Background Art Epilepsies constitute a diverse collection of brain disorders that affect about 3% of the population at some time in their lives (Annegers, 1996). An epileptic seizure can be defined as an episodic change in behaviour caused by the disordered firing of populations of neurons in the central nervous system. This results in varying degrees of involuntary muscle contraction and often a loss of consciousness. Epilepsy syndromes have been classified into more than 40 distinct types based upon characteristic symptoms, types of seizure, cause, age of onset and EEG patterns (Commission on Classification and Terminology of the International League Against Epilepsy, 1989). However the single feature that is common to all syndromes is the persistent increase in neuronal excitability that is both occasionally and unpredictably expressed as a seizure.

A genetic contribution to the aetiology of epilepsy has been estimated to be present in approximately 40% of affected individuals (Gardiner, 2000). As epileptic seizures may be the end-point of a number of molecular aberrations that ultimately disturb neuronal synchrony, the genetic basis for epilepsy is likely to be heterogeneous. There are over 200 Mendelian diseases which include epilepsy as part of the phenotype. In these diseases, seizures are symptomatic of underlying

neurological involvement such as disturbances in brain structure or function. In contrast, there are also a number of"pure"epilepsy syndromes in which epilepsy is the sole manifestation in the affected individuals. These are termed idiopathic and account for over 60% of all epilepsy cases.

Idiopathic epilepsies have been further divided into partial and generalized sub-types. Partial (focal or local) epileptic fits arise from localized cortical discharges, so that only certain groups of muscles are involved and consciousness may be retained (Sutton, 1990).

However, in generalized epilepsy, EEG discharge shows no focus such that all subcortical regions of the brain are involved.

The idiopathic generalized epilepsies (IGE) are the most common group of inherited human epilepsies. Two broad groups of IGE are now known-the classical idiopathic generalized epilepsies (Commission on Classification and Terminology of the International League Against Epilepsy, 1989) and the newly recognized genetic syndrome of generalized epilepsy with febrile seizures plus (GEFS+) (Scheffer and Berkovic, 1997; Singh et al. 1999). The classical IGEs are divided into a number of clinically recognizable but overlapping sub-syndromes including childhood absence epilepsy (CAE), juvenile absence epilepsy, juvenile myoclonic epilepsy (JME) etc (Commission on Classification and Terminology of the International League Against Epilepsy, 1989; Roger et al.

1992). These sub-syndromes are identified by age of onset and the pattern of seizure types (absence, myoclonus and tonic-clonic).

For instance, JME is characterised by myoclonic jerks, tonic-clonic seizures or clonic-tonic-clonic seizures and occasionally generalized absences. Myoclonic seizures occur within the first few hours after arising from sleep and usually involve the upper extremities without impairing consciousness. JME is an inherited

condition in otherwise neurologically normal children that usually begins during the teenage years and affects up to 26% of all individuals with IGE. The EEG of JME patients shows a characteristic spike and wave pattern and in up to 30% of patients, seizures are triggered by photic stimulation.

The molecular genetic era has resulted in significant advances in classification, diagnosis and biological understanding of numerous inherited neurological disorders including muscular dystrophies, familial neuropathies and spinocerebellar degenerations. These disorders are all uncommon or rare and have simple Mendelian inheritance.

In contrast, common neurological diseases like epilepsy have complex inheritance where they are determined by multiple genes sometimes interacting with environmental influences. Molecular genetic advances in disorders with complex inheritance have been far more modest to date (Todd, 1999).

Most of the molecular genetic advances have occurred by a sequential three stage process. First a clinically homogeneous disorder is identified and its mode of inheritance determined. Second, linkage analysis is performed on carefully characterized clinical populations with the disorder. Linkage analysis is a process where the chromosomal localization of a particular disorder is narrowed down to approximately 0. 5% of the total genome.

Knowledge of linkage imparts no intrinsic biological insights other than the important clue as to where to look in the genome for the abnormal gene. Third, strategies such as positional cloning or the positional candidate approach are used to identify the aberrant gene and its specific mutations within the linked region (Collins, 1995).

Most work on the molecular genetics of classical IGEs has been done on JME where a locus in proximity or within the HLA region on chromosome 6p was first reported in 1988 (Greenberg et al. , 1988). Despite this finding, and

subsequent supporting mapping studies, genetic defects have not been found and the exact locus of the gene or genes, in relationship to the HLA region, remains controversial.

Recently, further loci for JME have been identified and include 18q21 and 5q34 localisations (Durner et al., 2001; Cossette et al. , 2002). While the responsible gene at the 18q21 locus has not been identified, a mutation in the GABRA1 gene located at 5q34 was found in an affected family mapping to this region (Cossette et al. , 2002).

However, despite this study it appears that GABRA1 is not a gene that is a common site for mutation in individuals with JME and additional genes responsible for the disorder need to be identified.

Identification of additional genes will assist in understanding the molecular mechanisms involved in the aetiology of epilepsy as well as other CNS disorders and potentially aid in the identification of novel therapies and diagnostics for the disorder.

Disclosure of the Invention The present inventors have determined that members of the NEDD4 family of proteins are associated with CNS disorders including epilepsy through the identification of mutations and variations in the NEDD4-2 and NEDD4 genes.

According to one aspect of the present invention there is provided an isolated nucleic acid molecule encoding a mutation or variation in a NEDD4 family member, selected from any one of, but not restricted to, the group consisting of NEDD4, NEDD4-2, WWP1, WWP2, AIP-4, Smurfl, Smurf2, NEDL1 or NEDL2, wherein said mutation or variation produces an epilepsy phenotype and/or other CNS disorder.

In one form of the invention the mutation or variation alters the ability of the NEDD4 family member to regulate sodium channel activity or sodium channel levels when compared to the wild-type NEDD4 family member.

Preferably the mutation or variation alters the ability of the NEDD4 family member to ubiquitinate sodium channels.

The mutation or variation may be in the coding region of the NEDD4 family member or may be in the regulatory regions such as the promoter, 5'untranslated region, or 3'untranslated region.

In one form of the invention the mutation or variation occurs in exon 9 of NEDD4-2 and results in the replacement of a glutamic acid residue with an alanine residue at amino acid position 271, or replacement of a serine residue with a leucine residue at amino acid position 233. The E271A mutation or variation occurs as a result of an A to C nucleotide substitution at position 812 of the NEDD4-2 coding sequence as illustrated in SEQ ID NO: 1. The S233L mutation or variation occurs as a result of a C to T nucleotide substitution at position 698 of the NEDD4-2 coding sequence as illustrated in SEQ ID NO: 2. Preferably the E271A and S233L mutations or variations create a phenotype of idiopathic generalized epilepsy, in particular juvenile myoclonic epilepsy.

In a further form of the invention the mutation or variation is in exon 15 of NEDD4-2 and results in the replacement of a histidine residue with a proline residue at amino acid position 515. The H515P mutation or variation occurs as a result of an A to C nucleotide substitution at position 1544 of the NEDD4-2 coding sequence as illustrated in SEQ ID NO: 3. Preferably the mutation or variation creates a phenotype of photosensitive epilepsy.

In a still further form of the invention the mutation or variation is in exon 12 of NEDD4 and results in the replacement of a leucine residue with a phenylalanine residue at amino acid position 340. The L340F mutation or variation occurs as a result of a C to T nucleotide substitution at position 1018 of the NEDD4 coding sequence as illustrated in SEQ ID NO: 4. Preferably the L340F

mutation or variation creates a phenotype of juvenile myoclonic epilepsy.

In a further form of the invention the mutation or variation is in exon 25 of NEDD4 and results in the replacement of a lysine residue with an arginine residue at amino acid position 766. The K766R mutation or variation occurs as a result of an A to G nucleotide substitution at position 2297 of the NEDD4 coding sequence as illustrated in SEQ ID NO: 5. Preferably the L340F mutation or variation creates a phenotype of idiopathic generalized epilepsy or photosensitive epilepsy.

In still further forms of the invention, the mutations or variations are the result of a C to T nucleotide substitution in intron 2 at position +58 of NEDD4-2 as illustrated in SEQ ID NO: 6, the deletion of a T nucleotide in intron 8 at position-32 of NEDD4-2 as illustrated in SEQ ID NO: 7, a C to T nucleotide substitution in exon 10 at position 825 of the NEDD4-2 coding sequence as illustrated in SEQ ID NO: 8, a G to A nucleotide substitution in intron 24 at position +14 of NEDD4-2 as illustrated in SEQ ID NO: 9, an insertion of 2 nucleotides (TG) in intron 27 at position +63 of NEDD4-2 as illustrated in SEQ ID NO: 10, a C to T nucleotide substitution in exon 26 at position 2553 of the NEDD4-2 coding sequence as illustrated in SEQ ID NO: 11, an A to G nucleotide substitution in intron 28 at position +22 of NEDD4-2 as illustrated in SEQ ID NO: 12, an A to G nucleotide substitution in intron 28 at position +33 of NEDD4-2 as illustrated in SEQ ID NO: 13, a C to T nucleotide substitution 82 base pairs upstream (5') of the NEDD4 coding sequence as illustrated in SEQ ID NO: 14, a C to T nucleotide substitution in exon 1 at position 33 of the NEDD4 coding sequence as illustrated in SEQ ID NO: 15, a C to T nucleotide substitution in exon 2 at position 81 of the NEDD4 coding sequence as illustrated in SEQ ID NO: 16, a T to C nucleotide substitution in intron 15 at position-44 of NEDD4 as illustrated in SEQ ID NO: 17, a C

to T nucleotide substitution in exon 22 at position 2052 of the NEDD4 coding sequence as illustrated in SEQ ID NO: 18, a T to C nucleotide substitution in exon 26 at position 2373 of the NEDD4 coding sequence as illustrated in SEQ ID NO: 19, or a G to A nucleotide substitution in intron 27 at position +42 of NEDD4 as illustrated in SEQ ID NO: 20.

In another aspect of the present invention there is provided an isolated nucleic acid molecule comprising the nucleotide sequence set forth in any one of SEQ ID NO: 1- 20.

In another aspect of the present invention there is provided an isolated nucleic acid molecule consisting the nucleotide sequence set forth in any one of SEQ ID NO: 1- 20.

The nucleic acid molecules and nucleotide sequences of the present invention can be engineered using methods accepted in the art so as to alter their gene-encoding sequences for a variety of purposes. These include, but are not limited to, modification of the cloning, processing, and/or expression of the gene product. PCR reassembly of gene fragments and the use of synthetic oligonucleotides allow the engineering of the gene nucleotide sequences of the invention. For example, oligonucleotide-mediated site-directed mutagenesis can introduce mutations or variations that create new restriction sites, alter glycosylation patterns and produce splice variants etc.

As a result of the degeneracy of the genetic code, a number of polynucleotide sequences encoding the mutant or variant genes of the invention, some that may have minimal similarity to the polynucleotide sequences of any known and naturally occurring gene, may be produced. Thus, the invention includes each and every possible variation of polynucleotide sequence that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard

triplet genetic code as applied to the polynucleotide sequence of the naturally occurring mutant or variant gene, and all such variations are to be considered as being specifically disclosed.

The nucleic acid molecules and nucleotide sequences of this invention include RNA, cDNA, genomic DNA, synthetic forms, and mixed polymers, both sense and antisense strands, and may be chemically or biochemically modified, as will be appreciated by those skilled in the art. Such modifications include labels, methylation, intercalators, alkylators and modified linkages. In some instances it may be advantageous to produce nucleic acid molecules and nucleotide sequences encoding a NEDD4 family member gene or its derivatives possessing a substantially different codon usage than that of the naturally occurring gene. For example, codons may be selected to increase the rate of expression of the peptide in a particular prokaryotic or eukaryotic host corresponding with the frequency that particular codons are utilized by the host.

Other reasons to alter the nucleotide sequence encoding the nucleic acid molecules of the invention without altering the encoded amino acid sequence include the production of RNA transcripts having more desirable properties, such as a greater half-life, than transcripts produced from the naturally occurring sequence.

The invention also encompasses production of the nucleic acid molecules of the invention, entirely by synthetic chemistry. Synthetic sequences may be inserted into expression vectors and cell systems that contain the necessary elements for transcriptional and translational control of the inserted coding sequence in a suitable host. These elements may include regulatory sequences, promoters, 5'and 3'untranslated regions and specific initiation signals (such as an ATG initiation codon and Kozak consensus sequence) which allow more efficient translation of sequences. In cases where the complete coding sequence including its initiation codon and

upstream regulatory sequences are inserted into the appropriate expression vector, additional control signals may not be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals as described above should be provided by the vector. Such signals may be of various origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of enhancers appropriate for the particular host cell system used (Scharf et al. , 1994).

Nucleic acid molecules that are complements of the sequences described herein may also be prepared.

The present invention allows for the preparation of purified polypeptides or proteins. In order to do this, host cells may be transfected with a nucleic acid molecule as described above. Typically, said host cells are transfected with an expression vector comprising a nucleic acid molecule according to the invention. A variety of expression vector/host systems may be utilized to contain and express the sequences. These include, but are not limited to, microorganisms such as bacteria transformed with plasmid or cosmid DNA expression vectors; yeast transformed with yeast expression vectors; insect cell systems infected with viral expression vectors (e. g., baculovirus); or mouse or other animal or human tissue cell systems. Mammalian cells can also be used to express a protein that is encoded by a specific nucleic acid molecule of the invention using various expression vectors including plasmid, cosmid and viral systems such as a vaccinia virus expression system. The invention is not limited by the host cell employed.

The nucleic acid molecules of the present invention can be stably expressed in cell lines to allow long term production of recombinant proteins in mammalian systems.

Sequences encoding the polypeptides of the invention can be transformed into cell lines using expression vectors which may contain viral origins of replication and/or

endogenous expression elements and a selectable marker gene on the same or on a separate vector. The selectable marker confers resistance to a selective agent, and its presence allows growth and recovery of cells which successfully express the introduced sequences. Resistant clones of stably transformed cells may be propagated using tissue culture techniques appropriate to the cell type.

The protein produced by a transformed cell may be secreted or retained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode a protein may be designed to contain signal sequences which direct secretion of the protein through a prokaryotic or eukaryotic cell membrane.

In addition, a host cell strain may be chosen for its ability to modulate expression of the inserted sequences or to process the expressed protein in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, glycosylation, phosphorylation, and acylation. Post-translational cleavage of a"prepro"form of the protein may also be used to specify protein targeting, folding, and/or activity. Different host cells having specific cellular machinery and characteristic mechanisms for post- translational activities (e. g. , CHO or HeLa cells), are available from the American Type Culture Collection (ATCC) and may be chosen to ensure the correct modification and processing of the foreign protein.

When large quantities of protein are needed such as for antibody production, vectors which direct high levels of expression may be used such as those containing the T5 or T7 inducible bacteriophage promoter. The present invention also includes the use of the expression systems described above in generating and isolating fusion proteins which contain important functional domains of the protein. These fusion proteins are used for binding, structural and functional studies as well as for the

generation of appropriate antibodies.

In order to express and purify the protein as a fusion protein, the appropriate nucleic acid molecules of the present invention are inserted into a vector which contains a nucleotide sequence encoding another peptide (for example, glutathionine succinyl transferase). The fusion protein is expressed and recovered from prokaryotic or eukaryotic cells. The fusion protein can then be purified by affinity chromatography based upon the fusion vector sequence and the relevant protein can subsequently be obtained by enzymatic cleavage of the fusion protein.

Fragments of polypeptides of the present invention may also be produced by direct peptide synthesis using solid-phase techniques. Automated synthesis may be achieved by using the ABI 431A Peptide Synthesizer (Perkin-Elmer). Various fragments of polypeptide may be synthesized separately and then combined to produce the full-length molecule.

According to still another aspect, the present invention provides an isolated polypeptide, said polypeptide being a NEDD4 family member selected from any one of, but not restricted to, the group consisting of NEDD4, NEDD4-2, WWP1, WWP2, AIP-4, Smurfl, Smurf2, NEDL1 or NEDL2, wherein a mutation or variation event has occurred and said mutation or variation event produces an epilepsy phenotype and/or other CNS disorder.

In one form of the invention the mutation or variation event alters the ability of the NEDD4 family member to regulate sodium channel activity or sodium channel levels when compared to the wild-type NEDD4 family member. Typically the mutation or variation event alters the ability of the NEDD4 family member to ubiquitinate sodium channels.

In one form of the invention, the mutation or variation event is a substitution in which a glutamic acid residue is replaced with an alanine residue. Preferably the substitution is at amino acid position 271 of the

NEDD4-2 protein as illustrated in SEQ ID NO: 21 and creates a phenotype of idiopathic generalised epilepsy, more preferably juvenile myoclonic epilepsy.

In a further form of the invention, the mutation or variation event is a substitution in which a serine residue is replaced with a leucine residue. Preferably the substitution is at amino acid position 233 of the NEDD4-2 protein as illustrated in SEQ ID NO: 22 and creates a phenotype of idiopathic generalised epilepsy, more preferably juvenile myoclonic epilepsy.

In a still further form of the invention, the mutation or variation event is a substitution in which a histidine residue is replaced with a proline residue.

Preferably the substitution is at amino acid position 515 of the NEDD4-2 protein as illustrated in SEQ ID NO: 23 and creates a phenotype of photosensitive epilepsy.

In a further form of the invention, the mutation or variation event is a substitution in which a leucine residue is replaced with a phenylalanine residue.

Preferably the substitution is at amino acid position 340 of the NEDD4 protein as illustrated in SEQ ID NO: 24 and creates a phenotype of juvenile myoclonic epilepsy.

In a still further form of the invention, the mutation or variation event is a substitution in which a lysine residue is replaced with an arginine residue.

Preferably the substitution is at amino acid position 766 of the NEDD protein as illustrated in SEQ ID NO: 25 and creates a phenotype of idiopathic generalised epilepsy or photosensitive epilepsy.

As used herein, a"mutation"or a"mutation event"or reference to"variation"or a"variation event"or a "mutation or variation event"may be taken as a reference to variance from the wild-type nucleic acid or amino acid sequence, which may produce an epilepsy and/or other CNS disorder phenotype or may produce an epilepsy and/or other CNS disorder phenotype in combination with other factors, genetic or otherwise.

In a further aspect of the invention there is provided a method of preparing a polypeptide as described above, comprising the steps of: (1) culturing host cells under conditions effective for production of the polypeptide; and (2) harvesting the polypeptide.

According to still another aspect of the invention there is provided a polypeptide which is the product of the process described above.

Substantially purified protein or fragments thereof can then be used in further biochemical analyses to establish secondary and tertiary structure for example by x-ray crystallography of the protein or by nuclear magnetic resonance (NMR). Determination of structure allows for the rational design of pharmaceuticals to interact with the mutant protein, alter protein charge configuration or charge interaction with other proteins, or to alter its function in the cell.

It will be appreciated that, having implicated the NEDD4 family in epilepsy and/or other CNS disorders based on the identification of mutations and variations in NEDD4-2 and NEDD4, mutant or variant members of this family including those of the present invention, will enable therapeutic methods for the treatment of epilepsy including, but not restricted to, idiopathic generalised epilepsy, generalised epilepsy with febrile seizures plus, febrile seizures, juvenile myoclonic epilepsy and photosensitive epilepsy, as well as diagnostic and prognostic applications to screen for and detect the presence of the mutated gene or gene product in individuals with epilepsy including, but not restricted to, idiopathic generalised epilepsy, generalised epilepsy with febrile seizures plus, febrile seizures, juvenile myoclonic epilepsy and photosensitive epilepsy, and/or other CNS disorders.

Therapeutic Applications

According to one aspect of the invention there is provided a method of treating epilepsy and/or other CNS disorders, comprising administering a selective antagonist, agonist or modulator of a NEDD4 family member when it contains a mutation or variation as described above, more particularly, a mutation or variation in NEDD4-2 or NEDD4 as illustrated in SEQ ID NO: 1-25.

In still another aspect of the invention there is provided the use of a selective antagonist, agonist or modulator of a NEDD4 family member when it contains a mutation or variation as described above, more particularly, a mutation or variation in NEDD4-2 or NEDD4 as illustrated in SEQ ID NO: 1-25, said mutation or variation resulting in an epilepsy and/or other CNS disorder phenotype, in the manufacture of a medicament for the treatment of the disorder.

In one aspect of the invention a suitable agonist, antagonist or modulator will restore wild-type function to the mutants or variants that form part of this invention or will negate the effects a mutant or variant has on cell function.

Using methods well known in the art, a mutant or variant of the invention may be used to produce antibodies specific for the mutant or variant polypeptide or to screen libraries of pharmaceutical agents to identify those that bind the mutant or variant polypeptide.

In one aspect, an antibody, which specifically binds to a mutant or variant of the invention, may be used directly as an antagonist or modulator, or indirectly as a targeting or delivery mechanism for bringing a pharmaceutical agent to cells or tissues that express the mutant or variant polypeptide.

In a still further aspect of the invention there is provided an antibody which is immunologically reactive with a polypeptide as described above, but not with a wild-type polypeptide.

Such antibodies may include, but are not limited to,

polyclonal, monoclonal, chimeric, and single chain antibodies as would be understood by the person skilled in the art.

For the production of antibodies, various hosts including rabbits, rats, goats, mice, humans, and others may be immunized by injection with a polypeptide as described or with any fragment or oligopeptide thereof which has immunogenic properties. Various adjuvants may be used to increase immunological response and include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface-active substances such as lysolecithin. Adjuvants used in humans include BCG (bacilli Calmette-Guerin) and Corynebacterium parvum.

It is preferred that the oligopeptides, peptides, or fragments used to induce antibodies to the mutant or variant polypeptides of the invention have an amino acid sequence consisting of at least 5 amino acids, and, more preferably, of at least 10 amino acids. It is also preferable that these oligopeptides, peptides, or fragments are identical to a portion of the amino acid sequence of the natural protein and contain the entire amino acid sequence of a small, naturally occurring molecule. Short stretches of amino acids from polypeptides of the present invention may be fused with those of another protein, such as KLH, and antibodies to the chimeric molecule may be produced.

Monoclonal antibodies to a mutant or variant polypeptide of the invention may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV- hybridoma technique. (For example, see Kohler et al., 1975; Kozbor et al. , 1985; Cote et al. , 1983; Cole et al., 1984).

Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening

immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature. (For example, see Orlandi et al. , 1989; Winter and Milstein, 1991).

Antibody fragments which contain specific binding sites for a mutant or variant polypeptide of the invention may also be generated. For example, such fragments include, F (ab') 2 fragments produced by pepsin digestion of the antibody molecule and Fab fragments generated by reducing the disulfide bridges of the F (ab') 2 fragments.

Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity. (For example, see Huse et al., 1989).

Various immunoassays may be used for screening to identify antibodies having the desired specificity.

Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art. Such immunoassays typically involve the measurement of complex formation between a protein and its specific antibody. A two-site, monoclonal-based immunoassay utilizing antibodies reactive to two non- interfering epitopes is preferred, but a competitive binding assay may also be employed.

In a further aspect of the invention there is provided a method of treating epilepsy and/or other CNS disorders, comprising administering an isolated DNA molecule which is the complement (antisense) of any one of the nucleic acid molecules described above and which is, or encodes for, an RNA molecule that hybridizes with the mRNA encoding a mutant or variant of the invention, to a subject in need of such treatment.

Typically, a vector expressing the complement (antisense) of the nucleic acid molecules of the invention may be administered to a subject in need of such treatment. Many methods for introducing vectors into cells

or tissues are available and equally suitable for use in vivo, in vitro, and ex vivo. For ex vivo therapy, vectors may be introduced into stem cells taken from the patient and clonally propagated for autologous transplant back into that same patient. Delivery by transfection, by liposome injections, or by polycationic amino polymers may be achieved using methods which are well known in the art.

(For example, see Goldman et al. , 1997).

Additional antisense or gene-targeted silencing strategies may include, but are not limited to, the use of antisense oligonucleotides, injection of antisense RNA, transfection of antisense RNA expression vectors, and the use of RNA interference (RNAi) or short interfering RNAs (siRNA). Still further, catalytic nucleic acid molecules such as DNAzymes and ribozymes may be used for gene silencing (Breaker and Joyce, 1994; Haseloff and Gerlach, 1988). These molecules function by cleaving their target mRNA molecule rather than merely binding to it as in traditional antisense approaches.

In a further aspect, a suitable agonist, antagonist or modulator may include agents such as peptides, phosphopeptides or small organic or inorganic compounds that can restore wild-type activity to the mutants and variants of the invention as described above.

Peptides, phosphopeptides or small organic or inorganic compounds suitable for therapeutic applications may be identified using the mutant or variant nucleic acid molecules and polypeptides of the invention in drug screening applications as described below.

There is therefore provided a method of treating epilepsy and/or other CNS disorders comprising administering a suitable agonist, antagonist or modulator of a NEDD4 family member and that has been identified using the mutations or variations of the invention.

In some instances, an appropriate approach for treatment may be combination therapy. This may involve administering an antagonist, agonist or modulator to a

polypeptide of the invention, administering an antibody to a polypeptide of the invention, or administering a complement (antisense) to a mutant or variant nucleic acid molecule of the invention, so as to inhibit its functional effect, combined with administration of the equivalent wild-type NEDD4 family member, which in combination may restore function to normal levels. The appropriate wild- type NEDD4 family member can be administered using gene therapy approaches as described above for complement administration.

There is therefore provided a method of treating epilepsy and/or other CNS disorders comprising administering an antagonist, agonist or modulator to a polypeptide of the invention, administering an antibody to a polypeptide of the invention, or administering a complement (antisense) to a mutant or variant nucleic acid molecule of the invention in combination with administration of the equivalent wild-type NEDD4 family member.

In still another aspect of the invention there is provided the use of an antagonist, agonist or modulator to a polypeptide of the invention, use of antibody to a polypeptide of the invention, or use of a complement to a mutant or variant nucleic acid molecule of the invention in combination with the use of the equivalent wild-type NEDD4 family member, in the manufacture of a medicament for the treatment of epilepsy and/or other CNS disorders.

In further embodiments, any of the agonists, antagonists, modulators, antibodies, complementary sequences or vectors of the invention may be administered in combination with other appropriate therapeutic agents.

Selection of the appropriate agents may be made by those skilled in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents may act synergistically to effect the treatment or prevention of epilepsy and/or other CNS disorders. Using this approach, therapeutic efficacy with lower dosages of

each agent may be possible, thus reducing the potential for adverse side effects.

Any of the therapeutic methods described above may be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.

Drug Screening According to still another aspect of the invention, nucleic acid molecules of the NEDD4 family as well as polypeptides of the NEDD4 family and cells expressing these, are useful for the screening of candidate pharmaceutical agents for the treatment of epilepsy and/or other CNS disorders.

Still further, it provides the use wherein high throughput screening techniques are employed.

Agents that can be screened in accordance with the invention include, but are not limited to peptides (such as soluble peptides), phosphopeptides and small organic or inorganic molecules (such as natural product or synthetic chemical libraries and peptidomimetics).

In one embodiment, a screening assay may include a cell-based assay utilising eukaryotic or prokaryotic host cells that are stably transformed with recombinant molecules expressing the polypeptides or fragments of the invention, in competitive binding assays. Binding assays will measure the formation of complexes between a specific mutant or variant polypeptide, and the agent being tested, or will measure the degree to which an agent being tested will inhibit or restore the formation of a complex between a specific mutant or variant polypeptide, and its interactor or ligand.

The invention is particularly useful for screening agents by using the polypeptides of the invention in transformed cells, transfected or injected oocytes, or animal models bearing mutations of the invention such as transgenic animals or gene targeted (knock-out and knock-

in) animals (see transformed hosts).

Non cell-based assays may also be used for identifying agents that can inhibit or restore binding between the polypeptides of the invention and their interactors. Such assays are known in the art and include for example AlphaScreen technology (PerkinElmer Life Sciences, MA, USA). This application relies on the use of beads such that each interaction partner is bound to a separate bead via an antibody. Interaction of each partner will bring the beads into proximity, such that laser excitation initiates a number of chemical reactions ultimately leading to fluorophores emitting a light signal. Candidate agents that inhibit the binding of the mutant with its interactor will result in loss of light emission, while candidate agents that restore the binding of the mutant with its interactor will result in positive light emission. These assays ultimately enable identification and isolation of the candidate agents.

High-throughput drug screening techniques may also employ methods as described in W084/03564. Small peptide test agents synthesised on a solid substrate can be assayed for mutant or variant polypeptide binding. Bound mutant or variant polypeptide is then detected by methods well known in the art. In a variation of this technique, purified polypeptides of the invention can be coated directly onto plates to identify interacting test agents.

The invention also contemplates the use of competition drug screening assays in which neutralizing antibodies capable of specifically binding the mutant or variant polypeptide compete with a test agent for binding thereto. In this manner, the antibodies can be used to detect the presence of any peptide that shares one or more antigenic determinants of the mutant or variant.

The polypeptides of the present invention may also be used for screening agents developed as a result of combinatorial library technology. This provides a way to test a large number of different substances for their

ability to modulate activity of a polypeptide. An agent identified as a modulator of polypeptide function may be peptide or non-peptide in nature. Non-peptide"small molecules"are often preferred for many in vivo pharmaceutical applications. In addition, a mimic or mimetic of the substance may be designed for pharmaceutical use. The design of mimetics based on a known pharmaceutically active compound ("lead"compound) is a common approach to the development of novel pharmaceuticals. This is often desirable where the original active agent is difficult or expensive to synthesise or where it provides an unsuitable method of administration. In the design of a mimetic, particular parts of the original active agent that are important in determining the target property are identified. These parts or residues constituting the active region of the agent are known as its pharmacophore. Once found, the pharmacophore structure is modelled according to its physical properties using data from a range of sources including x-ray diffraction data and NMR. A template molecule is then selected onto which chemical groups which mimic the pharmacophore can be added. The selection can be made such that the mimetic is easy to synthesise, is likely to be pharmacologically acceptable, does not degrade in vivo and retains the biological activity of the lead compound. Further optimisation or modification can be carried out to select one or more final mimetics useful for in vivo or clinical testing.

It is also possible to isolate a target-specific antibody and then solve its crystal structure. In principle, this approach yields a pharmacophore upon which subsequent drug design can be based as described above. It may be possible to avoid protein crystallography altogether by generating anti-idiotypic antibodies (anti- ids) to a functional, pharmacologically active antibody.

As a mirror image of a mirror image, the binding site of the anti-ids would be expected to be an analogue of the

original receptor. The anti-id could then be used to isolate peptides from chemically or biologically produced peptide banks.

Another alternative method for drug screening relies on structure-based rational drug design. Determination of the three dimensional structure of the polypeptides of the invention allows for structure-based drug design to identify biologically active lead compounds.

Three dimensional structural models can be generated by a number of applications, some of which include experimental models such as x-ray crystallography and NMR and/or from in silico studies of structural databases such as the Protein Databank (PDB). In addition, three dimensional structural models can be determined using a number of known protein structure prediction techniques based on the primary sequences of the polypeptides (e. g.

SYBYL-Tripos Associated, St. Louis, MO), de novo protein structure design programs (e. g. MODELER-MSI Inc. , San Diego, CA, or MOE-Chemical Computing Group, Montreal, Canada) or ab initio methods (e. g. see US Patent Numbers 5331573 and 5579250).

Once the three dimensional structure of a polypeptide has been determined, structure-based drug discovery techniques can be employed to design biologically-active agents based on these three dimensional structures. Such techniques are known in the art and include examples such as DOCK (University of California, San Francisco) or AUTODOCK (Scripps Research Institute, La Jolla, California). A computational docking protocol will identify the active site or sites that are deemed important for protein activity based on a predicted protein model. Molecular databases, such as the Available Chemicals Directory (ACD) are then screened for molecules that complement the protein model.

Using methods such as these, potential clinical drug candidates can be identified and computationally ranked in order to reduce the time and expense associated with

typical wet lab'drug screening methodologies.

Agents identified through screening procedures as described above, and which are based on the use of the mutant or variant nucleic acid molecules and polypeptides of the invention form a part of the present invention, as do pharmaceutical compositions containing these and a pharmaceutically acceptable carrier.

Pharmaceutical Preparations Agents identified from screening assays and shown to restore wild-type activity can be administered to a patient at a therapeutically effective dose to treat or ameliorate epilepsy and/or other CNS disorders. A therapeutically effective dose refers to that amount of the agent sufficient to result in amelioration of symptoms of the disorder.

Toxicity and therapeutic efficacy of such agents can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The data obtained from these studies can then be used in the formulation of a range of dosages for use in humans.

Pharmaceutical compositions for use in accordance with the present invention can be formulated in a conventional manner using one or more physiological acceptable carriers, excipients or stabilisers which are well known. Acceptable carriers, excipients or stabilizers are non-toxic at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including absorbic acid; low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins ; binding agents including hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, arginine or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol;

salt-forming counterions such as sodium; and/or non-ionic surfactants such as Tween, Pluronics or polyethylene glycol (PEG).

The formulation of pharmaceutical compositions for use in accordance with the present invention will be based on the proposed route of administration. Routes of administration may include, but are not limited to, inhalation, insufflation (either through the mouth or nose), oral, intravenous, buccal, rectal or parental administration.

Diagnostic and Prognostic Applications Nucleic acid molecules of the present invention may be used for the diagnosis or prognosis of epilepsy and/or other CNS disorders, and the use of the nucleic acid molecules incorporated as part of the invention in diagnosis or prognosis of epilepsy and/or other CNS disorders, or a predisposition to epilepsy and/or other CNS disorders, is therefore contemplated.

The nucleic acid molecules that may be used for diagnostic or prognostic purposes include oligonucleotide sequences, genomic DNA and complementary RNA and DNA molecules. The nucleic acid molecules may be used to detect and quantitate gene expression in biological samples. Genomic DNA used for the diagnosis may be obtained from body cells, such as those present in the blood, tissue biopsy, surgical specimen, or autopsy material. The DNA may be isolated and used directly for detection of a specific sequence or may be amplified by the polymerase chain reaction (PCR) prior to analysis.

Similarly, RNA or cDNA may also be used, with or without PCR amplification. To detect a specific nucleic acid sequence, hybridisation using specific oligonucleotides, restriction enzyme digest and mapping, PCR mapping, RNAse protection, and various other methods may be employed.

Oligonucleotides specific to particular sequences can be chemically synthesized and labelled radioactively or

nonradioactively and hybridised to individual samples immobilized on membranes or other solid-supports or in solution. The presence, absence or excess expression of any one of the mutant or variant genes of the invention may then be visualized using methods such as autoradiography, fluorometry, or colorimetry.

In a further diagnostic or prognostic approach, the nucleic acid molecules and nucleotide sequences of the invention may be useful in assays that detect the presence of epilepsy and/or other CNS disorders. The nucleic acid molecules and nucleotide sequences may be labelled by standard methods and added to a fluid or tissue sample from a patient under conditions suitable for the formation of hybridisation complexes. After a suitable incubation period, the sample is washed and the signal is quantitated and compared with a standard value. If the amount of signal in the patient sample is significantly altered in comparison to a control sample then the presence of altered levels of nucleotide sequences in the sample indicates the presence of the associated disorder. Such assays may also be used to evaluate the efficacy of a particular therapeutic treatment regimen in animal studies, in clinical trials, or to monitor the treatment of an individual patient.

In order to provide a basis for the diagnosis or prognosis of epilepsy and/or other CNS disorders which are associated with mutations or variations of the invention, the nucleotide sequence of each mutant or variant can be compared between normal tissue and diseased tissue in order to establish whether the patient expresses a mutant or variant gene.

In order to provide a basis for the diagnosis or prognosis of epilepsy and/or other CNS disorders associated with abnormal expression of a mutant or variant of the invention, a normal or standard profile for expression is established. This may be accomplished by combining body fluids or cell extracts taken from normal

subjects, either animal or human, with a sequence, or a fragment thereof, encoding the relevant NEDD4 family member, under conditions suitable for hybridisation or amplification. Standard hybridisation may be quantified by comparing the values obtained from normal subjects with values from an experiment in which a known amount of a substantially purified polynucleotide is used. Another method to identify a normal or standard profile for expression is through quantitative RT-PCR studies. RNA isolated from body cells of a normal individual is reverse transcribed and real-time PCR using oligonucleotides specific for a relevant NEDD4 family member is conducted to establish a normal level of expression of the gene.

Standard values obtained in both these examples may be compared with values obtained from samples from patients who are symptomatic for epilepsy and/or other CNS disorders. Deviation from standard values is used to establish the presence of epilepsy and/or other CNS disorders.

Once the presence of epilepsy and/or other CNS disorders is established and a treatment protocol is initiated, hybridisation assays or quantitative RT-PCR studies may be repeated on a regular basis to determine if the level of expression in the patient begins to approximate that which is observed in the normal subject.

The results obtained from successive assays may be used to show the efficacy of treatment over a period ranging from several days to months.

According to a further aspect of the invention there is provided the use of a polypeptide as described above in the diagnosis or prognosis of epilepsy and/or other CNS disorders.

When a diagnostic or prognostic assay is to be based upon polypeptides of the invention, a variety of approaches are possible. For example, diagnosis or prognosis can be achieved by monitoring differences in the electrophoretic mobility of the mutant or variant

polypeptides of the invention and their normal counterparts. Such an approach will be particularly useful in identifying mutants or variants in which charge substitutions are present, or in which insertions, deletions or substitutions have resulted in a significant change in the electrophoretic migration of the resultant protein. Alternatively, diagnosis or prognosis may be based upon differences in the proteolytic cleavage patterns of normal and mutant or variant proteins, differences in molar ratios of the various amino acid residues, or by functional assays demonstrating altered function of the gene products.

In another aspect, antibodies that specifically bind mutant or variant polypeptides of the invention may be used for the diagnosis or prognosis of epilepsy and/or other CNS disorders, or in assays to monitor patients being treated with agonists, antagonists, modulators or inhibitors of the polypeptides of the invention.

Antibodies useful for diagnostic or prognostic purposes may be prepared in the same manner as described above for therapeutics. Diagnostic or prognostic assays would include methods that utilize the antibody and a label to detect the relevant mutant or variant polypeptide of the invention in human body fluids or in extracts of cells or tissues. The antibodies may be used with or without modification, and may be labelled by covalent or non- covalent attachment of a reporter molecule.

A variety of protocols for measuring the presence of a mutant or variant polypeptide, including but not restricted to, ELISAs, RIAs, and FACS, are known in the art and provide a basis for diagnosing or prognosing epilepsy and/or other CNS disorders. The expression of a mutant or variant polypeptide is established by combining body fluids or cell extracts taken from test mammalian subjects, preferably human, with antibody to the mutant polypeptide under conditions suitable for complex formation. The amount of complex formation may be

quantitated by various methods, preferably by photometric means. Antibodies specific for the mutant or variant polypeptide will only bind to individuals expressing the said mutant or variant polypeptide and not to individuals expressing only wild-type polypeptide (i. e. normal individuals). This establishes the basis for diagnosing or prognosing the epilepsy and/or other CNS disorders.

Once an individual has been diagnosed or prognosed with epilepsy and/or other CNS disorders, effective treatments can be initiated as described above.

Microarray In further embodiments, complete cDNAs, oligonucleotides or longer fragments derived from any of the nucleic acid molecules described herein may be used as probes in a microarray. The microarray can be used to diagnose or prognose through the identification of genetic variants, mutations, and polymorphisms in the nucleic acid molecules that form part of the invention, to understand the genetic basis of epilepsy and/or other CNS disorders, or can be used to develop and monitor the activities of therapeutic agents.

According to a further aspect of the present invention, tissue material obtained from animal models generated as a result of the identification of mutations and variations (see below), particularly those disclosed in the present invention, can be used in microarray experiments. These experiments can be conducted to identify the level of expression of the mutant or variant, or any cDNA clones from whole-tissue libraries, in diseased tissue as opposed to normal control tissue.

Variations in the expression level of genes between the two tissues indicates their possible involvement in the disease process either as a cause or consequence of the original mutation or variation present in the animal model. These experiments may be used to determine gene function, to understand the genetic basis of epilepsy

and/or CNS other disorders, to diagnose or prognose epilepsy and/or other CNS disorders, and to develop and monitor the activities of therapeutic agents. Microarrays may be prepared, used, and analyzed using methods known in the art. (For example, see Schena et al. , 1996; Heller et al. , 1997).

Transformed Hosts The present invention also provides for the production of genetically modified (knock-out, knock-in and transgenic), non-human animal models comprising the nucleic acid molecules of the invention. These animals are useful for the study of gene function, to study the mechanisms by which mutations of the invention give rise to disease and the effects of these mutations on tissue development, for the screening of candidate pharmaceutical compounds, for the creation of explanted mammalian cell cultures which express the mutants or variants, and for the evaluation of potential therapeutic interventions.

Animal species which are suitable for use in the animal models of the present invention include, but are not limited to, rats, mice, hamsters, guinea pigs, rabbits, dogs, cats, goats, sheep, pigs, and non-human primates such as monkeys and chimpanzees. For initial studies, genetically modified mice and rats are highly desirable due to the relative ease in generating knock-in, knock-out or transgenics of these animals, their ease of maintenance and their shorter life spans. For certain studies, transgenic yeast or invertebrates may be suitable and preferred because they allow for rapid screening and provide for much easier handling. For longer term studies, non-human primates may be desired due to their similarity with humans.

To create an animal model for a mutant or variant gene of the invention several methods can be employed. These include, but are not limited to, generation of a specific mutation or variation in a homologous animal

gene, insertion of a wild type human gene and/or a humanized animal gene by homologous recombination, insertion of a mutant or variant human gene as genomic or minigene cDNA constructs using wild type, mutant or artificial promoter elements, or insertion of artificially modified fragments of the endogenous gene by homologous recombination. The modifications include insertion of mutant stop codons, the deletion of DNA sequences, or the inclusion of recombination elements (lox p sites) recognized by enzymes such as Cre recombinase.

To create transgenic mice in order to study gain of gene function in vivo, any mutant or variant of the invention can be inserted into a mouse germ line using standard techniques such as oocyte microinjection. Gain of gene function can mean the over-expression of a gene and its protein product, or the genetic complementation of a mutation or variation of the gene under investigation. For oocyte injection, one or more copies of the mutant or variant gene can be inserted into the pronucleus of a just-fertilized mouse oocyte. This oocyte is then reimplanted into a pseudo-pregnant foster mother. The live-born mice can then be screened for integrants using analysis of tail DNA for the presence of the relevant human gene sequence. The transgene can be either a complete genomic sequence injected as a YAC, BAC, PAC or other chromosome DNA fragment, a cDNA with either the natural promoter or a heterologous promoter, or a minigene containing all of the coding region and other elements found to be necessary for optimum expression.

To generate knock-out mice or knock-in mice, gene targeting through homologous recombination in mouse embryonic stem (ES) cells may be applied. Knock-out mice are generated to study loss of gene function in vivo while knock-in mice allow the study of gain of function or to study the effect of specific gene mutations or variations.

Knock-in mice are similar to transgenic mice however the integration site and copy number are defined in the

former.

For knock-out mouse generation, gene targeting vectors can be designed such that they disrupt (knock-out) the protein coding sequence of the relevant NEDD4 gene in the mouse genome. This disruption is typically mediated by homologous recombination (Joyner, 2000) in murine embryonic stem cells or can be mediated by other technologies such as siRNA vectors that target the relevant gene (Kunath et al. , 2003). Knock-out animals of the invention will comprise a functional disruption of any one of the NEDD4 family members such that the relevant gene does not express a biologically active product. It can be substantially deficient in at least one functional activity coded for by the gene. Expression of the polypeptide encoded by the gene can be substantially absent (i. e. essentially undetectable amounts are made) or may be deficient in activity such as where only a portion of the gene product is produced. In contrast, knock-in mice can be produced whereby a gene targeting vector containing the relevant gene can integrate into a defined genetic locus in the mouse genome. For both applications, homologous recombination is catalysed by specific DNA repair enzymes that recognise homologous DNA sequences and exchange them via double crossover.

Gene targeting vectors are usually introduced into ES cells using electroporation. ES cell integrants are then isolated via an antibiotic resistance gene present on the targeting vector and are subsequently genotyped to identify those ES cell clones in which the gene under investigation has integrated into the locus of interest.

The appropriate ES cells are then transmitted through the germline to produce a novel mouse strain.

In instances where gene ablation results in early embryonic lethality, conditional gene targeting may be employed. This allows genes to be deleted in a temporally and spatially controlled fashion. As above, appropriate ES cells are transmitted through the germline to produce a

novel mouse strain, however the actual deletion of the gene is performed in the adult mouse in a tissue specific or time controlled manner. Conditional gene targeting is most commonly achieved by use of the cre/lox system. The enzyme cre is able to recognise the 34 base pair loxP sequence such that loxP flanked (or floxed) DNA is recognised and excised by cre. Tissue specific cre expression in transgenic mice enables the generation of tissue specific knock-out mice by mating gene targeted floxed mice with cre transgenic mice. Knock-out can be conducted in every tissue (Schwenk et al. , 1995) using the deleter'mouse or using transgenic mice with an inducible cre gene (such as those with tetracycline inducible cre genes), or knock-out can be tissue specific for example through the use of the CD19-cre mouse (Rickert et al., 1997).

Once knock-in animals have been produced they can subsequently be used to study the extent and mechanisms of disease, as well as for the screening of candidate therapeutic compounds.

According to still another aspect of the invention there is provided the use of genetically modified non- human animals in which a NEDD4 family member is expressed or disrupted, as well as use of those genetically modified non-human animals described above, for the screening of candidate pharmaceutical compounds (see drug screening above). These animals are also useful for the evaluation (eg therapeutic efficacy, toxicity, metabolism) of candidate pharmaceutical compounds, including those identified from the invention as described above, for the treatment of epilepsy and/or other CNS disorders.

It will be clearly understood that, although a number of prior art publications are referred to herein, this reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art, in Australia or in any other country.

Throughout this specification and the claims, the

words"comprise", "comprises"and"comprising"are used in a non-exclusive sense, except where the context requires otherwise.

It will be apparent to the person skilled in the art that while the invention has been described in some detail for the purposes of clarity and understanding, various modifications and alterations to the embodiments and methods described herein may be made without departing from the scope of the inventive concept disclosed in this specification.

Brief Description of the Drawings Figure 1: Effects of the NEDD4-2 S233L and H515P mutations or variations on the amplitude of inward Na+ currents mediated by SCN2A.

Figure 2: Effects of the NEDD4-2 S233L and H515P mutations or variations on the amplitude of inward Na+ currents mediated by SCN3A.

Modes for Performing the Invention Example 1: Mutation analysis of NEDD4-2 and NEDD4 A locus for juvenile myoclonic epilepsy has previously been mapped to chromosome 18q21 (Durner et al., 2001. Single stranded conformation polymorphism (SSCP) analysis and sequencing were performed on individuals affected with epilepsy, including JME, to identify disease causing mutations in NEDD4-2, a candidate gene mapping to this region, and subsequently NEDD4, another member of the NEDD4 family of proteins.

A large collection of individuals affected with epilepsy underwent careful clinical phenotyping and additional data regarding their family history was collated. Informed consent was obtained from each individual for blood collection and its use in subsequent experimental procedures. Clinical phenotypes incorporated classical IGE cases, including JME, as well as GEFS+, febrile seizure and photosensitive epilepsy cases. In

addition, control blood bank samples from normal individuals were included in screening procedures.

DNA was extracted from collected blood using the QIAamp DNA Blood Maxi kit (Qiagen) according to manufacturers specifications or through procedures adapted from Wyman and White (1980). Stock DNA samples were kept at concentrations ranging from 200 ng/ul to 1 ug/ul.

In preparation for SSCP analysis, samples to be screened were formatted into 96-well plates at a concentration of 30 ng/ul. These master plates were subsequently used to prepare exon specific PCR reactions in the 96-well format.

Primers used for SSCP were labelled at their 5'end with HEX. The primers were designed within flanking NEDD4- 2 or NEDD4 introns to enable amplification of each exon of each gene. Primers used to amplify NEDD4-2 exons are shown in Table 1, whereas primers used to amplify NEDD4 exons are shown in Table 2. Typical PCR reactions were performed in a total volume of 10 pll using 30 ng of patient DNA. All PCR reactions contained 67 mM Tris-HCl (pH 8.8) ; 16.5 mM (NH4) 2SO4 ; 6.5 LM EDTA; 1.5 mM MgCl2 ; 200 pM each dNTP ; 10% DMSO; 0.17 mg/ml BSA; 5 pg/ml each primer and 100 U/ml Taq DNA polymerase. Typically, PCR reactions were performed using 10 cycles of 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 30 seconds followed by 25 cycles of 94°C for 30 seconds, 55°C for 30 seconds, and 72°C for 30 seconds. A final extension reaction for 10 minutes at 72°C followed.

Ten 1 of loading dye comprising 50% (v/v) formamide, 12.5 mM EDTA and 0. 02% (w/v) bromophenol blue were added to completed reactions which were subsequently run on non- denaturing 4% polyacrylamide gels with a cross-linking ratio of 35: 1 (acrylamide: bis-acrylamide) and containing 2% glycerol. Gel thickness was 100pm, width 168mm and length 160mm. Gels were run at 1200 volts and approximately 20mA, at 18°C and analysed on the GelScan 2000 system (Corbett Research, Australia) according to

manufacturers specifications.

PCR products showing a conformational change were subsequently sequenced. This first involved re- amplification of the amplicon from the relevant individual (primers used in this instance did not contain 5'HEX labels) followed by purification of the PCR amplified templates for sequencing using QiaQuick PCR preps (Qiagen) based on manufacturers procedures. The primers used to sequence the purified amplicons were identical to those used for the initial amplification step. For each sequencing reaction, 25 ng of primer and 100 ng of purified PCR template were used. The BigDye sequencing kit (ABI) was used for all sequencing reactions according to the manufacturer's specifications. The products were run on an ABI 377 Sequencer and analysed using the EditView program.

A total of 95 idiopathic generalised epilepsy (IGE) patients (72 unrelated), 95 generalised epilepsy with febrile seizures plus (GEFS+) patients (65 unrelated), 95 patients with febrile seizures (FS) (66 unrelated), 59 patients with photosensitive epilepsy (PS) (37 unrelated) and 95 blood bank samples were screened by fluorescent- SSCP analysis and sequencing. Tables 3 and 4 show the results of the SSCP analysis of the NEDD4-2 gene and the NEDD4 gene respectively in the patient samples tested.

A total of eleven nucleotide changes were identified in the NEDD4-2 gene that were likely to be causative of epilepsy. A mutation or variation in exon 9 of NEDD4-2 resulted in the replacement of an A to a C at position 812 of the coding sequence of the gene as illustrated in SEQ ID NO: 1. The nucleotide change results in the replacement of a glutamic acid residue with an alanine residue at position 271 of the encoded protein, as illustrated in SEQ ID NO: 21. This change was originally identified from screening of the IGE plate and was later shown to be present in an individual with photosensitive JME. This change was not observed in the normal population samples

tested, nor was it present in individuals affected with GEFS+ or FS.

The second mutation or variation detected in the NEDD4-2 gene was the result of a C to T nucleotide substitution at position 698 of the coding sequence of the gene as illustrated in SEQ ID NO: 2. This change results in the replacement of a serine amino acid residue with a leucine residue at position 233 of the encoded protein, as illustrated in SEQ ID NO: 22. This change was originally observed in a sample on the IGE plate and was later confirmed to be present in an individual with photosensitive JME. This change was also seen in a second patient with photosensitive JME and was also seen in one normal individual.

A third mutation or variation was detected in NEDD4-2 as a result of an A to C nucleotide substitution at position 1544 of the coding sequence of the gene as illustrated in SEQ ID NO: 3. This change results in the replacement of a histidine amino acid residue with a proline residue at position 515 of the encoded protein, as illustrated in SEQ ID NO: 23. This change was seen in an individual with photosensitive epilepsy only and was not seen in normal controls.

Each of the amino acids affected by the abovementioned mutations or variations are conserved across a number of members of the NEDD4 family including those from other species further supporting these mutations or variations as being causative of epilepsy and/or other CNS disorders.

Six intronic mutations or variations were also detected in NEDD4-2 in individuals with IGE, febrile seizures or photosensitive JME. The first was a C to T nucleotide substitution in intron 2 at position +58 of the NEDD4-2 gene as illustrated in SEQ ID NO: 6. The second was the deletion of a T nucleotide in intron 8 at position - 32 of the NEDD4-2 gene, as illustrated in SEQ ID NO: 7.

The third was a G to A nucleotide substitution in intron

24 at position +14 of the NEDD4-2 gene as illustrated in SEQ ID NO: 9. The fourth was an insertion of two nucleotides (TG) in intron 27 at position +63 of the NEDD4-2 gene, as illustrated in SEQ ID NO: 10. The fifth was an A to G nucleotide substitution in intron 28at position +22, as illustrated in SEQ ID NO: 12, and the sixth intronic mutation was an A to G nucleotide substitution in intron 28 at position +33, as illustrated in SEQ ID NO: 13. All of these intronic changes were not seen in the normal population samples tested, except the fourth change which was seen in one normal individual.

Also identified was a mutation or variation in NEDD4- 2 that was specific for an individual with GEFS+. This was a C to T nucleotide substitution in exon 10 at position 825 of the coding sequence of the NEDD4-2 gene, as illustrated in SEQ ID NO: 8. This change was not observed in the normal population samples tested.

Finally, a C to T nucleotide substitution in exon 26 at position 2553 of the coding sequence of NEDD4-2, as illustrated by SEQ ID NO: 11, was seen in an individual with GEFS+, an individual with photosensitive JME and was also seen in a normal individual.

These mutations or variations are the first to be seen in the NEDD4-2 gene that are responsible for epilepsy phenotypes.

A total of nine nucleotide changes were identified in the NEDD4 gene that were likely to be causative of epilepsy. A mutation or variation in exon 12 of NEDD4 resulted in the replacement of a C to a T at position 1018 of the coding sequence of the NEDD4 gene as illustrated in SEQ ID NO: 4. The nucleotide change results in the replacement of a leucine residue with a phenylalanine residue at position 340 of the encoded protein, as illustrated in SEQ ID NO: 24. The amino acid affected by this mutation or variation is conserved across a number of members of the NEDD4 family including those from other species further supporting this mutation as being

causative of epilepsy and/or other CNS disorders. The L340F mutation or variation was present in an individual with JME but was not observed in the normal population samples tested, nor was it present in individuals affected with IGE or photosensitive epilepsy.

The second mutation or variation detected in the NEDD4 gene was the result of an A to G nucleotide substitution at position 2297 of the coding sequence of the gene as illustrated in SEQ ID NO: 5. The substitution results in the replacement of a lysine amino acid residue with an arginine residue at position 766 of the encoded protein, as illustrated in SEQ ID NO: 25. The amino acid affected by this mutation or variation is also conserved across a number of NEDD4 family members further supporting this mutation as being causative of epilepsy. The K766R mutation or variation was present in two unrelated individuals with IGE, and in one individual with photosensitive epilepsy. This change was also seen in two unrelated normal individuals.

Four mutations or variations were also detected in the coding region of NEDD4 that did not give rise to amino acid substitutions. The first was a C to T nucleotide substitution in exon 2 at position 81 of the coding sequence of the gene, as illustrated in SEQ ID NO: 16.

This change was only seen in an individual with IGE but was not observed in the normal population samples tested.

The second mutation was a C to T nucleotide substitution in exon 22 at position 2052 of the coding sequence of the gene, as illustrated in SEQ ID NO: 18. This change was seen in an individual with IGE, in an individual with JME and in an individual with photosensitive epilepsy. The change was also observed in one normal individual. The third mutation was a T to C nucleotide substitution in exon 26 at position 2373 of the coding sequence of the gene, as illustrated in SEQ ID NO: 19. This change was only seen in an individual with IGE and was not seen in the normal samples tested. Finally, a C to T nucleotide

substitution was seen in exon 1 at position 33 of the coding sequence of the gene, as illustrated in SEQ ID NO: 15. This change was seen in one individual with IGE, in three unrelated individuals with JME, and in one individual with photosensitive epilepsy. The change was also observed in one normal individual.

A mutation or variation was also seen in exon 1 of NEDD4, 5'to the start codon. This change was a C to T nucleotide substitution 82 base pairs upstream of the coding sequence of the gene as illustrated in SEQ ID NO: 14. This change was observed in one IGE individual and was also seen in one normal individual.

Two intronic mutations or variations were also detected in NEDD4. The first was a T to C nucleotide substitution in intron 15 at position-44, as illustrated in SEQ ID NO: 17. This change was seen in an individual with JME but was not seen in unaffected individuals. The second was a G to A nucleotide substitution in intron 27 at position +42, as illustrated in SEQ ID NO: 20. This change was seen one individual with IGE, one individual with JME and one normal individual.

These mutations or variations are the first to be seen in the NEDD4 gene that are responsible for epilepsy phenotypes.

Example 3: Characteristics of NEDD4-2 and NEDD4 The NEDD4-2 gene is a member of the NEDD4 family of proteins. Nedd4, the original member of this family, was first cloned as a developmentally regulated mouse gene highly expressed in early embryonic central nervous system (Kumar et al. , 1992). At present, there are predicted to be nine members of the human NEDD4 family of proteins (Harvey et al. , 2001; Ingham et al. , 2004). These include NEDD4 itself (Hs. 1565), NEDD4-2 (Hs. 3731), WWP1 (Hs. 450060, WWP2 (Hs. 315485), AIP4 (Hs. 314676), Smurfl (Hs. 436249), Smurf2 (Hs. 387385), NEDL1 (Hs. 428547), and NEDL2 (Hs. 210381).

A characteristic feature of the Nedd4 family of proteins is the presence of domains that have a similar organizational structure. Each member of the family has a C2 domain located towards the N-terminus, a ubiquitin- protein ligase domain (or HECT domain) situated at the C- termini, and multiple WW domains which are located between the C2 and HECT domains.

The function of the C2 domain in the Nedd4 family is not well understood, but it might mediate redistribution of these proteins to intracellular membranes upon fluctuations in Ca2+ concentration. HECT domain proteins are a major subclass of E3 ubiquitin protein ligases and comprise the substrate-specificity arm of the ubiquitin pathway. Many classes of proteins are regulated by ubiquitination including cell cycle proteins, transcription factors and membrane proteins. The WW domains derive their name from the presence of two highly conserved tryptophan residues and a conserved proline residue in a sequence of around 35 amino acids. These domains have a preference for binding small proline-rich sequences, called PY motifs, the most common of which is PPXY (Sudol, 1996). Single WW domains are found in many proteins but 2-4 copies are present in members of the Nedd4 family. As different WW domains from the same protein possess differential substrate specificity in vitro (Sudol, 1996), it is plausible that each of the members of the Nedd4 family interacts with a number of different proteins through WW domains in vivo.

One known target for the NEDD4 protein is the epithelial sodium channel (ENaC). NEDD4 binds to the proline-rich PY motifs present in ENaC subunits through its WW domains (Staub, 1996; Harvey et al. , 1999). It has been proposed that in response to increases in intracellular Na+ (Kellenberger et al. , 1998; Dinudom et al. , 1998; Harvey et al. , 1999), NEDD4 down-regulates Na+ channel activity by ubiquitination of the channel leading to its endocytosis and degradation (Goulet et al. , 1998;

Staub et al. , 1997; Abriel et al. , 1999). Studies on NEDD4-2 have also shown that it can bind to ENaC subunits and regulate sodium feedback control of them (Fotia et al. , 2003).

The regulation of ENaC is critical for the maintenance of Na+ homeostasis and for blood pressure control. While the NEDD4 family of proteins reduce ENaC surface expression, the rennin-angiotensin-aldosterone pathway increases renal Na+ absorption, in part by increasing the expression of ENaC at the cell surface (Masilamani et al. , 1999). An important down-stream mediator of aldosterone is serum and glucocorticoid- regulated kinase (SGK) which has been shown to bind to NEDD4-2 and phosphorylate it (Snyder et al. , 2002). This phosphorylation was shown to reduce the binding of NEDD4-2 to ENaC and hence the NEDD4-2 mediated inhibition of Na+ absorption. It therefore appears that the NEDD4 proteins (in particular NEDD4-2) and SGK converge in a common pathway to regulate epithelial sodium channel absorption (Snyder et al. , 2002).

The present invention implicates members of the NEDD4 family of proteins in epilepsy and/or other CNS disorders through the identification of mutations in the NEDD4-2 and NEDD4 genes. In support of the involvement of the NEDD4 family of proteins in epilepsy and/or other CNS disorders, recent studies have shown that in addition to the regulation of epithelial sodium channels, both NEDD4 and NEDD4-2 are also able to regulate specific neuronal sodium channels (Fotia et al. , 2004) which are required for the generation of electrical excitation in neurons.

Sodium channels in the brain are heteromers of a pore forming alpha subunit which can associate with three auxillary beta subunits. Each pore-forming alpha subunit consists of four domains covalently linked as the one molecule where each of the four domains are comprised of six transmembrane segments. The beta subunits of the sodium channel do not associate with the alpha subunits to

form any part of the pore, they do however influence the rate of channel inactivation and intracellular localization. Four of the ten alpha subunit genes in the mammalian genome are expressed at high levels in the central nervous system (SCN1A, SCN2A, SCN3A and SCN8A).

The NEDD4-2 gene has been shown to inhibit the activity of the neuronal sodium channels SCN2A and SCN8A, and further has been shown to ubiquitinate SCN2A (Fotia et al. , 2004). In addition, the NEDD4 gene has been shown to regulate the activity of SCN2A, however this is not through the direct ubiquitination of this protein (Fotia et al. , 2004). It has been suggested that while NEDD4-2 may directly ubiquitinate brain sodium channels to regulate their activity, NEDD4 may ubiquitinate other proteins that regulate sodium channel endocytosis and/or trafficking (Fotia et al. , 2004).

It can therefore be argued that mutations or variations in members of the NEDD4 family of proteins would have an effect on the ability of these proteins to regulate neuronal sodium channel activity in the brain. An alteration in this activity due to mutations or variations in any one of the NEDD4 proteins may equate to changes in neuronal sodium channel activity, and hence alterations in the excitation of neurons in the brain, ultimately contributing to an epilepsy and/or other CNS disorder phenotype.

Alternatively, mutations or variations in NEDD4 family members, including the mutations or variations in NEDD4-2 and NEDD4 disclosed herein, may disrupt or enhance interactions with other proteins that NEDD4 proteins bind which could in turn lead to changes in neuronal behavior ultimately leading to an increase in the susceptibility to epilepsy and/or other CNS disorders.

Example 4: Functional consequences of the NEDD4-2 and NEDD4 mutations or variations

To determine the functional consequences of the mutations or variations of the invention, the effects of sodium channel activity imparted by some of these mutations or variations was tested through electophysiological recordings of sodium channel alpha subunit mediated currents in Xenopus oocytes.

Clone preparation Capped RNA transcripts encoding full-length alpha subunits of rat SCN3A and rat SCN2A, human NEDD4-2 (NM 015277), SGK, and the NEDD4-2 mutants or variants (S233L and H515P) were synthesized using a MESSAGE MACHINE in vitro transcription kit (Ambion). The S233L and H515P mutations or variations were introduced into NEDD4-2 by standard PCR mutagenesis procedures.

Oocyte injection Xenopus laevis stage V-VI oocytes were removed and treated with collagenase (Sigma type I) for defolliculation. The oocytes were then injected with combinations of the cRNA (generated above), including the relevant sodium channel (2 ng/oocyte) with the Nedd4-2 cRNAs (10 ng/oocyte), with or without the addition of SGK (10 ng/oocyte). The oocytes were incubated at 18°C in ND96 solution (96 mM NaCl, 2 mM KC1, 1 mM CaCl2,1 mM MgCl2,5 mM HEPES, 5 mM pyruvic acid, and 50 ug/ml gentamicin, pH 7.5) prior to recording. Three days after cRNA injection, whole cell Na+ channel currents were recorded from oocytes using the two-electrode (virtual ground circuit) voltage clamp technique. Microelectrodes were filled with 3 M KC1 and typically had resistances of 0.3-1. 5 megohms. All recordings were made at room temperature (20-23 °C) using bath solution containing the following components: 100 mM NaCl, 2 mM KC1, 1 mM MgCl2, 0.3 mM CaCl2,20 mM Hepes, pH 7.5 with NaOH. During recording, oocytes were perfused continuously at a rate of-1. 5 ml/min. Using a GeneClamp 500B amplifier and pCLAMP 8 software (Axon Instruments Inc,

Union City, CA), data were low pass filtered at 1 kHz, digitized at 10 kHz and leak-subtracted on-line using a- P/6 protocol and analyzed offline. Initially, inward Na+ currents were generated by holding the cells at-70 mV and applying step depolarizations to membrane potentials from - 50 mV to +50 mV. Inward Na+ currents were evoked with 100 ms depolarizing pulses at 10 s intervals to 0 mV (SCN3A and SCN2A) from a holding potential of-70 mV.

Results As shown in Figure 1, higher concentrations of NEDD4- 2 (lOng/oocyte as opposed to lng/oocyte) are able to reduce the amplitude of inward Na+ currents mediated by SCN2A likely due to the greater reduction of SCN2A channels at the cell surface. The H515P NEDD4-2 clone had no effect on the amplitude of inward Na+ currents mediated by SCN2A when compared to wild-type NEDD4-2, however the S233L clone was able to decrease the amplitude of inward Na+ currents mediated by SCN2A to a greater extent than the wild-type. The S233L mutation or variation may have the effect of increasing the binding affinity of the mutant or variant to the SCN2A channels, or may lead to an increase in the expression of the mutant or variant thereby imparting a greater reduction of SCN2A channels at the cell surface. However, regardless of the mechanism, the NEDD4-2 (S233L) mutant or variant has the effect of altering neuronal sodium channel activity when compared to wild-type NEDD4-2.

As shown in Figure 2, H515P NEDD4-2 clone caused the amplitude of inward Na+ currents mediated by SCN3A to increase compared to that of the wild-type NEDD4-2. This suggests that the mutant or variant is not as effective at regulating SCN3A channels thereby likely leading to an increase in these channels at the cell surface and a resultant increase in Na+ currents. The S233L NEDD4-2 clone gave a negligible increase in amplitude of inward Na+ currents mediated by SCN3A when compared with wild-type

NEDD4-2. When SGK was also present in cells, it was able to reverse the effect of wild-type NEDD4-2 on SCN3A channels (Figure 2), presumably through phosphorylation of NEDD4-2 and a subsequent reduction in the binding of NEDD4-2 to SCN3A. This same observation was seen with the H515P clone where the presence of SGK lead to a further increase in the amplitude of inward Na+ currents compared to H515P alone.

Therefore the functional experiments conducted to date have shown that mutations or variations in the NEDD4 family of proteins effects the ability of these proteins to regulate neuronal sodium channel activity ultimately contributing to an epilepsy phenotype and/or other CNS disorder phenotype.

TABLE 1 Primer Sequences used for Mutation Analysis of NEDD4-2 Exon Forward Primer Reverse Primer Size (bp) I ND ND ND 2 CATTTAGGTTCCACTGTTTTCTC GTAAGTAGTCCATCCTTGACC 228 3 GACTGTATTGTACTAGTAACTGC TGGGACACATTAGGAGGCTAC 254 4 CGCTGTTCAAATGATTCCTGC ACGCTGCTCTGAAAATCCAG 173 5 GGACCTTTGTCTCTATTCATG CAGCACGAAGCATCAAACATG 214 6 CTCTGTAATCCAGTTGCCTG CCTATACCTACAGCATGCAG 200 7 GGTGGTTGGCTTTTGCTGAAG GATCTCAAGGCAAGGAGAGAG 229 8 ACCTCTTACTCACAGCCGAAG CACGTGTTCCTGACCATCAC 274 9 CCCGATCTCAACCACTTCTC AACATGGGAAGAAGGAGCTG 240 10 CCAGTGTCTCCTTCTCTGAA CTGGAAGACCCTTGGTCAC 300 11 GCGGTGAATATGGTTGAGTG TTGCAGCAGCCCAGATGATTG 203 12 CTGATCAGAAAACAAATGCAAGG CATTTCGGCTTCTATGGCCTG 238 13 GGGAGATCCTCCTATGAAGC AGTCACAGGACAGAGTGAGTC 211 14 GCACATTGGAATCGCACATG GACTTCATGATGAAAATGGAGC 276 15 CTGCACACAGATACTTCCAC TGGAGATAGAGAAGGTCCAC 209 16 TTTCTCTCTCCCTTCCTTCC TAACCCACAACACCTGTGTG 127 17 GACAGCTTTTGAAGAATCCAG ATCTTATACTGAAGAGGCAGA 202 18 TTCTCTTGAATGTTGCCTCAG TCTCACTGAAGTGACTGTGG 198 19 TGTGTATTTACTGTATGATTATGTG CACTGGGTGTGGCCATATACT 300 20 TTGAGTGACAGGTGGCAAAC AAACCGCAAGCAGCACTGAC 250 21 GCTCTGATACATAGCAGTGTC CCTTCTCATAAGACACGAGTG 168 22 TTTCTTGAGCATTCTGCACAG AGAAGAGTTCCCAGGGTTACC 234 23 TTGTGCACAGAGCCCATTTG TTTCAGCAAGGGACAGTGAC 285 24 AGAAAGCAGTGAGCACTAGTG ATCAGCTCCACCACACTAGC 145 25 GAAGGCAATAGGTGTTTAAGA CTCTCTAGGACATTATGGATCC 290 26 TCTCGCACCTTTCACATCCTG TCAGTCCTGAAGTCAGACCAC 232 27 ATGACAGCAGCATGTGCCATG GGAAATTCCCAGGAGGACAAC 205 28 TGCAGACCACACCATAGCTTC CATACCCAGCTAAGCAGTTC 202 Note : Primer sequences are listed 5'to 3'. ND: exons that have yet to be examined for mutations.

TABLE 2 Primer Sequences used for Mutation Analysis of NEDD4 Exon Forward Primer Reverse Primer Size (bp) I CTGCTGTCGCTGAGGGAG CTGAATAACCCGAAGGGAAG 229 2 TCAGTGTAATAAGTTGACTCAAG CTTCTTGGCAAGGCCTATTC 287 3 AGTCTGGGTAATCTGAGCTTG TTCATTCCACTTTGGATTCAAAC 271 4 GAATGGAGTTCTTACAAGTGTG GAGAATTTATCATTCTAACCTCC 252 5 CTGAGTATCTGTGGGTTGATG GCTGCTCCACTGAAATGTAC 170 6 GTGAATGGTGGCACTATCTC CCCAAAAGGAAAATCATGGAC 167 7 CCTTAGGTGATAGTTCATGAG AGGCTACTGTAAGGTGTAATG 217 8 TTTGAACCTCCCTTTGTAGAC GTTATTGTTCTTCAGAGTACAG 296 9-1 TGGTCTTAAAAGTTGAGGATTG GTCCTTCCAAGGATATCCTG 263 9-2 AGAACCTTCTCCTCTACCTC TGAATCCATCTGAGACATGAC 197 10 CCCAATGATCACAGAATCTTTG GTGTCTTTCAAGGAGAACTAG 231 tt CTAGTTCTCCTTGAAAGACAC TATAAACTACTGAAGCCGTAAC 282 12 TTACCCTCACTACCTTAGCTG GGCAAACGTTCACACTCAATC 236 13 GAGAGTAGACATAGGGACAG AGTTTACATAGGGATGTGACAG 277 14-1 GTCTCTTTAATGGAGGGTGTG CCAGCCTTTAGGAAGGAATC 249 14-2 CAAGCCTCCACCAGTGATTC AGACGCATAAGCATTCTCCTG 317 15 CATGGTAACAGACTGACTTTG TAGCCAAGTTAGATGGGTTAG 190 16 AAGAATGGAATGGAATATGCAAG GAGGATCTTCCCATTGTGTTC 286 17 GGAAGAGAGAACTCACACAG ACAGTCCCATCAGAGCACAC 232 18 TTCTTTTAATGCCCTTACGTTC ACATTTCCCATTACTTTCCATC 233 19-1 GACTTGGACACAGGGTGTAG CAAACTCAATCCACAGTCGAG 228 19-2 GTGTCAAGAGAGCAGACTTC ATTACAGGCATGAGCCACTG 246 20 ND ND ND 21 TTTCTTTCACTTGGTAATCATCC CTTCAAAATGTTCAAGCTGCTTG 183 22 ATTCAGACCCTCTACATACTG GAGCCTAGGAATGTATTAAGTG 233 23 ACCAAGTTTCTCGTATAACTAC CAAGGGGACAGAGAAAGATG 301 24 TGGTCTCAGCTAGCCTTTAG ACTGTGACATTATGGAAGAGC 224 25 AGGCATAGGAAAGGCCATTG CACATCAACATCTCCCAGTC 178 26 ATGAACTAGAGGTAAGACATAAC ATCAGTTAAATGTAATCCACCAG 270 27 TGTTTACCTCTTTCCCAGTGC TTGCGGATTCGTCAGCCATG 251 28 CTGGAGATCCTTGTAGAGAG GAGGAATCTCACTCTCTGAG 201 Note : Primer sequences are listed 5'to 3'. ND : exons that have yet to be examined for mutations.

TABLE 2 (Continued) NEDD4 Sequence Mutations and Variations for IGE, JME and Photosensitive (PS) Patients Amino Acid DNA sequence variation Allele frequency (%) change Exon Intronic Coding Epilepsy IGE JME PS Normal 21 IVS21+29G>A 28. 6 223 25. 0 22. 3 22 c. 2052C>T S684S 0. 7 0. 6 1. 4 0 IVS22+ 18A>T ND ND ND ND 23 IVS23+15del GTAAGTATTT 2. 1 2.0 4. 3 4.4 TATT 24---- 25 c.2297A>G K766R 1.4 0 1.4 1.1 26 c.2373T>C H791H 0.7 0 0 0 27 IVS27+24A>T ND ND ND ND IVS27+42G>A 0. 7 0. 6 0 0. 5 28 c.2571T>G T857T 11.3 13.6 18.9 14.0 IVS28+35C>A ND ND ND ND Note :- : Plate has been screened but no mutations identified; ND: Not determined; NS: exons that have yet to be screened. Numbering is based on the NEDD4 sequence represented by GenBank Accession Number NM_006154.

TABLE 3 NEDD4-2 Sequcnce Mutations and Variations for GEFS+, IGE, FS, PS and JME Patients Amino acid DNAS sequence variation Allele frequency (%) change Exon Intronic Coding Epilepsy Plate CEFS+ ICE FS JME Normal ND ND ND ND ND ND ND ND ND 2 IVS2+58C>T - 0 0. 7 0 0 0 0 3 - - - - - 4 - - - - - 5 - - - - - 6 7 - - - - - 8 - - - - - 9 IVS8-32delT 0 0.7 0 0 0.6 0 c. 812A>C E271A 0 0.7 0 0 0.6 0 c.698C>T S233L 0 0.7 0 0 0.6 0.5 10 c.825C>T T275T 0.8 0 0 0 0 0 11 - - - - - 12 - - - - - 13 - - - - - 14 - - - - - 15 c.1544A>C H515P 0 0 0 1.4 0 0 16 - - - - - 17 IVS16-12delT 23.8 20.7 29.7 6.8 18.7 22.6 IVS16-12delTT 13.1 13.2 14.1 14.9 12.7 10.5 IVS16-12delTTT 25.4 25 30.5 31.1 25.3 22.1 IVS16-12delTTTT 3.8 7.4 4.7 2.7 6.6 2.6 18---- 20 - - - - - 21 - - - - - 22 - - - - - 23 - - - - - 24 IVS24+14G>A 0 0 0.8 0 0.6 0 25 26 IVS27+63insTG 0 0 0 0 0.6 0.5 c. 2553C>T N851N 0.8 0 0 0 0.6 0.5 27 28 IVS28+22A>G 0 0.7 0 0 0 0 IVS28+33A>G 0 0 0 0 0.6 0 Note: -: Plate has been screened but no mutations identified ; ND: exons that have yet to be screened. Numbering is based on the NEDD4-2 sequence represented by GenBank Accession Number NM 015277.

TABLE 4 NEDD4 Sequence Mutations and Variations for IGE, JME and Photosensitive (PS) Patients DNA sequence variation Amino Acid Allele frequency (%) change Exon Intronic Coding Epilepsy IGE JME PS Normal 1 IVS1+14G>A - 11.8 4.5 16.2 12.6 c33C>T L I 1 L 0.7 1.9 1.6 0.6 c.-82C>T - 0.7 0 0 0.6 2 IVS1-150G>C IVS1-41T>C IVS2+12T>A - 13.4 16.3 19. 4 10.5 IVS2+79G>A c. 81C>T A27A 0.7 0 0 0 IVSI-65delT ND ND ND ND IVS1-59insA - ND ND ND ND 3 - - - - 4 - - - - 5 - - - - 6 - - - - 7 - - - - 8 IVS7-40G>A - ND ND ND ND 9-1 9-2 - - - - 10 c. 779A>G Q260R Seen together c.835G>A S279N 23. 9 24.7 25.0 20.4 12 c. 018C>T L340F 0 0.6 0 0 13---- 14-2 - - - - 15 IVS15+9A>T - 9.9 10.4 21.6 12.0 16 IVS15-44T>C 0 0. 6 0 0 17 - - - - 18 - - - - 19-1 - - - - 19-2 - - - - 20 NS NS NS NS NS NS NS

References References cited herein are listed on the following pages, and are incorporated herein by this reference.

Abriel, H. et al. (1999). J. Clin. Invest. 103: 667-673.

Annegers, JF. (1996). The treatment of epilepsy: Principles and practice. Second Edition. (Wyllie E (Ed) Williams and Wilkins).

Breaker, RR. and Joyce, GF. (1995). Chem. Biol.

2: 655-600.

Cole, SP. et al. (1984). Mol. Cell Biochem. 62: 109-120.

Collins, FS. (1995). Nature Genet. 9: 347-350.

Commission on Classification and Terminology of the International League Against Epilepsy. (1989).

Epilepsia. 30: 389-399.

Cossette, P. et al. (2002). Nature Genet. 31: 184-189.

Cote, RJ. et al. (1983). Proc. Natl. Acad. Sci. USA 80: 2026-2030.

Dinudom, A. et al. (1998). Proc. Natl. Acad. Sci. USA 95 : 7169-7173.

Durner, M. et al. (2001). Ann. Neurol. 49: 328-335.

Fotia, AB. et al. (2003). FASEB J. 17: 70-72.

Fotia, AB. et al. (2004). J. Biol. Chem. 279: 28930-28935.

Gardiner, M. (2000). J Neurol. 247: 327-334.

Goldman, CK. et al. (1997). Nature Biotechnology 15: 462- 466.

Goulet, CC. et al. (1998). J. Biol. Chem. 273: 30012- 30017.

Greenberg, DA. Delgado-Escueta, AV. Widelitz, H. Sparkes, RS. Treiman, L. Maldonado, HM. Park, MS. and Terasaki, PI. (1988). Am. J. Med. Genet. 31: 185-192.

Harvey, KF. et al. (2001). J. Biol. Chem. 276: 8597-8601.

Harvey, KF. et al. (1999). J. Biol. Chem. 274: 12525- 12530.

Haseloff, J. and Gerlach, WL. (1988). Nature 334: 585-591.

Heller, RA. et al. (1997). Proc. Natl. Acad. Sci. USA 94: 2150-2155.

Huse, WD. et al. (1989). Science 246: 1275-1281.

Ingham, RJ. et al. (2004). Oncogene 23 : 1972-1984.

Joyner, AL. (2000). Gene Targeting: A Practical Approach (Oxford University Press).

Kellenberger, S. et al. (1998). J. Clin. Invest. 101: 2741-2750.

Kohler, G. and Milstein, C. (1975). Nature 256: 495-497.

Kozbor, D. et al. (1985). J. Immunol. Methods 81: 31-42.

Kumar, S. et al. (1992). Biochem. Biophys. Res. Comm. 185: 1155-1161.

Kunath, T. et al. (2003). Nature Biotechnol. 21: 559-561.

Masilamani, S. et al. (1999). J. Clin. Invest. 104: R19- R23.

Orlandi, R. et al. (1989). Proc. Natl. Acad. Sci. USA 86: 3833-3837.

Rickert, RC. et al. (1997). Nucleic Acids Res. 25: 1317- 1318.

Roger, J. et al. (1992). Epileptic syndromes in infancy, childhood and adolescence. Second Edition. (John Libbey, London).

Scharf, KD. et al. (1994). Results Probl. Cell Differ. 20: 125-162.

Scheffer, IE. and Berkovic, SF. (1997). Brain 120 : 479- 490.

Schena, M. et al. (1996). Proc. Natl. Acad. Sci. USA 93: 10614-10619.

Schwenk, F. et al. (1995). Nucleic Acids Res. 23: 5080- 5081.

Singh, R. et al. (1999). Ann. Neurol. 45: 75-81.

Snyder, PM. et al. (2002). J. Biol. Chem. 277: 5-8.

Staub, O. et al. (1996). EMBO J. 15: 2371-2380.

Staub, O. et al. (1997). EMBO J. 16: 6325-6336.

Sudol, M. (1996). Prog. Biophys. Mol. Biol. 65: 113-132.

Sutton, GC. (1990). The principles and practice of medical genetics. Second Edition. (Churchill Livingstone, NY).

Todd, JA. (1999). Lancet 354 (Supplement 1) : 15-16.

Winter, G. and Milstein, C. (1991). Nature 349: 293-299.

Wyman, AR. and White, R. (1980). Proc. Natl. Acad. Sci.

77: 6754-6758.