formula (I) is a compound of formula (IV) or a solvate thereof:
(iv) wherein R 1 , R 2 , R 3 , R 4 , R 5 , R 6 and R c are as defined with respect to the compound of general formula (I) including the preferred definitions of each of these residues.
In a preferred example of the compounds of formula (IV), R 1 is selected from aryl and heteroaryl, wherein said aryl and said heteroaryl are each optionally substituted with one or more groups R c .
In a preferred example of the compounds of formula (IV), each R c is independently selected from halogen, -CF 3 , -CN, -OH, -0-R d , -0-C 1-4 alkyi, -O-aryl, -S-C 1-4 aikyl and -S-aryl.
In a preferred example of the compounds of formula (IV), the compound contains at least one OH group in addition to any OH groups in R 3 , preferably an OH group directly linked to a carbon atom being linked to a neighboring carbon or nitrogen atom via a double bond.
In a preferred example of the compounds of formula (IV), R 4 , R 5 and R 6 are each independently selected from hydrogen, C 1-5 alkyl, C 2 . 5 alkenyl, -(C 0 . 3 alkylene)-OH, -(C 0-3 alkylene)-0-R d , -(C 0 . 3 alkylene)-0(C 1-5 alkyl), -(C 0 . 3 alkyieneJ-Oid-s alkylene)-OH, -(C 0-3 alkylene)-0(d. 5 alkylene)-0-R d and -(C 0-3 alkylene)-0(Ci. 5 alkylene)-0(Ci. 5 alkyl).
In a preferred example of the compounds of formula (IV), R 5 is -OH, -0-R d or -0-(C 1-5 alkyl). In a preferred example of the compounds of formula (IV), R 4 and/or R 6 is/are hydrogen or -OH. Particular examples of the compound of formula (IV) include the following compounds or solvates thereof:
wherein R 3 is as defined with respect to the compound of general formula (I).
In a preferred example of the compounds of formula (IV), R 3 is -O-a-L-rhamnopyranosyl, -O-a-D-rhamnopyranosyl, -Ο-β-L-rhamnopyranosyl or -Ο-β-D-rhamnopyranosyl.
In a preferred example of the compounds of formula (IV), each R d is independently selected from arabinosidyl, gaiactosidyl, galacturonidyl, mannosidyl, glucosidyl, rhamnosidyl, apiosidyl, allosidyl, glucuronidyl, N-acetyl-g I ucosa m idyl , N-acetyl-mannosidyl, fucosidyl, fucosaminyl, 6-deoxytalosidyl, olivosidyl, rhodinosidyl, and xylosidyl.
The present invention is further described by reference to the following non-limiting figures and examples.
The Figures show:
Figure 1 : Determination of solubility of naringenin-5-O-a-L-rhamnoside (NR1 ) in water. Defined concentrations of NR1 were 0.22 pm-filtered before injection to HPLC. Soluble concentrations were calculated from peak areas by determined regression curves.
Figure 2: HPLC-chromatogram of naringenin-5-O-a-L-rhamnoside
Figure 3: HPLC-chromatogram of naringenin-4'-0-a-L-rhamnoside
Figure 4: HPLC-chromatogram of prunin (naringenin-7-0- -D-glucoside)
Figure 5: HPLC-chromatogram of homoeriodictyol-5-O-a-L-rhamnoside (HEDR1 ) Figure 6: HPLC-chromatogram of HEDR3 (4:1 molar ratio of homoeriodictyol-7-O-a-L-rhamnoside and homoeriodictyol-4'-0-a-L-rhamnoside)
Figure 7: HPLC-chromatogram of homoeriodictyol-4'-0- -D-glucoside (HED4'Gic)
Figure 8: HPLC-chromatogram of hesperetin-5-O-a-L-rhamnoside (HESR1 )
Figure 9: HPLC-chromatogram of hesperetin-3'-0-a-L-rhamnoside (HESR2)
Figure 10: UV 254 -chromatogram of hesperetin bioconversion 141020, sample injection volume was 1.2 L applied by the pumping system
Figure 11: ESI-TOF negative mode MS-analysis of fraction 3 from hesperetin bioconversionj 41020
Figure 12: ESI-TOF negative mode MS-analysis of fraction 6 from hesperetin bioconversionj 41020
Figure 13: prepLC UV^-chromatogram of PFP-HPLC of fraction 3 bioconversion 141020; the main peak (HESR1 ) between 3.1 min and 3.5 min was HESR1.
Figure 14: ESI-TOF negative mode MS-analysis of fraction 3 from 140424_Naringenin-PetC
Figure 15: ESI-TOF negative mode MS-analysis of fraction 5 from
Figure 16: UV-chromatogram of conversion after 24 h in bioreactor unit 1 150603_Naringenin- PetC
Figure 17: υν 330 chromatogram of an extract from a naringenin biotransformation with PetD
Figure 18: UV 33 o chromatogram of an extract from a naringenin biotransformation with PetC
Figure 19: UV 210-400 nm absorbance spectra of N5R peaks from figures U1 (middle) and U2
(dark) vs. prunin, the naringenin-7-0- -D-glucoside (light).
Figure 20: UV 210-400 nm absorbance spectra of GTF product peak Rf 0.77 (dark) vs. prunin
(light).
Figure 21: UV 330 chromatogram of an extract from a naringenin biotransformation with PetF Figure 22: Cytotoxicity of f!avonoid-5-O-a-L-rhamnosides on normal human epidermal keratinocytes
Figure 23: antiinflammatory, protecting, and stimulating activities of flavonoid-5-O-a-L- rhamnosides on normal human epidermal keratinocytes, normal human dermal fibroblasts, and normal human epidermal melanocytes
EXAMPLES
The compounds described in this section are defined by their chemical formulae and their corresponding chemical names. In case of conflict between any chemical formula and the corresponding chemical name indicated herein, the present invention relates to both the compound defined by the chemical formula and the compound defined by the chemical name.
Part A: Preparation of 5-O-rhamnosvlated flavonoids
Example A1 - Preparation of media and buffers
The methods of the present invention can be used to produce rhamnosylated flavonoids, as will be shown in the appended Examples.
Several growth and biotransformation media were used for the rhmanoslyation of flavonoids. Suitable media thus include: Rich Medium (RM) (Bacto peptone (Difco) 10 g, Yeast extract 5 g, Casamino acids (Difco) 5 g, Meat extract (Difco) 2 g, Malt extract (Difco) 5 g, Glycerol 2 g, MgS0 4 x 7 H 2 0 1 g, Tween 80 0.05 g and H 2 0 ad 1000 ml. at a final pH of about 7.2); Mineral Salt Medium (MSM) (Buffer and mineral sait stock solution were autoclaved. After the solutions had cooled down, 100 ml_ of each stock solution were joined and 1 mL vitamin and 1 mL trace element stock solution were added. Then sterile water was added to a final volume of 1 L. The stock solutions were: Buffer stock solution (10x) of Na 2 HP0 4 70 g, KH 2 P0 4 20 g and H 2 0 ad 1000 mL; Mineral salt stock solution (10x) of (NH 4 ) 2 S0 4 10 g, MgCI 2 x 6 H 2 0 2 g, Ca(N0 3 ) 2 x 4 H 2 0 1 g and H 2 0 ad 1000 mL; Trace element stock solution (1000x) of EDTA 500 mg, FeS0 4 x 7 H 2 0 300 mg, CoCI 2 x 6 H 2 0 5 mg, ZnS0 4 x 7 H 2 0 5 mg, MnCI 2 x 4 H 2 0 3 mg, NaMo0 4 x 2 H 2 0 3 mg, NiCI 2 x 6 H 2 0 2 mg, H 3 B0 3 2 mg, CuCI 2 x 2 H 2 0 1 mg and H 2 0 ad 200 mL. The solution was sterile filtered. Vitamin stock solution (1000x) of Ca-Pantothenate 10 mg, Cyanocobalamine 10 mg, Nicotinic acid 10 mg, Pyridoxal-HCI 10 mg, Riboflavin 10 mg, Thiamin-HCI 10 mg, Biotin 1 mg, Folic acid 1 mg, p-Amino benzoic acid 1 mg and H 2 0 ad 100 mL. The solution was sterile filtered.); Lysogeny Broth (LB) (Yeast extract 5 g, Peptone 10 g, NaCI 5 g and H 2 0 ad 1000 mL); Terrific Broth (TB) (casein 12 g, yeast extract 24 g, K 2 HP0 4 12.5 g, KH 2 P0 4 2.3 g and H 2 0 ad 1000 mL at pH 7.2). In some experiments, in particular when the concentration of dissolved oxygen (DO) was above about 50%, nutrients were added to the solution. This was done using a feed solution of Glucose 500 g, MgS0 4 10 g, thiamine 1 mg and H 2 0 ad 1000 mL. In some experiments, in particular when cells expressing glycosyl transferase were harvested prior to starting the production of rhamnosylated flavonoids, cells were resuspended in a buffer solution, in particular phosphate buffer saline (PBS). The solution was prepared using NaCI 150 mM, K 2 HP0 4 /KH 2 P0 4 100 mM at a pH of 6.4 to 7.4.
Example A2 - Glycosyl transferases used for the production of rhamnosylated flavonoids
Several different glycosyl transferases were used in the methods of the present invention to produce rhamnosylated flavonoids. In particular, the glycosyltransferases (GTs) used for flavonoid rhamnoside production were
1. GTC, a GT derived metagenomically (AGH18139), preferably having an amino acid sequence as shown in SEQ ID NO:3, encoded by a polynucleotide as shown in SEQ ID NO:4. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO:27.
2. GTD, a GT from Dyadobacter fermentans (WP_01581 417), preferably having an amino acid sequence as shown in SEQ ID NO:5, encoded by a polynucleotide as shown in SEQ ID NO:6. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO:28.
3. GTF, a GT from Fibrisoma limi (WP_009280674), preferably having an amino acid sequence as shown in SEQ ID NO:7, encoded by a polynucleotide as shown in SEQ ID NO:8. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO:29.
4. GTS from Segetibacter koreensis (WP_01861 1930) preferably having an amino acid sequence as shown in SEQ ID NO:9, encoded by a polynucleotide as shown in SEQ ID NO: 10. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO:30.
5. Chimera 3 with AAs 1 to 316 of GTD and AAs 324 to 459 of GTC preferably having an amino acid sequence as shown in SEQ ID NO: 58, encoded by a polynucleotide as shown in SEQ ID NO: 59. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO: 60.
6. Chimera 4 with AAs 1 to 268 of GTD and AAs 276 to 459 of GTC preferably having an amino acid sequence as shown in SEQ ID NO: 61 , encoded by a polynucleotide as shown in SEQ ID NO: 62. A codon-optimized sequence for expression in E. coli is shown in SEQ ID NO: 63. 7. Chimera 1 frameshift with AAs 1 to 234 of GTD and AAs 242 to 443 of GTC preferably having an amino acid sequence as shown in SEQ ID NO: 56, encoded by a polynucleotide as shown in SEQ ID NO: 57.
The GT genes were amplified by PGR using respective primers given in Table A1. Purified PGR products were ligated into TA-cloning vector pDrive (Qiagen, Germany). Chemically competent £ coli DH5Q were transformed with ligation reactions by heat shock and positive clones verified by blue/white screening after incubation. GT from Segetibacter koreensis was directly used as codon- optimized nucleotide sequence.
Chimera 3 and chimera 4 were created from the codon-optimized nucleotide sequences from GTD and GTC, while chimera 1 was constructed from the SEQ ID NO:4 and SEQ ID NO:6. Chimera 1 was created according to the ligase cycling reaction method described by Kok (2014) ACS Synth Biol 3(2):97-106. Thus, the two nucleotide sequences of each chimeric fragment were amplified via PGR and were assembled using a single-stranded bridging oligo which is complementary to the ends of neighboring nucleotide parts of both fragments. A thermostable ligase was used to join the nucleotides to generate the full-length sequence of the chimeric enzyme.
Chimera 3 and chimera 4 were constructed according to the AQUA cloning method described by Beyer (2015) PLoS ONE 10(9):e0137652. Therefore, the nucleotide fragments were amplified with complementary regions of 20 to 25 nucleotides, agarose-gel purified, mixed in water, incubated for 1 hour at room temperature and transformed into chemically competent E. coli DH5a. The primers used for the chimera construction are listed in Table A2.
Table A1 : Primers used for the amplification of the GT genes by PGR
Table A2: Primers used for the construction of chimeric enzymes
Enzyme Primer name Sequence (i
Chimera GCGGCCATATCGACGACGACGACAAGCATATGACGAAATAC 1 Bridge_P1_pETGTD AAAAATGAATTAACAGGT
GGAAGAAGAAAAGATATACTAAGGATCCGGCTGCT
Bridge_P1_GTCpET AACAAAGCCCGAAAGG
Chim_P1_D_Nde_for CATATGACGAAATACAAAAATGAATT
Chim_P1_D_rev GCGGTCATACTCAAATGATT
Chim_P1_C_for AGTGATCTGGGAAAAAATATC
Chim_P1_C_Bam_rev GGATCCTTAGTATATCTTTTCTTCTTCCT Chimera
3 GTDopt_pEt_fw GGGAATTCCATATGATGACCAAATACAAAAATG
Chim3_pET_rv CGGGATCCTTAGTAAATCTTTTCTTCTTCCTTC
1 r-Chim3-opt-
TGCCCTGAGGAAAGCGCGCACGTAATTC
o(Chim3-opt)
2f-Chim3-opt-
TGCGCGC I I I CCTCAGGGCAACTTAATC
o(Chim3-opt)
1 f-Assem bly-o( Vec) TGACGATAAGGATCGATGGGGATCCATGACCAAATACAAA
I r-Assemb!y-o(Vec) TATGGTACCAGCTGCAGATCTCGAGTTAGTAAATCTTTTCTTC
Chimera
4 GTDopt_pEt_fw GGGAATTCCATATGATGACCAAATACAAAAATG
Chim3_pET_rv CGGGATCCTTAGTAAATCTTTTCTTCTTC
1 r-Chim4_GTD-
CGATTTTGCGCCCATATTGTAACAACTTTTGA
o(Chim4_GTC)
2f-Chim4_GTC-
ACAATATGGGCGCAAAATCGTCGTAGTC
0(Chim4_GTD)
If-Assembly-o(Vec) TGACGATAAGGATCGATGGGGATCCATGACCAAATACAAA
1 r-Assem bly-o(Vec) TATGGTACCAGCTGCAGATCTCGAGTTAGTAAATCTTTTCTTC
To establish expression hosts purified pDrive::GT vectors were incubated with respective endonucieases (Table A1 ) and the fragments of interest were purified from Agarose after gel electrophoresis. Alternatively, the amplified and purified PGR product was directly incubated with respective endonucieases and purified from agarose gel after electrophoresis. The fragments were !igated into prepared pET19b or pTrcHisA plasmids and competent E. coli Rosetta garni 2 (DE3) were transformed by heat shock. Positive clones were verified after overnight growth by direct colony PGR using T7 promotor primers and the GT gene reverse primers, respectively.
Alltogether, seven production strains were established:
1. PetC E. coli Rosetta garni 2 (DE3) pET19b::GTC
2. PetD E. coli Rosetta garni 2 <DE3) pET19b::GTD
3. PetF E. coli Rosetta garni 2 (DE3) pET19b::GTF
4. PetS E. coli Rosetta garni 2 (DE3) pET19b::GTS
5. PetChimlfs E. coli Rosetta garni 2 (DE3) pET19b::Chimera 1 frameshift
6. PetChim3 E. coli Rosetta garni 2 (DE3) pET19b;:Chimera 3
7. PetChim4 E. coli Rosetta garni 2 (DE3) pET19b::Chimera 4
Example A3 - Production of rham nosy fated flavonoids in biotransformations Three kinds of whole cell bioconversion (biotransformation) were performed. All cultures were inoculated 1/100 with overnight pre-cultures of the respective strain. Pre-cultures were grown at 37 °C in adequate media and volumes from 5 to 100 mL supplemented with appropriate antibiotics.
1. Analytical small scale and quantitative shake flask cultures
For analytical activity evaluations, 20 mL biotransformations were performed in 00 mL Erienmeyer flasks while quantitative biotransformations were performed in 500 mL cultures in 3 L Erienmeyer flasks. Bacterial growth was accomplished in complex media, e.g. LB, TB, and RM, or in 9 supplemented with appropriate antibiotics at 28 °C until an OD 60 o of 0.8. Supplementation of 50 or 100 μΜ Isopropyl- -D-thiogalactopyranoside (IPTG) induced gene expression overnight (16 h) at 17 °C and 175 rpm shaking. Subsequently, a polyphenolic substrate, e.g. Naringenin, Hesperetin or else, in concentrations of 200 - 800 μΜ was added to the culture. Alternatively, the polyphenolic substrate was supplemented directly with the IPTG. A third alternative was to harvest the expression cultures by mild centrifugation (5.000 g, 18 °C, 10 min) and suspend in the same volume of PBS, supplied with 1 % (w/v) glucose, optionally biotin and/or thiamin, each at 1 mg/L, the appropriate antibiotic and the substrate in above mentioned concentrations. All biotransformation reactions in 3 L shake flasks were incubated at 28 °C up to 48 h at 175 rpm.
2. Quantitative bioreactor (fermenter) cultures
In order of a monitorable process bioconversions were performed in volumes of 0.5 L in a Dasgip fermenter system (Eppendorf, Germany). The whole process was run at 26 to 28°C and kept at pH 7.0. The dissolved oxygen (DO) was kept at 30% minimum. During growth the DO rises due to carbohydrate consumption. At DO of 50% an additional feed with glucose was started with 1 mL/h following the equation
y = e°- 1x
whereby y represents the added volume (mL) and x the time (h).
For cell growth the bacterial strains were grown in LB, TB, RM or M9 overnight. At OD 60 o of 10 to 50 50 μΜ of IPTG and the polyphenolic substrate (400-1500 μΜ) were added to the culture. The reaction was run for 24 to 48 h.
All bioconversion reactions were either stopped by cell harvest through centrifugation (13,000 g, 4°C, 20 min) followed by sterile filtration with a 0.22 μΜ PES membrane (SteritopTM, Carl Roth, Germany). Alternatively, cultures were harvested by hollow fibre membrane filtration techniques, e.g. TFF Centramed system (Pall, USA). Supernatants were purified directly or stored short-term at 4 °C (without light). Qualitative analyses of biotransformation reactions and products
Biotransformation products were determined by thin layer chromatography (TLC) or by HPLC.
For qualitative TLC analysis, 1 mL culture supernatant was extracted with an equal amount ethyl acetate (EtOAc). After centrifugation (5 min, 3,000 g) the organic phase was transferred into HPLC flat bottom vials and was used for TLC analysis. Samples of 20 L were applied on 20x10 cm 2 (HP)TLC silica 60 F 25 4 plates (Merck KGaA, Darmstadt, Germany) versus 200 pmol of reference flavonoids by the ATS 4 (CAMAG, Switzerland). To avoid carryover of substances, i.e. prevent false positives, samples were spotted with double syringe rinsing in between. The sampled TLC plates were developed in EtOAc/acetic acid/formic acid/water ( EtO Ac/H Ac H Fo/H 2 0) 100:11 :11 :27. After separation the TLC plates were dried in hot air for 1 minute. The chromatograms were read and absorbances of the separated bands were determined densitometrically depending on the absorbance maximum of the educts at 285 to 370 nm (D2) by a TLC Scanner 3 (CAMAG, Switzerland).
Analytical HPLC conditions
HPLC analytics were performed on a VWR Hitachi LaChrom Elite device equipped with diode array detection.
Column: Agilent Zorbax SB-C18 250x4,6 mm, 5 μΜ
Flowrate: 1 mL/min
Mobile phases: A: H 2 0 + 0.1% Trifluoro acetic acid (TFA), B: ACN + 0.1 % TFA
Gradient: 0-5':5% B, 5-15': 15% B, 15-25': 25% B, 25-25': 35% B,
35-45': 40%, 45-55' 100% B, 55-63': 5% B
Sample injection volume 100-500 μί
MS and MS/MS analyses were obtained on a microOTOF-Q with eiectrospray ionization (ESI) from Bruker (Bremen, Germany). The ESI source was operated at 4000 V in negative ion mode. Samples were injected by a syringe pump and a flow rate of 200 pL/min.
In order to purify the polyphenolic glycosides two different purification procedures were applied successfully.
1. Extraction and subsequent preparative HPLC
1.1 In liquid-liquid extractions bioconversion culture supernatants were extracted twice with half a volume of iso-butanol or EtO Ac. 1.2 In solid phase extractions (SPE) supernatants were first bound on suitable polymeric matrices, e.g. Amberlite XAD resins or silica based functionalized phases, e.g. C-18, and subsequently eluted with organic solvents, e.g. ACN, methanol (MeOH), EtOAc, dimethyl sulfoxide (D SO) et al. or with suitable aqueous solutions thereof, respectively.
Organic solvents were evaporated and the residuum completely dissolved in water- acetonitrile (H 2 0-ACN) 80:20. This concentrate was further processed by HPLC as described below.
2. Direct fractionation by preparative HPLC
Sterile filtered (0.2 μηι) biotransformation culture supernatants or pre-concentrated extracts were loaded on adequate RP18 columns (5 μηι, 250 mm) and fractionated in a H 2 0-ACN gradient under following general conditions:
System: Agilent 1260 Infinity HPLC system.
Column: ZORBAX SB-C18 prepHT 250 x 21.2 mm, 7 pm.
Flowrate: 20 mL/min
Mobile Phase: A: Water + 0.1 formic acid
B: ACN + 0.1 formic acid
Gradient: 0-5 min 5-30% B
5-10 min 30% B
10-15 min 35% B
15-20 min 40% B
20-25 min 100% B
Fractions containing the polyphenolic glycosides were evaporated and/or freeze dried. Second polishing steps were performed with a pentafluor-phenyi (PFP) phase by HPLC to separate double peaks or impurities.
The rhamnose transferring activity was shown with enzymes GTC, GTD, GTF and GTS and the three chimeric enzymes chimera 1 frameshift, chimera 3 and chimera 4 in preparative and analytical biotransformation reactions. The enzymes were functional when expressed in different vector systems. GT-activity could be already determined in cloning systems, e.g. E. coli DH5a transformed with pDrive vector (Qiagen, Germany) carrying GT-genes. E. coli carrying pBluescript II SK+ with inserted GT-genes also was actively glycosylating flavonoids. For preparative scales the production strains PetC, PetD, PetF, PetS, PetChimlfs, PetChim3 and PetChim4 were successfully employed. Products were determined by HPLC, TLC, LC-MS and NMR analyses.
Biotransformation of the f!avanone hesperetin using E. coli Rosetta garni 2 (DE3) pET19b::GTC (PetC) In a preparative scale reaction hesperetin (3',5,7-Trihydroxy-4'-methoxyflavanone, 2,3-dihydro-5,7- dihydroxy-2-(3-hydroxy-4-methoxyphenyl)-4H-1-benzopyran-4-on e, CAS No. 520-33-2) was converted. The biotransformation was performed following general preparative shake flask growth and bioconversion conditions.
The bioconversion of hesperetin (>98%, Cayman, USA) was monitored by HPLC analyses of 500 pL samples taken at start (T=0), 3h and 24 h reaction at 28 °C. The culture supernatant was loaded directly via pump flow to a preparative RP18 column (Agilent, USA). Stepwise elution was performed and seven fractions were collected according to Figure 10 and table A2.
All seven fractions subsequently were analyzed by HPLC and ESI-Q-TOF MS analyses. MS analyses in negative ion mode revealed fraction 3 and fraction 6 to contain a compound each with the molecular weight of 448 Da corresponding to hesperetin-O-rhamnoside (C22H24O10) (Figures 11 and 12table A2). To further purify the two compounds fractions 3 and 6 were lyophilized and dissolved in 30% ACN.
Final purification was performed by HPLC using a PFP column The second purification occurred on a Hypersil Gold PFP, 250 x 10 mm, 5 pm purchased from Thermo Fischer Scientific (Langerwehe, Germany) and operated at a flow rate of 6 mL/min (Mobile Phase: A: Water, B: ACN, linear gradient elution (0'-8':95%-40%A, 8'-13':100%B)(Figure 13). Subsequently, ESI-TOF MS analyses of the PFP fractions identified the target compounds designated HESR1 and HESR2 in respective fractions (table A3).
After lyophilization NMR analyses elucidated the molecular structure of HESR1 and HESR2, respectively (Example B-2). HESR1 turned out to be the hesperetin-5-O-a-L-rhamnoside and had a RT of 28.91 min in analytical HPLC conditions. To this point, this compound has ever been isolated nor synthetized before.
Table A2: Fractionation of hesperetin bioconversion by prepLC separation
Frac Well Location Volume BeginTime EndTime Description ESI
# # [μΐ] [min] [min]
1 I I i 1 . _ I _
1 1 1 1
1 1 Vial 201 20004.17 3.4999 4.5001 Time
2 1 Vial 202 58004.17 4.9999 7.9001 Time
3 1 Vial 203 17804.17 7.9999 8.8901 Time HESR1 448
4 1 Vial 204 20791.67 8.9505 9.9901 Time
5 1 Vial 205 39012.50 10.0495 12.0001 Time
6 1 Vial 206 38004.17 12.0999 14.0001 Time HESR2 448
7 1 Vial 207 40004.17 17.9999 20.0001 Time Table A3: Peak table of PFP-HPLC of fraction 3 hesperetin bioconversion
Type Width [min] Area Height Area Name
2.03 BB 0.1794 866.4182 75.7586 3.910
2.50 BV 0.1642 493.0764 43.5284 2.225
2.68 VV 0.0289 20.4545 9.5811 0.092
2.77 VB 0.0861 85.4639 15.0938 0.385
3.74 VB 0.0932 2007.7089 320.0400 9.061
4.04 BB 0.0816 74.1437 14.5014 0.334
4.46 BB 0.1241 190.8758 23.6774 0.861
5.23 BV 0.1326 121.1730 13.5104 0.546
5.50 VB 0.1617 315.1474 27.9130 1.422
6.19 BV 0.1654 43.3605 3.8503 0.195
10.36 W 0.4019 296.8163 9.8411 1.339
12.46 VB 0.1204 15.1287 1.7240 0.068
Biotransformation of the flavanone naringenin using PetC in a preparative shake flask culture
Naringenin (4',5,7-Trihydroxyflavanone, 2,3-dihydro-5,7-dihydroxy-2-(4-hydroxyphenyl)-4H-1- benzopyran-4-one, CAS No. 67604-48-2) was converted in a preparative scale reaction. The biotransformation was performed following general preparative shake fiask growth and bioconversion conditions.
The bioconversion of naringenin (98%, Sigma-Aldrich, Switzerland) was controlled by HPLC analyses of a 500 pL sample after 24 h reaction. The culture supernatant was directly loaded via pump flow to a preparative RP18 column. Stepwise elution was performed and seven fractions were collected according to table A4.
All seven fractions subsequently were analyzed by HPLC and ESI-TOF MS analyses. MS analyses in negative ion mode revealed fraction 3 and fraction 5 to contain a compound each with the molecular weight of 418 Da which is the molecular weight of naringenin-O-rhamnoside (C 2 i H220 9 )(table A4). The two compounds designated NR1 and NR2 were lyophilized. HPLC analysis in analytical conditions revealed RTs of approx. 27.2 min for NR1 and 35.7 min for NR2, respectively. NMR analyses elucidated the molecular structure of NR1 (Example B-3). NR1 was identified to be an enantiomeric 1 :1 mixture of S- and ft-naringenin-5-O-a-L-rhamnoside (N5R). Since the used precursor also was composed of both enantiomers the structure analysis proved that both isomers were converted by GTC. To our knowledge this is the first report that naringenin- 5-O-a-L-rhamnoside has ever been biosynthesized. The compound was isolated from plant material (Shrivastava (1982) Ind J Chem Sect B 21(6):406-407). However, the rare natural occurrence of this scarce flavonoid glycoside has impeded any attempt of an industrial application. In contrast, the first time bioconversion of naringenin-5-O-a-L-rhamnoside opens the way of a biotechnological production process for this compound. Until now the biotechnological production was only shown for e.g. naringenin-7-O-a-L-xyloside and naringenin-4'-0- -D-glucoside (Simkhada (2009) Mol. Cells 28:397-401 , Werner (2010) Bioprocess Biosyst Eng 33:863-871 ).
Table A4: Fractionation of naringenin bioconversion by prepLC separation
Frac Well Location Volume BeginTime EndTime Description ESI
# # [μΐ] [min] [min]
I I 1 1 1
1 1 i
1 I
1 1 Vial 201 31518. .75 4.6963 6.4407 Time
2 1 Vial 202 17328. .75 6.5074 7.4634 Time
3 1 Vial 203 34638. .75 7.5301 9.4478 Time NR1 418
4 1 Vial 204 43905. .00 9.5130 11.9455 Time
5 1 Vial 205 115995.00 12.0109 18.4484 Time NR2 418
6 1 Vial 206 71111. .25 18.5151 22.4590 Time
7 1 Vial 207 80047 , .50 22.5242 26.9647 Time
Biotransformation of naringenin using E. coli Rosetta garni 2 (DE3) pET19b::GTC (PetC) in a monitored bioreactor system
Next to production of naringenin rhamnosides in shake flask cultures a bioreactor process was successfully established to demonstrate applicability of scale-up under monitored culture parameters.
In a Dasgip fermenter system (Eppendorf, Germany) naringenin was converted in four fermenter units in parallel under conditions stated above.
At an OD 6 oo of 50 expression in PetC was induced by IPTG while simultaneously supplementation of 0.4 g of naringenin (98% CAS No. 67604-48-2, Sigma-Aldrich, Switzerland) per unit was performed. Thus, the final concentration was 2.94 mM of substrate.
After bioconversion for 24 h the biotransformation was finished and centrifuged. Subsequently, the cell free supernatant was extracted once with an equal volume of so-butanol by shaking intensively for one minute. Preliminary extraction experiments with defined concentrations of naringenin rhamnosides revealed an average efficiency of 78.67% (table A5). HPLC analyses of the bioreactor reactions indicated that both products, NR1 (RT 27,28') and NR2 (RT 35.7'), were built successfully (figure16). ESI-MS analyses verified the molecular mass of 418 Da for both products. Quantitative analysis of the bioconversion products elucidated the reaction yields. Concentration calculations were done from peak areas after determination regression curves of NR1 and NR2 (table A6). NR1 yielded an average product concentration of 393 mg/L, NR2 as the byproduct yielded an average 105 mg/L.
Table A5: Extraction of naringenin biotransformation products from supernatant with /sobutanoi
Extraction mit /so-butanol 1 ml/ 1 mL 1' shaking
% Mean Loss % Std Dev.
75,75160033
82,49563254 78,6707143 21,32928571 2,73747541
76,42705533
80,00856895
Table A6: HPLC chromatogram peak area and resulting product concentrations of NR1 and NR2
NR1 NR2
Concentration Concentration
Peak area mg/mL Peak area mg/mL
Unit 1 26°C 24h 232620332 0,33231476 64179398 0,091684854
Unit 2 28°C 24h 192866408 0,27552344 57060698 0,081515283
Unit 3 26°C 24h 235176813 0,335966876 61065093 0,087235847
Unit 4 28°C 24h 204937318 0,292767597 49803529 0,071 147899
Unit 1 26°C 24h 232620332 0,422412283 64179398 0,1 16542547
Unit 2 28°C 24h 192866408 0,350223641 57060698 0,103615791
Unit 3 26°C 24h 235176813 0,427054564 61065093 0,1 10887321
Unit 4 28°C 24h 204937318 0,372143052 49803529 0,090437591
Average 0,392958385 0,105370815 Biotransformation of narengenin using E. coli Rosetta garni 2 (DE3) pET19b::GTC (PetC), E. coli Rosetta garni 2 (DE3) pET19b::GTD (PetD), E. coli Rosetta garni 2 (DE3) pET19b::GTF (PetF), E. coli Rosetta garni 2 (DE3) pET19b::GTS (PetS), E. coli Rosetta garni 2 (DE3) pET19b::Chimera 1 frameshift (PetChimlfs), E. coli Rosetta garni 2 (DE3) pET19b::Chimera 3 (PetChim3) and E. coli Rosetta garni 2 (DE3) pET19b::Chimera 4 (PetChim4), respectively
To determine the regio specificities of GTC, GTD, GTF and GTS as well as the three chimeric enzymes chimera 1 frameshift, chimera 3 and chimera 4 biotransformations were performed in 20 ml_ cultures analogously to preparative flask culture bioconversions using naringenin as a substrate among others. To purify the formed flavonoid rhamnosides, the supernatant of the biotransformation was loaded on a C 6 H 5 solid phase extraction (SPE) column. The matrix was washed once with 20 % acetonitrile. The flavonoid rhamnosides were eluted with 100 % aceteonitrile. Analyses of the biotransformations were performed using analytical HPLC and LC- MS. For naringenin biotransformations analyses results of the formed products NR1 and NR2 of each production strain are listed in Table A7 and A8, respectively.
Table A7: Formed NR1 products in bioconversions of naringenin with different production strains strain NR1 retention time [min] HPLC ESI-MS ESI-MSMS
PetC 27.32 418 272
PetD 27.027 418 272
PetF 26.627 418 272
PetS 26.833 418 272
PetChimlfs 26.673 418 272
PetChim3 26.72 418 272
PetChim4 26.727 418 272
Table A8: Formed R2 products in bioconversions of naringenin with different production strains strain NR2 retention time [min] HPLC ESI-MS ESI-MSMS
PetC 35.48 418 272
PetD 35.547 418 272
PetF 35.26 418 272
PetS 35.28 418 272
PetChimlfs 35.080 418 272
PetChim3 35.267 418 272
PetChim4 35.267 418 272 Biotransformation of the flavanone homoeriodictvol (HEP) using PetC
In preparative scale HED (5,7-Dihydroxy-2-(4-hydroxy-3-methoxyphenyl)-4-chromanone, CAS No. 446-71-9) was glycosylated by PetC. The biotransformation was performed following general preparative shake flask growth and bioconversion conditions.
The bioconversion of HED was monitored by HPLC analyses. The culture supernatant was loaded directly via pump flow to a preparative RP18 column (Agilent, USA). Stepwise elution was performed and nine fractions were collected according to table A5.
All nine fractions subsequently were analyzed by HPLC and ESI-TOF MS analyses. MS analyses of fractions 5 and 8 in negative ion mode showed that both contained a compound with the molecular weight of 448 Da which corresponded to the size of a HED-O-rhamnoside and were designated HEDR1 and HEDR3. MS analysis of fraction 7 (HEDR2) gave a molecular weight of 434 Da. However, ESI MS/MS analyses of all three fractions identified a leaving group of 146 Da suggesting a rhamnosidic residue also in fraction 7.
After HPLC polishing by a (PFP) phase and subsequent lyophiiization the molecular structure of HEDR1 was solved by NMR analysis (Example B-1 ). HEDR1 (RT 28.26 min in analytical HPLC) was identified as the pure compound HED-5-O-a-L-rhamnoside..
Table A9: Fractionation of HED bioconversion by prepLC separation
Frac Well Location Volume BeginTime EndTime Description ESI-MS
# # [μΐ] [min] [min] [compound]
1 1 Vial 2Θ1 22503, ,75 5.0999 6.3501 Time
2 1 Vial 202 28593. ,75 6.4115 8.0001 Time
3 1 Vial 2Θ3 34927, ,50 8.0597 10.0001 Time
4 1 Vial 204 20141, ,25 10.0611 11.1801 Time
5 1 Vial 205 13695, ,00 11.2392 12.0001 Time HEDR1 448
6 1 Vial 206 34931, ,25 12.0594 14.0001 Time
7 1 Vial 207 25203. ,75 15.5999 17.0001 Time HEDR2 434
8 1 Vial 208 38246, ,25 17.0753 19.2001 Time HEDR3 448
9 1 Vial 209 66603, ,75 19.2999 23.0001 Time HED 302 Biotransformation reactions using PetC of the isoflavone genistein using PetC
In preparative scale genistein (4',5,7-Trihydroxyisoflavone ,5,7-dihydroxy-3-(4- hydrooxyphenyl)chromen-4-one, CAS No. 446-72-0) was glycosylated in bioconversion reactions using PetC. The biotransformation was performed in PBS following general preparative shake flask growth and bioconversion conditions.
The bioconversion of genistein was monitored by HPLC analyses. The genistein agiycon showed a RT of approx. 41 min. With reaction progress four peaks of reaction products (GR1-4) with RTs of approx. 26 min, 30 min, 34.7 min, and 35.6 min accumulated in the bioconversion (table A10). The reaction was stopped by cell harvest after 40 h and in preparative RP18 HPLC stepwise elution was performed. All fractions were analyzed by HPLC and ESI-Q-TOF MS analyses.
Fractions 3, 4, and 5, respectively, showed the molecular masses of genistein rhamnosides in MS analyses. Fraction 3 consisted of two separated major peaks (RT 26 min and 30 min). Fraction 4 showed a double peak of 34.7 min and 35.6 min, fraction 5 only the latter product peak at RT 35.6 min. Separate MS analyses of the peaks in negative ion mode revealed that all peaks contained compounds with the identical molecular masses of 416 which corresponded to the size ofgenistein- O-rhamnosides. NMR analysis of GR1 identified genistein-5,7-di-0-a-L-rhamnoside (Example B- 9).
Biotransformation of the isoflavone biochanin A using PetC
In preparative scale biochanin A (5,7-dihydroxy-3-(4-methoxyphenyl)chromen-4-one, CAS No. 491-80-5) was glycosylated in bioconversion reactions using PetC. The biotransformation was performed following general preparative shake flask growth and bioconversion conditions.
The bioconversion of biochanin A was monitored by HPLC. The biochanin A agiycon showed a RT of approx. 53.7 min. With reaction progress three product peaks at approx. 32.5', 36.6', and 45.6' accumulated in the bioconversion (table A10). These were termed BR1 , BR2, and BR3, respectively. The reaction was stopped by cell harvest after 24 h through centrifugation (13,000 g, 4°C). The filtered supernatant was loaded to a preparative RP18 column and fractionated by stepwise elution. All fractions were analyzed by HPLC and ESI-Q-TOF MS analyses.
The PetC product BR1 with a RT of 32.5 min was identified by NMR as the 5,7-di-O-a-L- rhamnoside of biochanin A (Example B-4). NMR analysis of BR2 (RT 36.6') gave the 5-O-a-L- rhamnoside (example B-5). In accordance to 5-O-a-L-rhamnosides of other flavonoids, e.g. HED- 5-O-a-L-rhamnoside, BR2 was the most hydrophilic mono-rhamnoside with a slight retardation compared to HEDR1. Taking into account the higher hydrophobicity of the precursor biochanin A (RT 53.5') due to less hydroxy groups and its C4'-methoxy function in comparison to a C4 -OH of genistein (RT 41 ') the retard of BR2 compared to GR2 could be explained.
Biotransformation of the flavone chrysin using PetC
In preparative scale chrysin (5,7-Dihydroxyflavone, 5,7-Dihydroxy-2-phenyl-4-chromen-4-one, CAS No. 480-40-0) was glycosylated in bioconversion reactions using PetC. The biotransformation was performed following stated preparative shake flask conditions in PBS.
The bioconversion of chrysin was monitored by HPLC analyses. The chrysin agiycon showed a RT of 53.5 min. In PetC biocenversions three reaction product peaks accumulated in the reaction, CR1 at RT 30.6 min, CR2 at RT36.4 min, and CR3 at RT43.4, respectively (table A10). All products were analyzed by HPLC and ESI-Q-TOF MS analyses.
CR1 was further identified by NMR as the 5,7-di-O-a-L-rhamnoside of chrysin (Example B-6) and in NMR analysis CR2 turned out to be the 5-0-a-L-rhamnoside (Example B-7). Like BR2, CR2 was also less hydrophilic than the 5-O-rhamnosides of flavonoids with free OH-groups at ring C, e.g. hesperetin and naringenin, although CR2 was the most hydrophilic mono-rhamnoside of chrysin.
Biotransformation of the flavone diosmetin using PetC
Diosmetin (5,7-Trihydroxy-4'-methoxyflavone, 5,7-dihydroxy-2-(3-hydroxy-4-methoxyphenyl) chromen-4-one, CAS No. 520-34-3) was glycosylated in bioconversion reactions using PetC. The biotransformation was performed as stated before.
The bioconversion of diosmetin was monitored by HPLC. The diosmetin agiycon showed a RT of 41.5 min using the given method. With reaction progress three peaks of putative reaction products at 26.5' (DR1 ), 29.1 ' (DR2), and 36' (DR3) accumulated (table A10).
The product DR2 with a RT of 29.1 min was further identified as the 5-O-a-L-rhamnoside of diosmetin (D5R) (Example B-10). DR1 was shown by ESI-MS analysis to be a di-rhamnoside of diosmetin. In accordance with the 5-O-a-L-rhamnosides of other flavonoids, e.g. hesperetin, DR2 had a similar retention in analytical RP18 HPLC-conditions.
Table A10 summarizes all reaction products of PetC biotransformations with the variety of f!avonoid precursors tested.
Table A10: Compilation of applied precursors and corresponding rhamnosylated products
The following Examples were prepared according to the procedure described above in Part A. Example B-1 : HED-5-O-a-L-rhamnoside
1 H NMR((600 MHz Methanol-*): δ = 7.06 (d, J = 2.0 Hz, 1 H), 7.05(d, J 6.91 (dW = 8.2, 2.1, 0.4 Hz, 1H), 6.90 (ddd, J= 8.1, 2.0, 0.6 Hz, 1H),6.81 (d, J=8.1 Hz, 1H), 6.80 (d, J= 8.1 Hz, 1 H), 6.32 (d, J = 2,3 Hz, 1 H), 6.29 (d, J = 2,3Hz, 1 H), 6.09 (t,J = 2,3 Hz, 2H), 5.44 (d, J = 1.9 Hz, 1 H), 5.40 (d, J = 1.9Hz, 1 H), 5.33 (dd, J =7.7, 2.9 Hz, 1 H), 5.31 (dd,J =8.1, 3.0Hz, 1H), 4.12 (ddd, J= 11.2, 3.5, 1.9 Hz, 2H), 4.08 (dd, J =9.5, 3.5 Hz, 1H), 4.05 (dd, J = 9.5, 3.5 Hz, 1H), 3.87 (s, 3H), 3.87 (s, 3H), 3.69 - 3.60 (m, 2H), 3.46 (td, J = 9.5, 5.8 Hz, 2H), 3.06 - 3.02 (m, 1H), 3.02 - 2.98 (m, 1H), 2.64 (ddd, J = 16.6, 15.5, 3.0 Hz, 2H), 1.25 (d, =6.2Hz, 3H), 1.23 (d, J=6.3Hz, 3H).
Example B-2: Hesperetin-5-O-a-L-rhamnoside
1 H-N R (400 MHz, DMSO-d 6 ): δ = 1.10 (3H, d, J = 6.26 Hz, CH3), 2.45 (m, H-3(a), superimposed by D SO), 2.97 (1H, dd, J = 12.5, 16.5 Hz, H3(b)), 3.27 (1H, t, 9.49 Hz, H(b)), 3.48 (m, H(a), superimposed by HDO), 3.76 (3H, s, OCH3), 3.9 -3.8 (2H, m, H(c),Hd), 5.31 (1H, d, 1.76 Hz, He), 5.33 (1H, dd, 12.5, 2.83 Hz, H2), 6.03 (1H,d, 2.19 Hz, H6/H8), 6.20 (1H, d, 2.19 Hz, H6/H8), 6.86 (1H, dd, 8.2, 2.0 Hz, H6'), 6.90 (1H, d, 2.0 Hz, H2'), 6.93 (1H, d, 8.2 Hz, H5')
Exa mnoside
1 H NMR (600 MHz, DMSO-d6): δ = 7.30 (d, J = 6.9 Hz, 2H), 7.29 (d, J = 6.9 Hz, 2H), 6.79 (d, J = 8.6 Hz, 2H), 6.78 (d, J = 8.6 Hz, 2H), 6.22 (d, J = 2.3 Hz, 1H), 6.20 (d, J = 2.2 Hz, 1H), 6.02 (d, J = 2.2 Hz, 1H), 6.01 (d, J = 2.2 Hz, 1H), 5.38 (dd, J = 12.7, 3.1 Hz, 1H), 5.35 (dd, J = 13.0, 2.5 Hz, 1H), 5.31 (d, J = 1.8 Hz, 1H), 5.27 (d, J = 1.9 Hz, 1H), 3.90 - 3.88 (m, 1H), 3.88 - 3.85 (m, 1H), 3.85 - 3.80 (m, 2H), 3.50 (dq, J = 9.2, 6.2 Hz, 1H), 3.48 (dq, J = 9.1 , 6.2 Hz, 1 H), 3.29 (t, J = 9.8 Hz, 2Η), 3.07 - 2.98 (m, 2H), 2.55 - 2.48 (m, 2H), 1.12 (d, J = 6.2 Hz, 3H), 1.10 (d, J = 6.2 Hz, 3H). 3C NMR (151 MHz, DMSO-d6): δ = 187.75, 187.71 , 164.04, 163.92, 163.80, 158.33, 158.23, 157.48, 157.44, 129.26, 129.24, 129.18, 129.15, 128.07, 128.00, 115.00, 105.19, 105.06, 98.58, 98.44, 97.25, 96.85, 96.77, 96.64, 78.03, 77.97, 71.67, 71.65, 69.98, 69.95, 69.66, 69.64, 44.78, 44.74, 17.80, 17.75.
Example B-4: Biochanin A-5,7-di-0-a-L-rhamnoside
1 H NMR(400 MHz DMSO-rf 6 ): δ = 8.21 (s, 1 H), 7.43 (d, J = 8.5 Hz, 2H), 6.97 (d, J = 8.6 Hz, 2H), 6.86 (d, J = 1.8 Hz, 1 H), 6.74 (d, J = 1.8 Hz, 1 H), 5.53 (d, J = 1.6 Hz, 1 H), 5.41 (d, J = 1.6 Hz, 1 H), 5.15 (s, 1 H), 5.00 (s, 1 H), 4.93 (s, 1 H), 4.83 (s, 1 H), 4.70 (s, 1 H), 3.93 (br, 1 H), 3.87 (br, 1 H), 3.85 (br, 1H), 3.77 (s, 3H), 3.64 (dd, J = 9.3,3.0 Hz, 1 H), 3.54 (dq, J = 9.4, 6.4 Hz, 1 H), 3.44 (dq, J = 9.4, 6.4 Hz, 1 H), 3.34 (br, 1 H), 1.13 (d, J = 6.1 Hz, 3H), 1.09 (d, J = 6.1 Hz, 3H)
Example B-5: Biochanin A 5-O-a-L-rhamnoside
1 H NMR(400 MHz DMSO-d 6 ): δ = 8.21 (s, 1 H), 7.42 (d, J = 8.7 Hz, 2H), 6.96 (d, J = 8.7 Hz 2H), 6.55 (d, J = 1.9 Hz, 1 H), 6.48 (d, J = 1.9 Hz, 1 H), 5.33 (d, J = 1.7 Hz, 1 H), 5.1 - 4.1 (br, nH), 3.91 (br, 1 H), 3.86 (d, J = 9.7, 1 H), 3.77 (s, 3H), 3.48 (br, superimposed by impurity, 1 H), 3.44 (impurity), 3.3 (superimposed by HDO), 1.10 (d, J = 6.2 Hz, 3H)
Example B-6: Chrysin-di-5,7-0-a-L-rhamnoside H
1 H NMR(400 MHz DMSO-d 6 ): δ = 8.05 (m, 2H), 7.57 (m, 3Η), 7.08 (s, 1H), 6.76 (d, J = 2.3 Hz, 1H), 6.75 (s, 1Η), 5.56 (d, J = 1.6 Hz, 1H), 5.42 (d, J= 1.6 Hz, 1H), 5.17 (s, 1H), 5.02 (s, 1H), 4.94 (s, 1H), 4.86 (s, 1H), 4.71 (s, 1H), 3.97 (br, 1H), 3.88 (dd, J = 9.5,3.1 Hz, 1H), 3.87 (br, 1H), 3.66 (dd, J = 9.3,3.4 Hz, 1H), 3.56 (dq, J = 9.4, 6.2 Hz, 1H), 3.47 (dq, J = 9.4, 6.2 Hz, H), 3.32 ( superimposed by HDO, 2H), 1.14 (d, J = 6.2 Hz, 3H), 1.1 (d, J = 6.2 Hz, 3H)
Exam le B-7: Chrysin-5-O-a-L-rhamnoside
1 H NMR(400 MHz DMSO-d 6 ): δ = 8.01 (m, 2H), 7.56 (m, 3H), 6.66 (s, 1H), 6.64 (d, J = 2.1 Hz, 1H), 6.55 (d, J = 2.1 Hz, 1H), 5.33 (d, J= 1.5 Hz, 1H), 5.01 (s, 1H), 4.85 (d, J =4.7 Hz, 1 H), 4.69 (s, 1 H), 3.96 (br, 1 H), 3.87 (md, J = 8.2 Hz, 1 H), 3.54 (dq, J = 9.4, 6.2 Hz, 1 H), 3.3 (superimposed by HDO), 1.11 (d, J = 6.1 Hz, 3H)
Example B-8: Silibinin-5-O-a-L-rhamnoside
1 H NMR(400 MHz DMSO-d e ): δ = 7.05 (dd, J =5.3,1.9 Hz, 1H), 7.01 (br, 1H), 6.99 (ddd, J = 8.5,4.4,1.8 Hz, 1 H), 6.96 (dd, J = 8.3, 2.3 Hz, 1 H), 6.86 (dd, J = 8.0, 1.8 Hz, 1 H), 6.80 (d, J = 8.0 Hz, 1H), 6.25 (d, J= 1.9 Hz, 1H), 5.97 (dd, J = 2.1,3.7 Hz, 1H), 5.32 (d, J= 1.6 Hz, 1H),
5.01 (d, J= 11.2 Hz, 1H), 4.90 (d, J = 7.3 Hz, 1H), 4.36 (ddd, J =11.2,6.5,4.6 Hz, 1H), 4.16 (ddd, J = 7.6,3.0,4.6 Hz, 1H), 3.89 (m, 1H), 3.83 (br, 1H), 3.77 (d, J= 1.8 Hz, 1H), 3.53 (m, 3H), 3.30 (superimposed by HDO, 3H), 1.13 (d, J = 6.2 Hz, 3H)
Example B-9: Genistein-5,7-di-0-a-L-rhamnoside
H
1 H NMR(400 MHz DMSO-d 6 ): δ = 8.16 (s, 1 H), 7.31 (d, J = 8.4 Hz, 2H), 6.85 (d, J = 2.1 Hz, 1H), 6.79 (d, J = 8.4 Hz, 2H), 6.73 (d, J = 2.1 Hz, 1H), 5.52 (d, J = 1.8 Hz, 1H), 5.40 (d, J = 1.8 Hz, 1H), 5.14 (d, J = 3.8 Hz, 1 H), 4.99 (d, J = 3.8 Hz, 1H), 4.92 (d, J = 5.2 Hz, 1H), 5.83 (d, J = 5.2 Hz, 1 H), 5.79 (d, J = 5.5 Hz, 1 H), 4.69 (d, J = 5.5 Hz, 1 H), 3.93 (br, 1 H), 3.87 (br, 1H), 3.85 (br, 1H), 3.64 (br, 1H), 3.44 (m, 2H), 3.2 (superimposed by HDO, 2H), 1.12 (d, J = 6.2 Hz, 3H), 1.09 (d, J = 6.2 Hz, 3H)
Example B-10: Diosmetin-5-O-a-L-rhamnoside
1 H N R(600 MHz DMSO-tf 6 ): δ = 7.45 (dd, J - 8.5,2.3 Hz, 1H), 7.36(d, J = 2.3 Hz, 1H), 7.06 (d, J = 8.6 Hz, 1 H), 6.61 (d, J = 2.3 Hz, 1 H), 6.54 (d, J = 2.3 Hz, 1 H), 6.45 (s, 1 H), 5.32 (d, J = 1.7 Hz, 1 H), 3.96 (dd, J = 3.5, 2.0 Hz, 1 H), 3.86 (m, 1 H), 3.85 (s, 3H), 3.54 (dq, J =9.4, 6.3 Hz, 1H), 3.30 (superimposed by HDO, 1H), 1.11 (d, J = 6.2, 3H)
Part C: Solubility Figure 1 illustrates the amounts of Naringenin-5-rhamnoside recaptured from a RP18 HPLC- column after loading of a 0.2 μηι filtered solution containing defined amounts up to 25 mM of the same. Amounts were calculated from a regression curve. The maximum water solubility of Naringenin-5-rhamnoside approximately is 10 mmol/L, which is equivalent to 4.2 g/L.
The hydrophilictty of molecules is also reflected in the retention times in a reverse phase (RP) chromatography. Hydrophobic molecules have later retention times, which can be used as qualitative determination of their water solubility.
HPLC-chromatography was performed using a VWR Hitachi LaChrom Elite device equipped with diode array detection under the following conditions:
Column: Agilent Zorbax SB-C18 250x4,6 mm, 5 μΜ, Flow 1 mL/min
Mobile phases: A: H 2 0 + 0.1 % Trifluoro acetic acid (TFA);
B: ACN + 0.1 % TFA
Sample injection volume: 500 μί;
Gradient: 0-5 min: 5% B, 5-15 min: 15% B, 15-25 min: 25% B, 25-25 min: 35% B, 35-45 min: 40%, 45-55 min: 100% B, 55-63 min: 5% B
Table B1 contains a summary of the retention times according to figures 2-9 and Example A-2.
Generally, it is well known that glucosides of lipophilic small molecules in comparison to their corresponding rhamnosides are better water soluble, e.g. isoquercitrin (quercetin-3-glucoside) vs. quercitrin (quercetin-3-rhamnosides). Table B1 comprehensively shows the 5-O-a-L-rhamnosides are more soluble than a-L-rhamnosides and β-D-glucosides at other positions of the flavonoid backbone. Ail the 5-O-a-L-rhamnosides eluted below 30 min in RP18 reverse phase HPLC. In contrast, flavanone giucosides entirely were retained at RTs above 30 min independent of the position at the backbone. In case of HED it was shown that among other positions, here C4' and C7, the differences concerning the retention times of the a-L-rhamnosides were marginal, whereas the C5 position had a strong effect on it. This was an absolutely unexpected finding.
The apparent differences of the solubility are clearly induced by the attachment site of the sugar at the polyphenolic scaffold. In 4-on-5-hydroxy benzopyranes the OH-group and the keto-function can form a hydrogen bond. This binding is impaired by the substitution of an a-L-rhamnoside at C5 resulting in an optimized solvation shell surrounding the molecule. Further, in ' aqueous environments the hydrophilic rhamnose residue at the C5 position might shield a larger area of the hydrophobic polyphenol with the effect of a reduced contact to the surrounding water molecules. Another explanation would be that the occupation of the C5 position more effectively forms a molecule with a spatial separation a hydrophilic saccharide part and a hydrophobic polyphenolic part. This would result in emulsifying properties and the formation of micelles. An emulsion therefore enhances the solubility of the involved compound.
Part DLlActivitv of rhamnosyjated flavonoids
Example 0-1 : Cytotoxicity of flavonoid-5-O-a-L-rhamnosides
To determine the cytotoxicity of flavonoid-5-0-a-L-rhamnosides tests were performed versus their aglycon derivatives in cell monolayer cultures. For this purpose concentrations ranging from 1 μΜ to 250 μ were chosen. The viability of normal human epidermal keratinocytes (NHEK) was twice evaluated by a MTT reduction assay and morphological observation with a microscope. NHEK were grown at 37°C and 5% C0 2 aeration in Keratinocyte-SFM medium supplemented with epidermal growth factor (EGF) at 0.25 ng/mL, pituitary extract (PE) at 25 pg/mL and gentamycin (25 pg/mL) for 24 -h and were used at the 3rd passage. For cytotoxicity testing, pre-incubated NHEK were given fresh culture medium containing a specific concentration of test compound and incubated for 24 h. After a medium change at same test concentration cells were incubated a further 24 h until viability was determined. Test results are given in Table B2 and illustrated in Figure 10. Table B2: Cytotoxicity of flavonoid-5-O-a-L-rhamnosides on normal human epidermal keratinocyt.es
Compound [μΜ] from stock solution at 100 mM in DMSO
Control 1 2.5 5 10 25 50 100 250
Hesperetin
Viability (%) 98 98 103 98 107 101 106 106 98 54
102 102 106 09 106 105 109 106 100 59
Mean 100 105 103 106 103 108 106 99 57 sd 2 2 8 1 3 2 0 1 4
Morph. obs. + + + + + + + +/- +/-
Hes-5-Rha
Viability (%) 95 85 86 87 81 86 89 81 86 91
118 103 108 113 95 103 112 93 108 102
Mean 100 97 100 88 95 101 87 97 96 sd 14 16 19 10 13 16 9 16 8
Morph. obs. + + + + + + + + +
Naringenin
Viability (%) 95 96 96 95 93 95 89 85 76 48
104 05 95 92 91 95 94 94 74 47
Mean 100 95 93 92 95 92 89 75 47 sd 5 1 2 1 0 4 6 2 1
Morph. obs. + + + + + + + +/-. * +/-, *
Nar-5-Rha
Viability (%) 96 99 91 92 85 94 92 78 82 79
101 104 111 93 88 100 98 91 90 87
Mean 100 101 93 86 97 95 84 86 83 sd 3 14 1 2 4 4 9 6 6
Morph. obs. + + + + + + + + +/-
Cytotoxicity measurements on monolayer cultures of NHEK demonstrated a better compatibility of the 5-O-a-L-rhamnosides versus their flavonoid aglycons at elevated concentration. Up to 100 μΜ no consistent differences were observed (figure 10). However, at 250 μΜ concentration of the aglycons hesperetin and naringenin the viability of NHEK was decreased to about 50% while the mitochondrial activity of NHEK treated with the corresponding 5-O-a-L-rhamnosides was still unaffected compared to lower concentrations. In particular these results were unexpected as the solubility of flavonoid aglycons generally is below 100 μΜ in aqueous phases while that of glycosidic derivatives is above 250 μΜ. These data clearly demonstrated that the 5-O-a-L- rhamnosides were less toxic to the normal human keratinocytes.
Example D-2: Anti-inflammatory properties Anti-Inflammatory potential
NHEK were pre-incubated for 24 h with the test compounds. The medium was replaced with the NHEK culture medium containing the inflammatory inducers (PMA or Poly !:C) and incubated for another 24 hours. Positive and negative controls ran in parallel. At the endpoint the culture supernatants were quantified of secreted IL-8, PGE2 and TNF-a by means of ELISA.
Anti-inflammatory effects of 5-O-rhamnosides in NHEK cell cultures
Table B3: Inhibition of 5-O-rhamnosides on Cytokine release in human keratinocytes (NHEK)
516
Compared to control experiments the 5-O-rhamnosides showed anti-inflammatory activities on human keratinocytes concerning three different inflammation markers IL-8, TNFa, and PGE 2 under inflammatory stimuli (PMA, poly(l:C)). Especially, the activity of HESR1 on PGE 2 was remarkable with a 74% inhibition. An anti-inflammatory activity is well documented for flavonoid derivatives. And several authors reported their action via COX, NFKB, and MAPK pathways (Biesalski (2007) Curr Opin Clin Nutr Metab Care 10(6):724-728, Santangelo (2007) Ann 1st Super Sanita 43(4): 394-405). However, the exceptional water solubility of flavonoid-5-O-rhamnosides disclosed here allows much higher intracellular concentrations of these compounds than achievable with their rarely soluble aglycon counterparts. The aglycon solubilities are mostly below their effective concentration. Thus, the invention enables higher efficacy for anti-inflammatory purposes.
Among many other regulatory activities TNFa also is a potent inhibitor of hair follicle growth (Lim (2003) Korean J Dermatology 41 : 445-450). Thus, TNFa inhibiting compounds contribute to maintain normal healthy hair growth or even stimulate it.
Example D-3: Antioxidative properties
Antioxidative effects of 5-O-rhamnosides in NHEK cell cultures
Pre-incubated NHEK were incubated with the test compound for 24 h. Then the specific fluorescence probe for the measurement of hydrogen peroxide (DHR) or lipid peroxides (C11-fluor) was added and incubated for 45 min. Irradiation occurred with in H 2 0 2 determination UVB at 180 mJ/cm 2 (+UVA at 2839 mJ/cm 2 ) or UVB at 240 mJ/cm 2 (+UVA at 3538 mJ/cm 2 ) in lipid peroxide, respectively, using a SOL500 Sun Simulator lamp. After irradiation the cells were post-incubated for 30 min before f!ow-cytometry analysis.
Table B4: Protection of 5-O-rhamnosides against UV-induced H 2 0 2 stress in NHEK cells
Table Β5: Protection of 5-O-rhamnosides against UV-induced lipid peroxide in NHEK cells 3047 3.3Ε-04
2877 3.5Ε-04
HESR1 "Ι ΟΟμΜ 1671 6.0Ε-04 6.4Ε-04 6.3Ε-05 99 10 - 1 12
1455 6.9Ε-04
NR1 100μΜ 2414 4.1 Ε-04 4.3Ε-04 2.1 Ε-05 93 4 9 6
2255 4.4Ε-04
An anti-oxidative function of the tested f!avonoid-5-O-rhamnosides could be observed for HESR1 on mitochondrially produced hydrogen peroxids species and for NR1 on lipid peroxides, respectively. However, it is argued that these parameters are influenced also by different intracellular metabolites and factors, e.g. gluthation. Hence, interpretation of anti-oxidative response often is difficult to address to a single determinant.
Example D-4: Stimulating properties of 5-O-rhamnosides
Tests were performed with normal human dermal fibroblast cultures at the 8 th passage. Cells were grown in DMEM supplemented with glutamine at 2mM, penicillin at 50 U/mL and streptomycin (50 pg/mL) and 10% of fetal calf serum (FCS) at 37 °C in a 5% C0 2 atmosphere.
Stimulation of flavonoid-5-O-rhamnosides on syntheses of procollagen I, release of VEGF, and fibronectin production in NHDF cells
Fibroblasts were cultured for 24 hours before the celis were incubated with the test compounds for further 72 hours. After the incubation the culture supernatants were collected in order to measure the released quantities of procollagen I, VEGF, and fibronectin by means of ELISA. Reference test compounds were vitamin C (procollagen I), PMA (VEGF), and TGF-β (fibronectin).
Table B6: Stimulation of 5-O-rhamnosides on procollagen I synthesis in NHDF cells
Treatment Basic data Normalized data
Pro%
%
Compound Cone. collagen I Mean sd sd
Control P (1 > Stimulati sd p (1 >
" (ng/ml) on
1893
; Control 11473 1667 122 100 7 - 0 7
Ι Ϊ637
14739
Vitamin C 20 pg/ml 5854 15272 ! 323 316 19 *** 216 19 ***
5225 I
1334
NR1 100 μΜ 11097 ' 335 66 20 -34 20 1
i860
1929
HESR1 100 μΜ 1968; 55 118 3 - 18 3 '
2007 Table B7: Stimulation of 5-O-rhamnosides on VEGF release in NHDF cells
Table B8: Stimulation of 5-O-rhamnosides on fibronectin synthesis in NHDF cells
Results demonstrated that flavonoid-5-O-rhamnosides can positively affect extracellular matrix components. HESR1 stimulated procollagen I synthesis in NHDF by about 20 % at 100 μΜ. NR1 at 100 μΜ had a stimulating effect on fibronectin synthesis with an increase of 20% in NHDF. Both polymers are well known to be important extracellular tissue stabilization factors in human skin. Hence substances promoting collagen synthesis or fibronectin synthesis support a firm skin, reduce wrinkles and diminish skin aging. VEGF release was also stimulated approx. 30% by NR1 indicating angiogenic properties of flavonoid-5-O-rhamnosides. Moderate elevation levels of VEGF are known to positively influence hair and skin nourishment through vascularization and thus promote e.g. hair growth (Yano (2001 ) J Clin Invest 107:409-417, KR101629503B1 ). Also, Fibronectin was described to be a promoting factor on human hair growth as stated in US 2011/0123481 A1. Hence, NR1 stimulates hair growth by stimulating the release of VEGF as well as the synthesis of fibronectin in normal human fibroblasts.
Stimulation of flavonoid-5-O-rhamnosides on MMP-1 release in UVA-irradiated NHDF
Human fibroblasts were cultured for 24 hours before the cells were pre-incubated with the test or reference compounds (dexamethasone) for another 24 hours. The medium was replaced by the irradiation medium (EBSS, CaCI 2 0.264 g/L, MgCIS0 4 0.2 g/L) containing the test compounds) and cells were irradiated with UVA (15 J/cm 2 ). The irradiation medium was replaced by culture medium including again the test compounds incubated for 48 hours. After incubation the quantity of matrix metallopeptidase 1 (MMP-1 ) in the culture supernatant was measured using an ELISA kit.
Table B10: Stimulation of 5-O-rhamnosides on UV-induced MMP-1 release in NHDF cells
Flavonoid-5-O-rhamnosides showed high activities on MMP-1 levels in NHDF. NR1 caused a dramatic upregulation of MMP-1 biosynthesis nearly 4-fold in UV-irradiated conditions.
MMP-1 also known as interstitial collagenase is responsible for collagen degradation in human tissues. Here, MMP-1 plays important roles in pathogenic arthritic diseases but was also correlated with cancer via metastasis and tumorigenesis (Vincenti (2002) Arthritis Res 4:157-164, Henckels (2013) F1000Research 2:229). Additionally, MMP-1 activity is important in early stages of wound healing (Caley (2015) Adv Wound Care 4: 225-234). Thus, MMP-1 regulating compounds can be useful in novel wound care therapies, especially if they possess anti-inflammatory and VEGF activities as stated above.
NR1 even enables novel therapies against arthritic diseases via novel biological regulatory targets. For example, MMP-1 expression is regulated via global MAPK or NFKB pathways (Vincenti and Brinckerhoff 2002, Arthritis Research 4(3):157-164). Since flavonoid-5-O-rhamnosides are disclosed here to possess anti-inflammatory activities and reduce IL-8, TNFcs, and PGE-2 release, pathways that are also regulated by MAPK and NFKB. Thus, one could speculate that MMP-1 stimulation by flavonoid-5-O-rhamnosides is due to another, unknown pathway that might be addressed by novel pharmaceuticals to fight arthritic disease.
Current dermocosmetic concepts to reduce skin wrinkles address the activity of collagenase. Next to collagenase inhibition one contrary concept is to support its activity. In this concept misfolded collagene fibres that solidify wrinkles within the tissue are degraded by the action of collagenases. Simultaneously, new collagene has to be synthetized by the tissue to rebuild skin firmness. In this concept, the disclosed flavonoid-5-O-rhamnosides combine ideal activities as they show stimulating activity of procollagen and MMP-1.
Finally, MMP-1 upregulating flavonoid-5-O-rhamnosides serve as drugs in local therapeutics to fight abnormal collagene syndroms like Dupuytren's contracture.
Example D-5: Modulation of transcriptional regulators by fiavonoid-5-O-rhamnosides NF- Β activity in fibroblasts
NIH3T3-KBF-Luc cells were stably transfected with the KBF-Luc plasmid (Sancho (2003) Mol Pharmacol 63:429-438), which contains three copies of NF-κΒ binding site (from major histocompatibility complex promoter), fused to a minimal simian virus 40 promoter driving the luciferase gene. Cells (1x10 4 for NIH3T3-KBF-Luc) were seeded the day before the assay on 96- well plate. Then the cells were treated with the test substances for 15 min and then stimulated with 30 ng/ml of TNFa. After 6 h, the cells were washed twice with PBS and lysed in 50μΙ lysis buffer containing 25 mM Tris-phosphate (pH 7.8), 8 mM MgCI2, 1 mM DTT, 1% Triton X-100, and 7% glycerol during 15 min at RT in a horizontal shaker. Luciferase activity was measured using a GloMax 96 microplate luminometer (Promega) following the instructions of the luciferase assay kit (Promega, Madison, Wl, USA). The RLU was calculated and the results expressed as percentage of inhibition of NF-κΒ activity induced by TNFa (100% activation) (tables B10.1-B10.3). The experiments for each concentration of the test items were done in triplicate wells.
Table B10.1 : Influence of 5-O-rhamnosides on NF-κΒ activity in NIH3T3 cells
Table B10.2: Influence of 5-O-rhamnosides on NF- Β activity in NIH3T3 cells
DR2 10μΜ 211150 215320 213260 213243 189880 145.6
DR2 25μΜ 245900 241550 234880 240777 217413 166.7
Biochanin A ΙΟμΜ 588070 586440 579220 584577 561213 430.4
Biochanin A 25μ 570360 573190 594510 579353 555990 426.4
BR1 10μΜ 259120 247590 229500 245403 222040 170.3
BR1 25μΜ 211660 208010 203720 207797 184433 141.4
BR2 10μ 205410 202640 202940 203663 180300 138.3
BR2 25μΜ 237390 235850 235350 236197 212833 163.2
Table B10.3: Influence of 5-O-rhamnosides on NF-scB activity in NIH3T3 cells
It was reported that NF-κΒ activity is reduced by many flavonoids (Prasad (2010) Planta Med 76: 1044-1063). Chrysin was reported to inhibit NF-κΒ activity through the inhibition of ΙκΒα phosphorylation (Romier(2008) Brit J Nutr 100: 542-551 ). However, when NIH3T3-KBF-Luc cells were stimulated with TNFa the activty of NF- Β was generally co-stimulated by flavonoids and their 5-O-rhamnosides at 10 μΜ and 25 μΜ, respectively.
STAT3 activity
HeLa-STAT3-luc cells were stably transfected with the plasmid 4xM67 pTATA TK-Luc. Cells (20 x10 3 cells/ml) were seeded 96-well plate the day before the assay. Then the cells were treated with the test substances for 15 min and then stimulated with IFN-y 25 Ill/ml. After 6 h, the cells were washed twice with PBS and lysed in 50μΙ lysis buffer containing 25 mM Tris-phosphate (pH 7.8), 8 mM MgCI 2> 1 mM DTT, 1% Triton X-100, and 7% glycerol during 15 min at RT in a horizontal shaker. Luciferase activity was measured using GloMax 96 microplate luminometer (Promega) following the instructions of the luciferase assay kit (Promega, Madison, Wl, USA). The RLU was calculated and the results were expressed as percentage of inhibition of STAT3 activity induced by IFN-γ (100% activation) (tables B1 1.1-B11.3). The experiments for each concentration of the test items were done in triplicate wells.
Table B11.1 : STAT3 activation by flavonoids and their 5-O-rhamnosides in HeLa cells
Siflbinin 50μΜ 12157 1 1885 10540 11527 9692 120.55
Table B11.3: STAT3 activation by flavonoids and their 5-O-rhamnosides in HeLa cells
RLU 1 RLU 2 RLU 3 MEAN RLU %
specific Activation
Control 2312 2233 2173 2239 0 0
IFNY 25U/ml 11375 10852 11269 11 165 9158 100
SR1 25MM+IFNY 25U/ml 9507 1 1653 10203 10454 8447 92.24
SR1 SOpM+IFNy 25U/ml 10090 1 1355 10938 10794 8787 95.95
STAT3 is a transcriptional factor of many genes related to epidermal homeostasis. Its activity has effects on tissue repair and injury healing but also is inhibiting on hair follicle regeneration (Liang (2012) J Neurosci32: 10662-10673). STAT3 activity may even promote melanoma and increases expression of genes linked to cancer and metastasis (Cao(2016) Sci. Rep. 6, 21731 ).
Example D-6: Alteration of glucose uptake into cells by flavonoid 5-O-rhamnosides Determination of glucose uptake in keratinocytes
HaCaT cells (5x10 4 ) were seeded in 96-well black plates and incubated for 24h. Then, medium was removed and the cells cultivated in OptiME , labeled with 50μ 2-NBDG (2-[N-(7-nitrobenz- 2-oxa-1 ,3-diazol-4-yl) amino]-2-deoxy-D-glucose and treated with the test substances or the positive control, Rosiglitazone, for 24 h. Medium was removed and the wells were carefully washed with PBS and incubated in PBS (Ι ΟΟμΙ/well). Finally the fluorescence was measured using the Incucyte FLR software, the data were analyzed by the total green object integrated intensity (GCUxMm2xWe!l) of the imaging system IncuCyte HD (Essen Bioscience). The fluorescence of Rosiglitazone is taken as 100% of glucose uptake, and the glucose uptake was calculated as (% Glucose uptake) = 100(T - B)/(R - B), where T (treated) is the fluorescence of test substance- treated cells, B (Basal) is the fluorescence of 2-NBDG cells and P (Positive control) is the fluorescence of cells treated with Rosiglitazone. Results of triplicate measurements are given in tables B12.1 and B12.2.
Table B12.1 : Influence of flavonoid 5-O-rhamnosides on Glucose uptake in HaCaT cells 2 NBD + 1 2 3 specific Glucose uptake
Control 8945 6910 3086 6314 0 0.0
2NBDG 50μΜ 176818 359765 312467 283017 276703 0.0
Rosiglitazone 776381 707003 1 141924 875103 868789 100.0 80μΜ
HESR1 25μ 756943 549324 384251 563506 557192 64.1
HESR1 50μ 501977 642949 529620 558182 551868 63.5 s a. NR1 25μ 493970 1160754 649291 768005 761691 87.7
§ NR1 50μΜ 278134 256310 257198 263881 257567 29.6
CD
CR1 25μΜ 291406 3581 14 628963 426161 419847 48.3
CR1 50μΜ 619992 595330 174412 463245 456931 52.6
CR2 25μ 427937 431593 390512 416681 410367 47.2
CR2 50μΜ 771478 1 100390 923151 931673 925359 106.5
DR2 25μΜ 632398 940240 197738 590125 58381 1 67.2
DR2 50μΜ 2958363 1297231 2493030 2249541 2243227 258.2
Table B12.2: Influence of flavonold 5-O-rhamnosides on Glucose uptake in HaCaT cells
Next Patent: SHED, IN PARTICULAR FOR HOLDING PIGS