FIELD OF INVENTION

The present invention relates to mucosal vaccine development. In particular, the present invention provides a novel vaccine composition formulated for mucosal delivery comprising a virus antigenic polypeptide and a mast cell-activating adjuvant, a kit comprising said composition and methods of use, such as for inducing an immune response in a subject for therapeutic or prophylactic purposes. More particularly, the virus is selected from the group comprising Coronaviruses (Beta-coronaviruses preferably), Influenza viruses, Enteroviruses, Flaviviruses, Rotaviruses and Human parainfluenza viruses and the mast cell-activating adjuvant comprises a peptide of Formula I; R1-I-N-L-K-A-X6-A-A-L-A-K-X12-X13-L-R2 (SEQ ID NO: 1) wherein X ₆ is W, L, F, or I; X12 is W, L, F, Y, M, I, C, A, V, Q, S, R, H, N, E, or G; X13 is C, L, W, F, or M; R1 is absent or Ac; and R ₂ is NH ₂ or OH; or analogues or salts thereof.

BACKGROUND OF THE INVENTION

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) emerged in 2019 as a novel Coronavirus infecting humans and in 2020 it began a major ongoing global pandemic. The disease it induces in humans, COVID-19, is characterized by fever, cough, fatigue and dyspnea, with severe cases leading to pneumonia and death. Vascular complications and coagulation disorders also occur. The elderly and those with pre-existing conditions, such as diabetes and hypertension, are most at risk for developing life-threatening complications. The widespread worldwide distribution of active COVID-19 infection clusters and the severity of disease outcomes in patients in multiple age groups has necessitated unprecedented advances in vaccine technologies and distribution. Although a multitude of vaccines are now available that show protection in terms of significantly reducing the incidence of infections, hospitalizations, deaths and reducing transmission, breakthrough infections often occur, suggesting that there are limitations to the duration of protective immune responses induced by the current vaccine regimens. Furthermore, new variants of concern (VOC) continue to circulate, even in populations with high levels of vaccine coverage. This is thought to be at least partially attributable to immune pressure on the SARS-CoV-2 virus leading to diversification of antigenic properties through virus mutation.

Among the first vaccines approved against SARS-CoV-2 were mRNA-based vaccines, which initial analyses showed can be >90% effective a few weeks following the vaccine protocol completion (Polack, F. P. et al., N Engl J Med 383, 2603-2615, 2020). Most strategies have used the Spike (S) protein as antigen, which is found on the virus surface. Often, the region of the S-protein containing its receptor binding domain (RBD) that allows its entry into host cells via binding to the angiotensin-converting enzyme 2 (ACE2) receptor is used. Importantly, ACE2 is expressed by the type I and II alveolar cells of the lung that are key targets of lower respiratory tract infection by SARS-CoV-2, so that neutralizing antibodies against this protein are effective in preventing cellular entry and infection by the virus. For human vaccinees who were given mRNA vaccines, there are strong correlations between the titer of vaccine-induced antibody responses and protection from symptomatic disease. Notwithstanding their efficacy, risk of breakthrough infection appeared to increase in the months following completion of the two-dose mRNA vaccine (Lipsitch, M., et al., Nat Rev Immunol 22, 57-65, 2022), likely owing to the natural time-related decay in specific antibodies. Complicating this phenomenon of waning protection over time has been the emergence of VOC, for which vaccine-induced antibodies show decreased neutralization (Mistry, P. et al., Front Immunol 12, 809244, 2021). Despite the loss of antigen-specificity and neutralization capacity of vaccine-induced antibodies to VOC such as Omicron (Cao, Y. et al., Nature 602, 657-663, 2022), vaccinees remain highly protected against severe disease and death, which could possibly point to a protective role for T cells in vaccine-induced protection. Indeed, T cells are highly cross- reactive to VOC and even to SARS-CoV-1 and seasonal coronaviruses (Le Bert, N. et al., J Exp Med. 218(5):e20202617, 2021 ; Jing, L. et al., JCI Insight. 7(6):e158126, 2022; Moss, P. Nat Immunol 23, 186-193, 2022). In primates with SARS-CoV-2 infection, CD8 T cell activation correlated with viral control in the absence of neutralizing antibodies (Ishii, H. et al., Cell Rep Med 3, 100520, 2022). In humans, rapid induction of SARS-CoV-2-specific T cell responses were also associated with mild disease (Tan, A. T. etal., Cell Rep 34, 108728, 2021). Boosting of mRNA vaccines has been shown to lead to a surge in vaccine protection that correlated with the boost in S-specific antibody titers. These observations highlight outcomes of COVID- 19 vaccines that could be further improved as our understanding of functional correlates of COVID-19 protection grows.

Messenger RNA (mRNA) vaccines also have limitations for world-wide use given that they are difficult to distribute and require strict cold chain adherence and storage near -80°C. Several alternative vaccine approaches are also being developed for SARS-CoV-2, including subunit vaccines (Wang, N., et al., Front Microbiol 11 , 298, 2020), which involve use of more-stable protein antigens and have an advantage for stability at multiple temperatures. Although subunit vaccines have been used effectively in the context of many viral vaccines, including those approved for hepatitis B and influenza viruses 2021), usually, the protein components of subunit vaccines are not sufficient, alone, to establish immune memory (Fan, J. et al., Vaccines (Basel).10(7) : 1120, 2022). For this reason, adjuvants, or substances that promote immune activation, are often added to the subunit vaccine formulation to induce long-term memory responses. Alum and AS04 (aluminium salt combined with the TLR4 agonist 2-O- desacyl-4’-monophosphoryl lipid A) are two human-approved adjuvants (Garcon, N. et al., BioDrugs 25, 217-226, 2011 ; Shi, S. et al., Vaccine 37, 3167-3178, 2019). Currently, there are no mucosal adjuvants approved for use in humans, but there are adjuvants that have been used in mucosal vaccine formulations in experimental settings, including the most widely studied experimental mucosal adjuvant, Cholera toxin, and mast cell-activating compounds, such as mastoparan (Lavelle, E. C. & Ward, R. W. Nat Rev Immunol 22, 236-250, 2022; McLachlan, J. B. etal., Nat Med 14, 536-541 , 2008; St John, A. L. etal., NPJ Vaccines. 5(1): 12, 2020). Cholera toxin causes toxicity so it cannot be used in humans (Lavelle, E. C. & Ward, R. W. Nat Rev Immunol 22, 236-250, 2022). Mastoparan is a short 14 aa peptide that is of insufficient length to trigger immune responses itself. Its analogue, mastoparan-7 (M7) has greater cell-activating activity and appears to work in vivo primarily through inducing mast cell degranulation responses through the MrgX2 receptor (McNeil, B. D. et al. Nature 519, 237- 241 , 2015). However, it is unknown if M7 works differently in the skin compared to mucosal sites, induces site-specific responses, or influences T cell phenotypes and functions that are particularly important for combatting certain types of viral pathogens. Prior studies also established the adjuvant activity of M7 during homologous challenges, but whether mucosal vaccines generally or M7-adjuvanted vaccines specifically induce responses that are more broadly protective against diverse viral isolates compared to conventional approaches is also unknown. For vaccines against SARS-CoV-2, mucosal vaccines have shown promise in experimental studies, with multiple platforms, including unadjuvanted S protein and viral vector-based systems evoking protective immune responses (Hassan, A. O. et al., Cell 183, 169-184 e113, 2020; Wu, S. et al., Nat Commun 11 , 4081 , 2020; Alu, A. et al., EBioMedicine 76, 103841 , 2022; Afkhami, S. et al., Cell 185, 896-915 e819, 2022; Kingstad-Bakke, B. et al., Proc Natl Acad Sci U S A 119, e2118312119, 2022; Mao, T. et al. bioRxiv 26:2022.01.24.477597. 2022). However, the above-described strategies all have limitations.

Thus, there is still a need for improved vaccines that can be easily distributed and at the same time also provide broad, lasting and effective protection against different variants of virus.

SUMMARY OF THE INVENTION

According to the present invention, mucosal administration of SARS-CoV-2 subunit vaccines comprising a mast cell-activating adjuvant is a promising strategy to improve systemic immune responses, through preferential induction of central memory T (TCM) cells that are polyfunctional. These TCM responses are T cell intrinsic and are maintained following transfer to new hosts to promote improved memory recall upon lung antigen challenge in both the draining brachial lymph nodes (LNs) and lungs. Furthermore, the improved polyfunctional response following intra-nasal (I.N.) vaccination is extended to antibodies, which show improved breadth of neutralizing responses against multiple variants compared to vaccination subcutaneously (S.C.) with the same adjuvant. Finally, the LN. vaccination resulted in improved protection of clinical disease in a hamster challenge model.

Thus, in a first aspect of the present application, there is provided a vaccine composition formulated for mucosal delivery comprising:

(a) a virus antigenic polypeptide, or a fragment or variant thereof; and

(b) a mast cell-activating adjuvant comprising a peptide of Formula I:

Ri - I-N-L-K-A-X6-A-A-L-A-K-X12-X13-L-R2 (SEQ ID NO: 1) wherein

Xe is W, L, F, or l;

X12 is W, L, F, Y, M, I, C, A, V, Q, S, R, H, N, E, or G;

X13 is C, L, W, F, or M;

R1 is absent or Ac; and

R ₂ is NH ₂ or OH; or analogues or salts thereof.

In some embodiments, the mast cell-activating adjuvant comprises mastoparan (INLKALAALAKKIL-NH2 or -OH; SEQ ID NO: 2) or analogues or salts thereof. More preferably, the mast cell-activating adjuvant is mastoparan 7 (INLKALAALAKALL-NH2 or -OH; SEQ ID NO: 3).

In some embodiments, the virus is selected from the group comprising Coronaviruses (Betacoronaviruses preferably), Influenza viruses, Enteroviruses, Flaviviruses, Rotaviruses and Human parainfluenza viruses. Preferably, the virus is SARS CoV-2. More preferably, the virus is SARS CoV-2 and the antigenic polypeptide is an S (spike) polypeptide (SEQ ID NO: 4). In one embodiment, the S polypeptide consists of or comprises a receptor-binding domain (RBD) of the S protein. The RBD of the S polypeptide may consist of or comprise amino acids Arg319 to Phe541 , of the SARS-CoV-2 S protein (SEQ ID NO: 4), as set forth in SEQ ID NO: 5.

In some embodiments, the virus antigenic polypeptide is present in a pharmaceutically effective amount in the vaccine composition. In some embodiments, the mast cell-activating adjuvant is present in a pharmaceutically effective amount in the vaccine composition.

In some embodiments, the composition further comprises a pharmaceutically acceptable carrier. In some embodiments, the composition when delivered mucosally provides improved crossprotection against virus variants as compared to when it is sub-cutaneous delivered.

In a second aspect of the invention, there is provided the vaccine composition of the first aspect of the invention for use as a medicament for the prevention or treatment of a virus- related disease.

In a third aspect of the invention, there is provided the vaccine composition of the first aspect of the invention for the prevention or treatment of a virus-related disease.

In a fourth aspect of the invention, there is provided a use of the vaccine composition of the first aspect of the invention in the manufacture of a medicament for the prevention or treatment of a virus-related disease.

In a fifth aspect of the invention, there is provided a method of vaccination against a virus- related disease, which method comprises administering an effective amount of a vaccine composition of the first aspect of the invention to a subject in need thereof. Preferably, the composition is administered to the nasal mucosae of said subject.

In a sixth aspect of the invention, there is provided a method of inducing an immune response in a mammal, comprising administering a vaccine composition of the first aspect of the invention. Preferably, the administering comprises contacting nasal mucosae of said mammal.

In some embodiments, the immune response comprises a prophylactic immune response or a therapeutic immune response.

In a seventh aspect of the invention, there is provided a kit to elicit an immune response to a virus antigenic polypeptide, or a fragment or variant thereof, the kit comprising a vaccine composition of the first aspect of the invention and a delivery device, wherein the delivery device is capable of administering the vaccine composition to the mucosae of a subject. Preferably, the delivery device is a nasal delivery device.

Generally, the mucosal delivered vaccine composition according to the present invention provides the following significant effects:

1. It provides superior systemic SARS-CoV-2 TMEM compared to subcutaneous vaccination with the same antigen.

2. It improves polyfunctional TCM phenotypes versus the subcutaneous vaccination. 3. It induces IgA and promotes IgG production that can cross-neutralize variants of concern.

4. It leads to superior clinical protection from SARS-CoV-2-induced disease caused by parental or omicron strains in a hamster model of COVID-19.

BRIEF DESCRIPTION OF THE DRAWINGS

Certain embodiments of the present disclosure are described more fully hereinafter with reference to the accompanying drawings.

Figure 1 shows schematic diagrams of (A) sub-cutaneous (S.C.) and (B) intra-nasal (I.N.) S- RBD vaccination strategies. For S.C. administration, the adjuvant was Alum or Mastaparan M7 (M7), whereas for I.N. administration, the adjuvant was M7. At day 5 post-immunization, T cell responses were measured by flow cytometry in the draining lymphoid organs for the respective tissues for S.C. or I.N. immunizations, respectively, either the popliteal LN (PLN) or the nasal-associated lymphoid tissue (NALT), the latter of which is the rodent structure analogous to Waldeyer’s ring in humans. Systemic T cell responses were also assessed in the spleen.

Figure 2 shows superior systemic T cell activation following I.N. vaccination against SARS- CoV-2 compared to S.C. vaccination. Heat map representations of the frequency of various T cell subsets in the (A) Draining lymphoid tissue (either NALT or popliteal lymph nodes) or (B) Spleen, day 5 following vaccination.

Figure 3 shows T cell retention was enhanced in the draining lymphoid tissue following S.C. vaccine administration compared to I.N. administration of S-RBD + M7. Plots showing (A) Total T cells, (B) CD4 ⁺ T cells and (C) CD8 ⁺ T cells in the draining lymphoid tissue of the vaccine administration, either PLN or NALT, day 5 following vaccination. Groups were compared by 1 -way ANOVA with Holm-Sidak’s post-test; *p<0.05.

Figure 4 shows superior CD4 ⁺ T cell activation in the draining lymphoid tissue following I.N. compared to S.C. vaccination with S-RBD + M7. Plots showing (A) total activated CD4 ⁺ CD69 ⁺ T cells and (B) total activated CD8 ⁺ CD69 ⁺ T cells in the PLN after S.C. M7+S-RBD vaccination and NALT after I.N. M7+S-RBD vaccination, day 5 following vaccination. Groups were compared by 1-way ANOVA with Holm-Sidak’s post-test; *p<0.05.

Figure 5 shows enhanced CD4 ⁺ T cell retention in the spleen following I.N. vaccination. Plots showing the total (A) CD4 ⁺ T cells and (B) CD8 ⁺ T cells in the spleen day 5 following vaccination with S-RBD + M7. Groups were compared by 1-way ANOVA with Holm-Sidak’s post-test; *p<0.05;**p<0.01. Non-significant p-values less than 0.1 are indicated on the graph.

Figure 6 shows enhanced CD4 ⁺ T cell retention in the spleen following LN. vaccination. Plots showing the total (A) total activated CD4 ⁺ CD69 ⁺ T cells and (B) total activated CD8 ⁺ CD69 ⁺ T cells in the spleen on day 5 following S.C. or I.N. vaccination with S-RBD + M7 compared to controls or antigen (S-RBD) alone. Groups were compared by 1-way ANOVA with Holm- Sidak’s post-test; *p<0.05;**p<0.01. Non-significant p-values less than 0.1 are indicated on the graph.

Figure 7 shows enhanced production of IL- 17 by CD8 ⁺ T cells following I.N. vaccination. Numbers of IL-17 ⁺ CD8 ⁺ T cells in the spleen following (A) I.N. or (B) S.C. vaccination with M7+S-RBD compared to controls or antigen (S-RBD) alone. *p<0.05 and **p<0.01 by 1-way ANOVA.

Figure 8 shows a schematic diagram of the experimental design where hamsters were vaccinated with S-RBD and M7 via multiple routes using a prime (day 0) and boost (day 14). Animals were then challenged I.N. with of 105 plaque-forming units (PFU) SARS CoV-2 on day 35 and monitored for 4 days prior to necropsy.

Figure 9 shows (A) clinical scores of vaccinated animals were significantly reduced compared to unvaccinated infected controls by 2-way ANOVA with Tukey’s post-test; p<0.0001 . n=5 per group. (B) on day 4 post-infection, I.N. vaccinated animals began to recover body mass compared to unvaccinated and S.C. vaccinated controls that were also infected. *p<0.05 and **p<0.01 by one-way ANOVA with Tukey’s post-test. (C) I.N. vaccinated animals had reduced lung tissue damage compared to unvaccinated animals following SARS-CoV-2 challenge, by histopathological score, determined by one-way ANOVA. p<0.05.

Figure 10 shows representative images of lung histology. Scale bar=100pm. Black arrows indicate examples of bronchiolar epithelial cell death and desquamation, although very mild in the I.N. group. Grey arrows indicate examples peribronchiolar cellular infiltration. Asterix are placed to indicate examples of pronounced alveolar septal infiltration.

Figure 11 shows a schematic diagram of the experimental design used to characterize antigen-specific memory T cell function in vaccinated mice, wherein splenocytes isolated from mice vaccinated with M7+S-RBD by either the I.N. or S.C. route were stimulated with the antigen S-RBD ex vivo. Figure 12 shows differential induction of memory T cell phenotypes by LN. versus S.C. vaccination. (A) Increased activation of CD8 ⁺ TEM cells detected from mice vaccinated via the S.C. route, following stimulation with S-RBD. (B) Increased TNF ⁺ CD8 ⁺ TCM cells from mice vaccinated via the I.N. route following stimulation with S-RBD. Data points represent experimental replicates (individual donor mice) and dashed line represents the average baseline control for T cells from naive mice stimulated with S-RBD. Significance compared to naive controls is represented with symbols aligned above each bar. ***p<0.001 by Student’s unpaired t-test.

Figure 13 shows enhanced induction of antigen-specific polyfunctional TCM by mucosal M7+S- RBD vaccination. (A-B) Representative flow cytometry plots showing the identification of TE and TCM populations for the (A) I.N. and (B) S.C. vaccinated groups and their expression of cytokines IFN-y and TNF, by intracellular staining. (C) Representative histograms showing strong induction of TNF following I.N. compared to S.C. vaccination.

Figure 14 shows increased numbers of antigen-specific polyfunctional T _C M are induced by I.N. vaccination compared to S.C. vaccination. Quantification of the (A) TNF ⁺ and (B) IFN-y ⁺ TNF ⁺ populations of CD4 ⁺ T _C M following antigen stimulation indicates an increase following I.N. compared to S.C. vaccination with the same M7+S-RBD. Data points represent experimental replicates (4-5 individual mice for vaccine groups and 2 technical replicates from 2 mice for PBS group) Significance compared to naive controls is represented with symbols aligned above each bar. *p<0.05, **p<0.01 , ***p<0.001 , ****p<0.0001 by 1-way ANOVA with Tukey’s post-test.

Figure 15 shows a schematic diagram of the experimental design for identification of antigenspecific recruitment and activation of T cells following antigen challenge in lungs. In brief, purified Thy1.2 ⁺ T cells from M7+S-RBD-vaccinated donors (via S.C. or I.N. routes) were transferred into Thy1.1 ⁺ naive recipients, followed by I.N. challenge with S protein.

Figure 16 shows the identification of vaccinated donor T cells in lungs of mice challenged with S-protein. (A) Flow cytometry plot indicating the presence of donor Thy1 ,2 ⁺ CD8 ⁺ T cells in the lungs of recipient mice, but not control mice, 5 days after challenge. Plot depicts concatenated samples from all groups. (B) Donor Thy1.2 ⁺ CD8 ⁺ T cells constituted a minor portion of hemopoietic cells in the lung following challenge and did not differ in frequency between I.N. or S.C. vaccinated groups. Figure 17 shows improved re-activation of memory T cells derived from I. N. -vaccinated donors in recipient lungs upon challenge. Histogram of TNF expression in donor (Thy1.2 ⁺ ) and recipient (Thy1.1 ⁺ ) CD44 ⁺ CD8 ⁺ T cells representative of each group indicates an increase in TNF expression by donor T cells in lungs from vaccinated mice. Down sampling of 600 T cells was used to facilitate comparisons of equal numbers of cells for each sample. The percentage of TNF ⁺ cells of total CD44 ⁺ CD8 ⁺ T cells is indicated in the legend.

Figure 18 shows significantly increased TNF expression and activation by TMEM cells in the lungs following antigen challenge. The MFI for (A) TNF expression and (B) CD69 expression were compared for Thy1.2 ⁺ donor CD8 ⁺ TMEM cells in the lungs following S challenge. Vaccinated groups were not compared to control groups since there were insufficient donor memory T cells in the lungs of unvaccinated control groups for TNF expression quantification. N=4-5 mice per group derived from two independent experiments. *p<0.05 by Student’s unpaired t-test.

Figure 19 shows that mucosal vaccination with M7+S-RBD enhances memory T cell responses in brachial LNs. Plots indicate the percentage of donor-derived CD8 ⁺ T cells detected in brachial LNs following S antigen challenge with (A) T _C M or (B) T _E M phenotypes. Percentage of (C) CD8 ⁺ T cells and (D) CD4 ⁺ T cells that are donor TMEM cells, staining doublepositive for cytokines (TNF ⁺ IFN-y ⁺ ). N=4-5 mice per group derived from two independent. *p<0.05, **p<0.01 by Student’s unpaired t-test.

Figure 20 shows superior antibody titer and SARS-CoV-2 variant cross-neutralization after mucosal vaccination with M7+S-RBD. (A) Anti-S-RBD IgA endpoint titers in nasal washes, 21 days post-immunization. (B-C) Anti-S-RBD IgG (B) endpoint titers and (C) Avidity (percentage antibody that remains bound after stringent ELISA washing) following S.C. or I.N. vaccination. *p<0.05, by two-way ANOVA. ns=not significant. (D) Percentage inhibition of S-RBD association with its receptor hACE-2 by s-VNT. For control vs. I.N, p=0.003; for control versus S.C. p<0.001. For I.N. versus S.C., the comparison was not significantly different. (E) Heatmap depicting the % inhibition against S-RBD from multiple SARS-CoV-2 variants at 1 :10 serum dilution.

Figure 21 shows (A) comparison of serum antibody binding to S-RBD from multiple VOC between the I.N. and S.C. vaccination groups, determined by ELISA. RLU=Relative light units. (B) No correlation between antigen binding and neutralization (by sVNT) was observed. Figure 22 shows cross-neutralizing antibodies are produced in response to both LN. and S.C. M7+S-RBD vaccination for certain variants. Dose response curves show the % inhibition against S-RBD from multiple SARS-CoV-2 variants (A) Alpha (B) Delta (C) Gamma and (D) Delta plus by s-VNT assay. P-values were determined by 2-way ANOVA. *p<0.05, **p<0.01 , ***p<0.001 ****p<0.0001.

Figure 23 shows superior cross-neutralization of certain variants by I.N. M7+S-RBD vaccine- induced antibodies. Dose response curves showing the % inhibition against S-RBD from multiple SARS-CoV-2 variants by s-VNT assay. For (A) Mu (B) Beta and (C) Lambda variants, the I.N. vaccine induced significantly cross-neutralizing antibodies while S.C. vaccination did not. P-values were determined by 2-way ANOVA. *p<0.05, **p<0.01 , ***p<0.001 ****p<0.0001.

Figure 24 shows superior cross-neutralization of currently circulating Omicron sub-variants by I.N. M7+S-RBD vaccine-induced antibodies Dose response curves showing the % inhibition against S-RBD from multiple SARS-CoV-2 variants (A) BA.1 and (B) BA.2 by s-VNT assay. P-values were determined by 2-way ANOVA. *p<0.05, **p<0.01 , ***p<0.001 ****p<0.0001.

Figure 25 shows improved lung histopathological scores for I.N. vaccinated hamsters during a heterologous challenge with Omicron. Groups of vaccinated and unvaccinated hamsters (n=5) were challenged with 105 PFU of Omicron VOC (USA/PHC658/2021). (A) Elevated clinical scores day 4 post-Omicron challenge in unvaccinated animals compared to uninfected controls. *p<0.05 by 1-way ANOVA with Tukey’s post-test. (B) Comparison of histopathological scores for Hong Kong (parental strain, Hong Kong/VM20001061/2020) and Omicron-challenged hamsters. Data from Hong Kong challenged hamsters is re-presented from Figure 2 to aid comparison. **p<0.01 and *p<0.05 by two-way ANOVA with Tukey’s posttest. (C) Represented images of lung tissue from Omicron-infected hamsters, day 4 postinfection. Scale bar=100Dm. Black arrows indicate examples of bronchiolar epithelial cell death and desquamation, although very mild in the I.N. group. Grey arrows indicate examples peribronchiolar cellular infiltration. Asterix are placed to indicate examples of severe alveolar septal infiltration.

DETAILED DESCRIPTION OF THE INVENTION

Further details of the invention will now be described with reference to the following nonlimiting examples. Unless otherwise defined herein, technical and scientific terms used in the present description have the meanings that are commonly understood by those of ordinary skill in the art. A. Definitions

As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.

As used herein, the term “comprising” may include the embodiments “consisting of” and “consisting essentially of”. The terms “comprise(s),” “include(s),” “having,” “has,” “can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases that require the presence of the named ingredients/steps and permit the presence of other ingredients/steps. However, such description should be construed as also describing compositions, mixtures, or processes as “consisting of” and “consisting essentially of” the enumerated ingredients/steps, which allows the presence of only the named ingredients/steps, along with any impurities that might result therefrom, and excludes other ingredients/steps.

As used herein, the term “antigenic polypeptide” refers to a polypeptide containing one or more epitopes (e.g., linear, conformational or both) that will stimulate a hosts immune system to make a humoral response, i.e., B cell mediated antibody production, and/or a cellular antigenspecific immunological response, i.e. T cell mediated immunity. An “epitope” is that portion of an antigen that determines its immunological specificity.

As used herein, a “variant” of a polypeptide sequence includes amino acid sequences having one or more amino acid additions, substitutions and/or deletions when compared to the reference sequence. The variant may comprise an amino acid sequence which is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to a full-length wild-type polypeptide.

As used herein, a “fragment” of a polypeptide may comprise an immunogenic fragment (i.e. an epitope-containing fragment) of the full-length polypeptide which may comprise or consist of a contiguous amino acid sequence of at least 6, at least 7, at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 20, or more amino acids which is identical to a contiguous amino acid sequence of the full-length polypeptide.

As used herein, the term “mast cell-activating adjuvant” includes any peptides comprising one or a plurality of amino acid residues that can, under appropriate conditions, induce a mast cell to secrete, or induce, mast cell membrane activators. Such peptides include, but are not limited to, polymixin, mastoparans (Kruger, P. G. et al., (2003) Regul. Pept. 114(1): 29-35; Nakajima, T. et al., (1985) Peptides 6 Suppl. 3: 425-430; Argiolas, A. et al., (1984) J. Biol. Chem. 259(16): 10106-10111 ; de Souza, B. M. etal., (2004) Rapid Commun. Mass. Spectrom. 18(10): 1095-1102; Konno, K. et al., (2000) Toxicon. 38(11): 1505-1515; Ziai, M. R. et al., (1990) Journal of Pharmacy & Pharmacology 42(7): 457-461 ; Bavec, A. et al., (2004) J. Peptide Science 10(11): 691-699); peptides derived from the mammalian neuroendocrine protein chromogranin A, such as catestatin (Radek, K. A. et al., (2008) J. Invest. Dermatol. 128(6): 1525; Kruger, P. G. et al., (2003) Regul. Pept. 114(1): 29-35); neomycin (Aridor, M. et al., (1993) Science 262(5139): 1569-1572); and additional molecules capable of binding IgE molecules bound on the mast cell membranes such as IgE-specific antibody or antigen (Mayr, S. et al., (2002) J. Immunol. 169(4): 2061-2068). Preferably, the mast cell-activating adjuvant comprises a peptide of Formula I, as herein defined. More preferably, the mast cell-activating adjuvant is mastoparan or mastoparan 7.

When referring to a peptide, the term “analogue” means any derivative of such peptide that is prepared or contains a substitution, addition, deletion or post-translational modification (methylation, acylation, ubiquitination, intramolecular covalent bond) in the amino acid sequence of said peptide, all of which retain the properties of and/or have improved properties of said peptide. For example, mastoparan analogues may include derivatives of the mastoparan peptide obtained through modifications to any amino acids of the mastoparan peptide as well as any side chains or terminals of the amino acids with functional groups or polymers, incorporation of natural or unnatural amino acids and/or their derivatives within the peptide, and/or crosslinking with other peptides, while said analogues preserve the properties of mastoparan.

When referring to a peptide, the term “salt” refers to a salt of the peptide that is prepared by reacting said peptide with a relatively non-toxic acid or base. When the peptide contains a relatively acidic functional group, a base addition salt can be obtained by bringing the peptide into contact with a sufficient amount of base in a pure solution or a suitable inert solvent. When the peptide contains a relatively basic functional group, an acid addition salt can be obtained by bringing the peptide into contact with a sufficient amount of acid in a pure solution or a suitable inert solvent.

The phrase "pharmaceutically acceptable", as used in connection with compositions described herein, refers to molecular entities and other ingredients of such compositions that are physiologically tolerable and do not typically produce untoward reactions when administered to a subject (e.g., a human). As used herein, the term “effective amount” is the amount of an active component sufficient to elicit either an antibody or a T cell response or both sufficient to have a beneficial effect on the subject, e.g. to prevent or treat or at least partially arrest symptoms and/or complications. The effective amount will depend in part on the vaccine composition, the manner of administration such as intranasal or subcutaneous delivery, the stage and severity of the disease being treated, the weight and general state of health of the patient, and the judgment of the prescribing physician.

B. Vaccine composition

The invention provides a vaccine composition formulated for mucosal delivery comprising:

(a) a virus antigenic polypeptide, or a fragment or variant thereof; and

(b) a mast cell-activating adjuvant comprising a peptide of Formula I: R1-I-N-L-K-A-X6-A-A-L-A-K-X12-X13-L-R2 (SEQ ID NO: 1) wherein

Xe is W, L, F, or l;

X12 is W, L, F, Y, M, I, C, A, V, Q, S, R, H, N, E, or G;

X13 is C, L, W, F, or M;

Ri is absent or Ac; and

R ₂ is NH ₂ or OH; or analogues or salts thereof.

Virus antigenic polypeptide

The virus antigenic polypeptide for use in the present invention is any immunogenic polypeptide derived from a virus which is suitable for prophylaxis or treatment by mucosal delivery. In some embodiments, the virus antigenic polypeptide is from viruses such as Coronaviruses (Beta-coronaviruses preferably), Influenza viruses, Enteroviruses, Flaviviruses, Rotaviruses and Human parainfluenza viruses. Preferably, the virus antigenic polypeptide is from a coronavirus, for example, from SARS CoV-2.

SARS CoV-2 is the coronavirus strain responsible for the COVID-19 pandemic. It has four structural proteins, known as S (spike), E (envelope), M (membrane), and N (nucleocapsid) proteins; wherein the N protein holds the RNA genome, and the S, E, and M proteins together create the viral envelope. The S protein on the surface of the virus is a key factor involved in infection, i.e., the protein responsible for allowing the virus to attach to and fuse with the membrane of a host cell. The fundamental role of the S protein in viral infection indicates that it is a potential target for vaccine development, antibody-blocking therapy, and small molecule inhibitors.

The SARS CoV-2 S protein is a type I transmembrane glycoprotein and its amino acid sequence is shown as set forth in SEQ ID NO: 4. It is 1273 amino acids in total length and consists of a signal peptide (amino acids 1-13) located at the N-terminus, the S1 subunit (residues 14-685), and the S2 subunit (residues 686-1273); the last two regions are responsible for receptor binding and membrane fusion, respectively. In the S1 subunit, there is an N-terminal domain (residues 14-305) and a receptor-binding domain (RBD, residues 319-541). The S2 subunit consists of the fusion peptide (FP) (residues 788-806), heptapeptide repeat sequence 1 (HR1) (912-984 residues), HR2 (1163-1213 residues), transmembrane (TM) domain (1213-1237 residues), and cytoplasm domain (1237-1273 residues). The RBD situated in the S1 subunit binds to the host cell receptor angiotensinconverting enzyme 2 (ACE2) in the region of aminopeptidase N. It has been shown that the RBD region can induce highly potent neutralizing antibody (nAb) responses.

In some embodiments, the virus antigenic polypeptide of the present invention is from the S protein of a SARS CoV-2 virus. Preferably, the virus antigenic polypeptide comprises or consists of a receptor-binding domain (RBD) of the S protein. More preferably, the virus antigenic polypeptide may comprise or consist of amino acids Arg319 to Phe541 , of the SARS- CoV-2 S protein (SEQ ID NO: 4), as set forth in SEQ ID NO: 5.

Mast cell-activating adjuvant

The mast cell-activating adjuvant suitable for use in the present invention comprises a peptide of Formula I:

R1-I-N-L-K-A-X6-A-A-L-A-K-X12-X13-L-R2 (SEQ ID NO: 1) wherein

Xe is W, L, F, or l;

X12 is W, L, F, Y, M, I, C, A, V, Q, S, R, H, N, E, K or G;

X13 is C, L, W, F, or M;

Ri is absent or Ac; and

R ₂ is NH ₂ or OH; or analogues or salts thereof.

In some embodiments, the peptide comprises a sequence of SEQ ID NO: 1 , wherein Xe is leucine and Xi ₂ and X13 are defined as above. In some embodiments the peptide comprises a sequence of SEQ ID NO: 1 , wherein Xe is leucine, X13 is isoleucine, and Xi ₂ is defined as above. In some embodiments, Xe is leucine, X13 is isoleucine, and X12 comprises L, F, Y, W, M, K, or I. In some embodiments, Xe is leucine, X13 is L, and X12 is defined above.

In some embodiments, the mast cell-activating adjuvant comprises mastoparan (INLKALAALAKKIL-NH2 or INLKALAALAKKIL-OH, SEQ ID NO: 2) or analogues or salts thereof, or mastoparan 7 (INLKALAALAKALL-NH2 or INLKALAALAKALL-OH, SEQ ID NO: 3) or analogues or salts thereof.

Vaccine composition for mucosal delivery

“Mucosa” is the thin skin that covers the inside surface of parts of the body and produces mucus to protect them. It typically consists of one or more layers of epithelial cells overlying a layer of loose connective tissue. Mucosal tissues include buccal, colorectal, under-eyelid, gastrointestinal, lung, nasal, ocular, sublingual and vaginal tissues.

The vaccine composition provided by the present invention is specifically intended for mucosal delivery, although it can be used S.C. Mucosal delivery routes suitable for the present invention may be selected from, for example, sublingual delivery, buccal delivery, gingival delivery, and intra-nasal delivery, preferably intra-nasal delivery.

Accordingly, in some embodiments, the vaccine composition of the invention further comprises at least one pharmaceutically acceptable carrier. In some embodiments, the carrier may comprise isotonic agents (such as sugars, polyalcohols such as mannitol, sorbitol, or sodium chloride), stabilizers (such as methionine, albumin, lipoprotein and globulin), buffers (such as various salts of organic or inorganic acids, bases, or amino acids, and include various forms of citrate, phosphate, tartrate, succinate, adipate, maleate, lactate, acetate, bicarbonate, or carbonate ions. Preferable buffers for use in the present invention include sodium or potassium buffers, for example, sodium phosphate, potassium phosphate, sodium succinate and sodium citrate.), cryoprotectants (such as trehalose and lactose), bulking agents (such as mannitol, lactose, sucrose, dextran, trehalose, glycine, arginine) and/or preservatives (such as antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal). The pharmaceutically acceptable carrier may also be administered separately but concurrently with the vaccine composition of the present invention.

In another aspect, the present invention provides a kit to elicit an immune response against a virus in a subject (e.g. human). In some embodiments, the kit comprises a vaccine composition of the first aspect of the invention and a delivery device, wherein the delivery device is capable of administering the vaccine composition to the mucosae of a subject. Preferably, the delivery device is a nasal delivery device.

C. Therapeutic use

One aspect of the invention is the vaccine composition of the present invention for use as a medicament for the prevention or treatment of a virus-related disease. Also provided is the vaccine composition of the present invention for the prevention or treatment of a virus-related disease. Further provided is use of the vaccine composition of the present invention in the manufacture of a medicament for the prevention or treatment of a virus-related disease.

Another aspect of the invention is a method of vaccination against a virus-related disease, which method comprises administering an effective amount of the vaccine composition of the present invention to a subject in need thereof. Preferably, the composition is administered to the nasal mucosae.

The “virus-related disease” depends on the antigenic polypeptide comprised in the vaccine composition. Generally, if the vaccine composition comprises an antigenic polypeptide from a specific virus, then said vaccine composition can be used for the prevention or treatment of a disease (for example, infection) caused by the corresponding specific virus or maybe variants thereof. Considering some antigenic polypeptides may present in different kinds or variants of a virus, a challenge is to generate a vaccine composition comprising such antigenic polypeptide that will stimulate the production of cross-neutralizing antibodies which may provide a broad protection against multiple virus variants, such as those observed with variants of concern, and reduce break-through infections and subsequent transmission.

In one embodiment, the vaccine composition of the present invention provides protection against a virus selected the group comprising Coronaviruses (Beta-coronaviruses preferably), Influenza viruses, Enteroviruses, Flaviviruses, Rotaviruses and Human parainfluenza viruses. Preferably, the vaccine composition of the present invention is capable of providing improved cross-neutralizing protection against virus variants (e.g. various SARS CoV-2 virus variants), especially when compared to sub-cutaneous delivery.

Yet another aspect of the invention is a method of inducing an immune response in a subject, comprising administering the vaccine composition of the present invention. In some embodiments, the method comprising concurrently administering an effective amount of the vaccine composition of the present invention with a pharmaceutically acceptable carrier. Preferably, the administering comprises contacting nasal mucosae. In some embodiments, the immune response comprises a prophylactic immune response or a therapeutic immune response.

It should be understood that any and all embodiments of the present disclosure can be combined with technical features in any other embodiment or multiple other embodiments to obtain additional embodiments under the premise of no conflict. The invention includes such combinations resulting in further embodiments.

EXAMPLES

The examples and exemplary embodiments below are intended to be purely exemplary of the invention and should therefore not be considered to limit the invention in any way.

Materials and Methods

Animal studies

All animal studies were conducted at the vivarium in Duke-NUS Medical School and approved by the Singapore Health Services (SingHealth) IACUC. C57BL/6 mice purchased from InVivos were used for all experiments and immunizations began when they were 8-10 weeks old. Male Syrian golden hamsters (6 to 7-weeks old) were used for SARS-CoV-2 challenge studies and were procured from the Advanced Centre for Treatment, Research and Education in Cancer, Tata Memorial centre, Navi Mumbai, India. The animals were housed separately based on groups and maintained in individually ventilated cages at 23±1°C temperature and 50±5% relative humidity, given access to standard pellet feed and water ad libitum and maintained on a 12h day/night light cycle at the Viral Biosafety level-3 facility, Indian Institute of Science, Bangalore. The hamster study complied with institutional biosafety guidelines (I BSC/IISc/ST/17/2020; I BSC/IISc/ST/18/2021), following the Indian Council of Medical Research and Department of Biotechnology recommendations. All animal experiments were reviewed and approved by the Institutional Animal Ethics Committee (Ref: IAEC/IISc/ST/784/2020) at the Indian Institute of Science. The experiments were performed according to the guidelines of CPCSEA (The Committee for Control and Supervision of Experiments on Animals).

Viruses

SARS-CoV2 Wuhan isolate (Hong Kong/VM20001061/2020, Cat No.: NR-52282) and Omicron variant (USA/PHC658/2021 , Cat No.: NR-56461) were obtained from BEI resources, NIAID, NIH. They were propagated (at 0.01 MOI) and titrated by plaque assay in Vero-E6 cells.

Mouse Vaccinations

Mice were vaccinated with 1 pg of recombinant S-RBD protein (Sino Biological), having the amino acid sequence set forth in SEQ ID NO: 5, either with or without 20 pg of Mastoparan-7 (M7; SEQ ID NO: 3; Sigma-Aldrich). For some groups, S-RBD was resuspended in alum (aluminium hydroxide; InvivoGen). Footpads were injected with a 20 pL volume of vaccine or vehicle control (PBS). For nasal inoculations, the same doses of 1 pg S-RBD + 20 pg M7 were instilled in a volume of 12 pL per mouse (6 pL per nostril).

Hamster Vaccinations

The hamsters were vaccinated either I.N. or S.C. with SARS-CoV-2 S-RBD (3 pg/animal) and M7 (60 pg/animal) on days 0 and 14. For I.N. immunization, the vaccine formulation was given in a total volume of 20 pL (10 pL per nostril). For S.C. immunization, hamsters were injected in the neck region with a volume of 90 pL. Weight was recorded before the administration of each vaccine dose. Post-immune sera were collected one day before infection, i.e. week 5 after the first vaccine dose. Blood collection was performed retro-orbitally and blood was allowed to clot for 30 min at room temperature (RT). Following the incubation, samples were centrifuged at 3000 rpm for 15 min and clear serum was collected in separate tubes and stored at -80°C.

Hamster SARS-CoV-2 infections

Animals were infected under anesthesia following intraperitoneal injection of Ketamine (150mg/kg) (Bharat Parenterals Limited) and Xylazine (10mg/kg) (Indian Immunologicals Ltd). They were challenged with Hong Kong (Wuhan-like) or Omicron SARS CoV-2 viruses I.N. with 105 plaque-forming units (PFU) in 100 pL PBS. Bodyweight and clinical signs of animals were recorded daily. Hamsters were observed daily until day 4 post-infection for the following clinical signs and were scored based on severity: Lethargy (none=0, mild=1 , severe=2), piloerection (none=0, mild=1 , moderate=2, severe=3), abdominal respiration (none=0, mild=1 , severe=2), hunched back (none=0, mild=1 , severe=2). Bodyweight loss was also considered as a clinical sign, with scoring done from a scale of 1 to 3 (1-5 %= 1 ; 5.1-10%= 2; 10.1 -15%=3). On day 4, all animals were euthanized using an overdose of Xylazine (Indian Immunologicals Ltd). The lung samples were harvested for virological (left lobe) and histopathological analysis (right lobe). Quantification of lung viral load by qRT PCR

Lung samples from hamsters were processed using a tissue homogenizer and total RNA was isolated using TRIzol (15596018, Thermo Fisher) according to the manufacturer’s instructions. A 10pL reaction mixture with 100ng of RNA per sample, in a 384 well block was used to quantify viral RNA using AgPath-ID™ One-Step RT-PCR kit (AM1005, Applied Biosystems). The following primers and probes targeting the SARS CoV-2 N-1 gene were used. Forward primer: 5'GACCCCAAAATCAGCGAAAT3' and Reverse primer: 5'

TCTGGTTACTGCCAGTTGAATCTG3', Probe: (6-FAM/BHQ-1)

ACCCCGCATTACGTTTGGTGGACC. The Ct values were used to determine viral copy numbers by generating a standard curve using a SARS CoV-2 genomic RNA standard.

Lung tissue specimens from hamsters were fixed in 4% paraformaldehyde in PBS and embedded in paraffin blocks. Tissue sections of 4-6pm thickness were stained with Hematoxylin and Eosin (H&E). Slides were examined by light microscopy for 3 histological criteria in the lung (Alveolar infiltration and exudation, vasculature inflammation and peribronchiolar infiltration with epithelial desquamation) and each criterion was scored based on the severity on a scale of 1 to 3 (none=0, mild=1 , moderate=2, severe=3).

Flow cytometry

NALT or popliteal LNs were harvested at necropsy along with spleens. The tissues were digested with collagenase (Sigma) and passed through 70 pm cell strainers (Corning) to prepare single cell suspensions. RBCs were lysed to remove them from spleen single cells using RBC lysis solution (BioLegend). Total cell numbers were determined by counting on a hemocytometer. To facilitate intracellular staining for cytokines, single cell suspensions were incubated for 5 hours in 2 pM monensin (BioLegend) to inhibit intracellular protein trafficking. Cells were stained with Live/Dead Fixable Blue Dead cell stain (Invitrogen, L23105) for 10 minutes prior to staining with anti-CD45-BUV395 (564279), anti-CD3e- PercP-Cy5.5 (551163), anti-CD4-BV650 (563232), anti-CD8a- Alexa Fluor 700 (557959), and anti-CD69- FITC (557392) (all from BD Biosciences), anti-NK1.1-PE (eBioscience, 12-5941-82), and anti-yb TCR-APC (BioLegend, 118116) for 1h. Subsequently, cells were washed 3x with 1% BSA in PBS solution, fixed with 4% paraformaldehyde (PFA) for 20 minutes on ice, and permeabilized with 0.1 % saponin in 1% BSA in PBS solution. Intracellular staining was done for IFN-Y (anti-IFN-v-APC-Cy7, BioLegend, 505850) and IL-17a (anti-IL-17A-BV510, BD Biosciences, 564168) for 1 hr. Cells were washed 3x with 0.1 % saponin in 1 % BSA-PBS solution and finally resuspended in 1% BSA-PBS. Cells were acquired using an LSRFortessa cell analyzer (BD Biosciences) and analysed using FlowJo software (version 10). Heatmaps were generated using Heatmapper software (Babicki, S. et al. Nucleic Acids Res 44, W147- 153, 2016) after normalization to saline-challenged controls and log-transformation of data.

ELISA

Recombinant S-RBD protein (Sino Biological) was coated onto 96 well plates in carbonate (15 mM) bicarbonate (35 mM) buffer at 4°C, overnight. Serial 2x dilutions of serum were added to the coated plates and incubated overnight at 4°C. Plates were washed 3x with PBS and treated with an AP conjugated anti-mouse IgG antibody (Southern Biotech) for 1.5 hours. For avidity ELISA, plates were washed with 4 M urea for 10 minutes prior to addition of secondary antibodies. Plates were washed again 3x with PBS and AttoPhos substrate (Promega) was added to each well. Fluorescence intensity at excitation/emission 440/560nm was measured using a Tecan Spark 10M plate reader after 45 minutes.

Surrogate virus neutralization assay

A study team member blinded to the experimental groups performed the multiplex sVNT assay as previously described (Tan, C. W. et al. N Engl J Med 385, 1401-1406, 2021). In brief, serum samples were pre-incubated with avidin microspheres coated with AviTag-biotinylated RBD proteins from different SARS-CoV-2 strains (including ancestral, Alpha, delta, Lambda, Beta, Gamma, Mu, Delta plus, Omicron BA.1 and BA.2) for 15 min at 37°C, followed by addition of Phycoerythrin (PE)-labelled human ACE2 at a final concentration of 2,000 ng/ml for another 15 min at 37°C. After two washes, the signals were acquired using the Luminex MAGPIX ireader.

T cell activation assay

JAWSII cells (1.5x10 ⁴ ) were seeded to each well of a 96-well flat-bottom plate in aMEM with 5 ng/mL GM-CSF and incubated at 37°C with 5% CO2 in atmospheric air. 24 hours after seeding 1 pg of S-RBD protein was added to each well. On day 3 post-seeding, spleens were harvested from vaccinated mice at day 35 post-vacci nation and prepared as described above. Wells were washed with PBS and 1x10 ⁵ splenocytes were added to each well in RPMI containing 10% FBS. Cells were incubated at in a 5% CO2 incubator at 37°C for four days before analysis by flow cytometry. At day 7 post-seeding, cells were incubated for 5 hours in 2 pM monensin (BioLegend) to inhibit intracellular protein trafficking and then stained with Live/Dead Near I R Dead cell stain (Invitrogen, L10119) for 10 minutes. Cells were then stained with anti-CD3e- PercP-Cy5.5 (551163), anti-CD4-BV650 (563232), anti-CD8a-Alexa Fluor 700 (557959), anti-CD44-BV510 (563114), anti-CD62L-PE-Cy7 (560516, all from BD Biosciences) and anti-CD69-eFluor450 (11-0691-82, eBioscience) for 1 hour in PBS supplemented with 1 % BSA on ice. Subsequently, cells were washed 3x with 1 %BSA in PBS, fixed with 4% PFA at 4°C for 20 minutes, and permeabilized with 0.1% Saponin in 1% BSA- PBS solution for 30 minutes. Intracellular staining was done for IFN-y (anti-IFN-y-BV711 , BD Biosciences 554412) and TNFa (goat-anti-TNFa, R&D Systems AF-410-NA, anti-goat-IgG- FITC, Jackson ImmunoResearch, 305-096-006) for 1 hour in permeabilization solution. Data were acquired using LSRFortessa cell analyzer (BD Biosciences) and analysed using FlowJo software (version 10).

T cell adoptive transfer and antigen challenge

Spleens were harvested from vaccinated mice at day 35 post-vaccination and single-cell suspensions were prepared as described above. RBCs were lysed using 1x RBC lysis solution (BioLegend) and cells were counted using a hemocytometer. T cells were isolated from the splenocytes using Pan T Cell Isolation Kit II (Miltenyi BioTec) according to the manufacturer’s protocol and 1x10 ⁶ T cells were transferred to Thy1.1 mice by tail vein injection. Mice were challenged with 50 pg S protein (full length; SEQ ID NO: 4) intranasally in 20 pl PBS 24h posttransfer. The SARS-CoV2 S protein was expressed using the vector pCAGGS containing the SARS-Related Coronavirus 2, Wuhan-Hu-1 Spike Glycoprotein Gene from BEI (NR-52394) and purified following the published protocol (Stadlbauer, D. et al. Curr Protoc Microbiol 57, e100, 2020). Mice were euthanized 5 days post-challenge and lungs and brachial lymph nodes were harvested. The tissues were digested with collagenase (Sigma) and passed through 70 pM cell strainer (Corning) to prepare single cell suspensions. RBC lysis was done for spleen single cells using RBC lysis solution (BioLegend). Cells were stained with Live/Dead Blue Dead cell stain (Invitrogen, L23105) for 10 minutes. Cells were then stained with anti-CD45- BUV395 (564279), anti-CD4-BV650 (563232), anti-CD8a-Alexa Fluor 700 (557959), and anti-CD44-BV510 (563114), anti-CD62L-PE-Cy7 (560516, all from BD Biosciences), anti- NK1.1-PE (eBioscience, 12-5941-82), anti-CD69-eFluor450 (eBioscience, 11-0691-82, or PerCP-Cy5.5 45-0691-82) anti-CD90.2-PerCP-Cy5.5 (BioLegend, 140322, or eFluor450 eBioscience 48-0902-80) and anti-yb TCR-APC (BioLegend, 118116). Subsequently, cells were washed, fixed with 4% paraformaldehyde (PFA), and permeabilized with 0.1 % Saponin in 1% BSA-PBS solution. Intracellular staining was done for IFN-y (anti-IFN-y-BV711 , BD Biosciences 554412) and TNFa (goat-anti-TNFa, R&D Systems AF-410-NA, anti-goat-IgG- FITC, Jackson ImmunoResearch 305-096-006) in permeabilization solution for 1 hour on ice. Cells were acquired with a LSRFortessa cell analyzer (BD Biosciences) and analysed using FlowJo software (version 10).

Data were analysed using Prism 9 and Microsoft Excel software. For multiple groups comparison, ANOVA was used, while Student’s unpaired t-test was used when two groups were compared. All data are presented as the means of experimental replicates using individual mice and error bars represent the SEM throughout the disclosure.

Results

The ability of various vaccine formulations utilizing recombinant S protein to activate T cells was first compared. For this, mice were immunized subcutaneously (S.C.) with the receptor binding domain (RBD; SEQ ID NO: 5) of S protein, combined with either adjuvant, Alum or M7 (Fig. 1A), or intra-nasally (I.N.) with an equivalent amount of S-RBD and M7 (Fig. 1 B). Although the RBD is small, our assessments suggested that there are multiple CD4 ⁺ and CD8 ⁺ T cell epitopes predicted for mice in this region of the S protein, which is consistent with the observations in humans that the RBD contains confirmed T cell epitopes (Mateus, J. et al. Science 370, 89-94, 2020). The T cell responses 5 days post-immunization were measured by flow cytometry in the draining lymphoid organs for the respective tissues for S.C. or I.N. immunizations, respectively, either the popliteal lymph nodes (PLN) or the nasal-associated lymphoid tissue (NALT), the latter of which is the rodent structure analogous to Waldeyer’s ring in humans (Brandtzaeg, P. Am J Respir Crit Care Med 183, 1595-1604, 2011). This time point was chosen because it represents an early time following vaccination when antigenspecific CD4 and CD8 T cell responses can be detected in experimental mouse models. Systemic T cell responses were also assessed in the spleen following either route of immunization. The numbers of total and activated T cells in these secondary lymphoid organs after subcutaneous or nasal injection with M7+S-RBD were compared to saline-treated or S- RBD antigen alone-treated control groups. Subcutaneous immunizations with M7 induced increased retention of total CD3 ⁺ T cells as well as CD8 ⁺ and CD4 ⁺ T cell subsets in the draining PLN, and conventionally innate T cells, y5 and NKT cells, followed a similar trend (Fig. 2A and Fig. 3A). Vaccination with alum + S-RBD also induced strong T cell activation responses in the local draining lymph node, and conventionally innate T cells, y5 and NKT cells were similarly increased in the PLN (Fig. 2A and Fig. 3B). In contrast, the total T cell and CD8+ T cell numbers were not significantly affected in the NALT following mucosal challenge with M7+S-RBD, while there was a small but significant increase in the total number of CD4 ⁺ T cells (Fig. 2A and Fig. 3C). There were also increased numbers of activated CD69 ⁺ CD4 ⁺ T cells in the NALT following I.N. vaccination, which was not observed to a significant level in the PLN after S.C. vaccination with M7+S-RBD (Fig. 2A and Fig. 4A). These results suggest that peripheral S.C. vaccination with Alum or M7 as adjuvant results in increased activation of T cells in the PLN, while the effects of M7 on T cell activation in the NALT are more moderate and skewed towards CD4 ⁺ T cell activation.

In contrast to the draining lymphoid organs, the systemic activation of T cells was much higher in the spleen following mucosal vaccination. There were increased numbers of total T cells, as well as total, y5, NKT and activated CD4 ⁺ & CD8 ⁺ cells after LN. vaccination with M7+S- RBD compared to unvaccinated or S-RBD-antigen alone treated controls, which did not occur in the S.C. vaccinated groups (Fig. 2B, Fig. 3A, Fig. 5 and Fig. 6). These data illustrate that mucosal immunization results in improved systemic immune activation, compared to peripheral S.C. immunization, even comparing the same adjuvant and antigen. In contrast, immune activation was more restricted to the draining lymphoid tissue following subcutaneous injection (Fig. 2). These results highlighted a skewing of T cell activation in the draining lymphoid tissue towards increased CD4 ⁺ activation in the NALT and increased CD8 ⁺ activation in the spleen but, overall, support that immune activation is significantly induced in the draining lymphoid tissues after either S.C. or I.N. vaccination. I.N. vaccination was associated with stronger T cell activation in the spleen compared to S.C. vaccination.

In addition to T cell activation, the inventors also measured intracellular cytokine expression in T cells, including IFN-y, TNF and IL-17, as these cytokines define polarized T cell responses (Dong, C. Annu Rev Immunol 39, 51-76, 2021). While intracellular IFN-y and TNF were not detected at this time point, I L-17 ⁺ expressing CD8 ⁺ T cells were uniquely enhanced in the spleen of mucosally-immunized mice, but not in the NALT of the same animals or in either the spleen or draining LNs of mice given S.C. immunizations with the same adjuvant, M7 (Fig. 7). This is interesting given the fact that Th17 responses have been associated with IFN-y - independent immune activation, augmented B cell activity, IgA induction at mucosal sites, and protective immune responses during respiratory viral infections (Wang, X. et al. Cell Mol Immunol 8, 462-468, 2011). Together these results indicate that the phenotypes of T cells, and particularly their activation levels and cytokine production, are influenced by the vaccination route and adjuvant used.

Improved lung pathology in SARS-CoV-2 challenged hamsters after mucosal vaccination

To confirm that the I.N. and S.C. vaccines using M7 as an adjuvant would provide early protection from clinical disease during SARS-CoV-2 challenge, the inventors used a previously described Syrian hamster model (Imai, M. et al. Proc Natl Acad Sci U S A 117, 16587-16595, 2020), which is thought to more closely recapitulate COVID-19 disease in humans compared to mice, without the need for genetic modification (Sia, S. F. et al. Nature 583, 834-838, 2020). Animals were vaccinated using a prime-boost strategy, followed by a challenge at 5 weeks using the Hong Kong/VM20001061/2020 virus, a parental (“Wuhan”) strain virus, as show in in Fig. 8. Although hamsters generally exhibit reduced neutralizing antibody titers to S-RBD compared to other experimental model species, the inventors observed seroconversion and the presence of neutralizing antibodies in all of the vaccinated animals prior to challenge (data not shown). Animals were monitored daily after virus inoculation for 4 days for body mass and clinical signs and the results from vaccinated groups were compared to healthy uninfected controls and unvaccinated infected controls. Both groups of I.N. and S.C. vaccinated animals were significantly and similarly protected from clinical disease compared to unvaccinated animals, based on clinical score (Fig. 9A). Although all groups of infected animals, lost weight following infection, it was noted that by day 4, the final day of monitoring prior to necropsy, I.N. vaccinated animals had begun to recover their weight significantly compared to unvaccinated and S.C. vaccinated animals (Fig. 9B). However, significant differences in virus genome quantification in the lungs at the time of necropsy was not detected, although it cannot rule out that this also relates to the early time point used following inoculation. Even so, histopathological analysis of tissues from all animals (Fig. 9C) confirmed significant protection of I.N. vaccinated animals from severe lung inflammation. I.N. vaccinated animals showed reduced peribronchiolar infiltration, vascular inflammation, and alveolar space exudation, as shown in representative images (Fig. 10). These results support that I.N. vaccination results improved protection from clinical disease compared to S.C. vaccination with the same formulation.

Improved polyfunctional memory recall by T cells upon antigen exposure following mucosal vaccination

Given the strong systemic immune response observed in the spleen immediately following mucosal vaccination of mice with M7+S-RBD, (Fig. 2B) and the subtle yet significant differences in clinical outcomes between hamsters vaccinated with the same formulation I.N. versus S.C. upon SARS-CoV-2 challenge (Figs. 8-10), the inventors aimed to extend beyond describing the acute T cell responses elicited by the vaccine by comparing the antigen-specific T cell memory responses. For this, the inventors returned to the mouse model to allow further immunological characterization and T cells were harvested from spleens 5-weeks postvaccination for mice given S.C. versus I.N. challenges with the same antigen and adjuvant combination (M7+S-RBD) and tested ex vivo for their activation following antigen stimulation, according the experimental design shown in Fig. 11. Antigen stimulation induced expansion and activation of CD4 ⁺ and CD8 ⁺ T effector memory (TEM) and T central memory (TCM) cells in vaccinated groups over the baseline found in naive animals, but there were not significant differences in these populations between the two routes of vaccine administration (Figs. 12 and 13), except for the elevated numbers of activated CD8 ⁺ TEM cells, based on CD69 expression, observed in the S.C. group (Fig. 12). This seemed consistent with the strong induction of CD8 ⁺ T cells at day 5 following S.C. immunization (Fig. 2A). Intracellular staining for cytokines identified a heightened functional response by both CD4 ⁺ and CD8 ⁺ TCM cells, where a higher proportion of TCM cells were TNF ⁺ following LN. compared to S.C. immunization (Figs. 12B and 14A). Furthermore, I.N. immunization induced more CD4 ⁺ TC cells that were polyfunctional based on the co-expression of TNF and IFN-y (Fig. 14B). Not only were the proportions of TNF ⁺ TCM cells higher following antigen stimulation of T cells from I.N. compared to S.C. vaccine groups, but higher expression of TNF was also apparent by flow cytometry (Fig. 13C). Stronger TCM functional responses after I.N. vaccine administration is consistent with increased activity of memory cells that are able to home to multiple LNs by virtue of their CD62L expression (Sallusto, F., etal., Nature 4( \ , 708-712, 1999). These results support that, even controlling for vaccine formulation by using the same adjuvant, mucosal immunization promotes greater systemic antigen-specific memory responses compared to S.C. injection, where the response is concentrated in the draining LNs. Furthermore, recall of those TMEM cells from I.N. vaccination leads to an enhanced polyfunctional phenotype based on the expression of multiple cytokines.

The inventors next questioned whether the improved polyfunctional T cell phenotype induced by mucosal vaccination was T cell-intrinsic and whether it would influence immune responses in the lung upon antigen challenge. To address this question, an adoptive transfer experiment was performed using the Thy1 .1/1.2 system for tracking donor versus recipient T cells (Fig. 15). For this, T cells were harvested from the spleens of Thy1.2 ⁺ mice given I.N. or S.C. vaccination with M7+S-RBD, with a boost to ensure robust responses, and adoptively transferred into recipient mice with Thy 1.1 ⁺ T cells. To simulate a viral infection without the potential of differential viral replication kinetics influencing the T cell recruitment and activation, mice were given an I.N. challenge of full-length S protein. After allowing 5 days for memory recall and CD8 ⁺ T cell trafficking, the inventors isolated the lungs and their draining LNs, the brachial LNs, to assess the phenotypes and activation profiles of donor Thy1.2 ⁺ T cells (Fig. 15). As expected, Thy1.2 ⁺ donor T cells from vaccinated groups could be detected in the lungs of Thy 1.1 ⁺ recipient mice following S-antigen challenge (Fig. 16A) and these were mostly CD8 ⁺ T cells (Fig. 16B), whereas CD4 ⁺ cells in the lungs had very low frequency (data not shown). Neither unvaccinated control mice nor vaccinated control mice given S-antigen challenge exhibited T cell recruitment to the lungs, suggesting the antigen-specificity of the response in mice given T cells from vaccinees (Fig. 16A). Given the scarcity of donor CD4 ⁺ T cells in lungs and based on the important functions of CD8 ⁺ T cells in responding to viral infections in peripheral tissues, donor memory CD8 ⁺ T cells were characterized. First, there were no significant differences in the numbers of memory CD8 ⁺ T cells that were recruited into the lung tissue between groups whose donor T cells were derived from LN. versus S.C. vaccinated animals (Fig. 16B). However, donor memory CD8 ⁺ T cells expressed higher levels of TNF compared to recipient memory CD8 ⁺ T cells for both vaccination groups, with the highest levels expressed in the group having donorT cells from mice with I.N. vaccination (Fig. 17), suggesting improved antigen-specific activation at the challenge site. The donor memory CD8 ⁺ T cells in the lungs also expressed higher levels TNF as determined by MFI by flow cytometry (Fig. 18A) and, interestingly they also expressed higher levels of the activation marker CD69 by MFI (Fig. 18B). These results suggest that while there was no effect on the efficiency of memory CD8 ⁺ T cell recruitment into the lungs following challenge, the TMEM cells from I.N. vaccinated mice were more activated and functional following their entry into the lung tissue, supporting improved antigen-specific recall.

The inventors also questioned whether S antigen challenge in animals (as performed according to Fig. 15) would induce heightened TCM responses and polyfunctional T cell responses in vivo in lung draining LNs following transfer of T cells from I.N. compared to S.C. challenges, similar to observations in the ex vivo assays (Figs. 11-14). Donor T cells could be identified in the brachial LNs based on Thy1 .2 expression. The CD4 ⁺ and CD8 ⁺ subsets of memory donor T cells were examined and there were both CD4 ⁺ and CD8 ⁺ populations that expressed cytokines including TNF and IFN-y which were more abundantly present in the LNs of mice that received donor T cells from vaccinated mice. Additionally, significantly increased proportions of donor CD8 ⁺ T cells having the TCM and TE phenotypes were present in brachial LNs for the I.N. vaccinated group (Fig. 19A-B). Furthermore, more CD8 ⁺ and CD4 ⁺ donor memory cells in the brachial LN produced cytokines TNF and IFN-y following antigen challenge in mice receiving T cells derived from I.N. vaccination compared to S.C. vaccination (Fig. 19C-D). These results indicate that T cells develop an improved polyfunctional phenotype following I.N. vaccination, able to respond to challenge in the lung-draining LNs with higher levels of activation and cytokine production.

Superior antibody responses and clinical protection following mucosal vaccination

Improved systemic T cell responses following I.N. were found compared to peripheral S.C. vaccination; however, given the high correlation between antibody responses and protection against symptomatic infection for humans vaccinated against SARS-CoV-2, the inventors questioned whether mucosal vaccination influenced antibody responses. Mucosal vaccination is associated with improved IgA responses, and consistent with this we observed that I.N. vaccination improved Spike-specific IgA secretion in nasal washes, compared to S.C. vaccination with the same formulation by ELISA (Fig. 20A). Moreover, the inventors were also curious if there were differences in antibody specificity and neutralizing ability resulting from the different vaccination routes. Therefore, the inventors also characterized serum IgG responses against S-RBD. Early responses at 3 weeks post-immunization showed no difference in binding to the same antigen, S-RBD, between mice exposed to the M7-S-RBD vaccine via the I.N. or S.C. routes; however, by 5 weeks post-immunization, anti-S-RBD titers were significantly higher in mice vaccinated via the mucosal I.N. route (Fig. 20B). No significant differences in antibody avidity were observed to the same S-RBD used as the vaccine antigen (Fig. 20C), suggesting the polyclonal antibodies had a similar polyclonal strength of binding to the original antigen used for vaccination. In order to gain an understanding of whether the antibodies induced could be protective against SARS-CoV-2, a surrogate virus neutralization test was used which detects total immunodominant neutralizing antibodies targeting S-RBD (Tan, C. W. et al. Nat Biotechnol 38, 1073-1078, 2020). The surrogate neutralization test against S-RBD from an ancestral strain similar to the antigen used for vaccination, the Singapore/2/2020 strain, revealed that there was effective and similar concentration-dependent induction of neutralizing antibodies by both I.N. and S.C. vaccination routes (Fig. 20D). The inventors also investigated the potential of antibodies generated by I.N. versus S.C. vaccine exposure to induce antibodies with cross-neutralizing capacity towards other variants of SARS-CoV-2. While S.C. inoculation induced efficient neutralizing antibodies against the Alpha variant in addition to the parental strain, cross-neutralization against other variants tested was low for the Delta, Delta plus, and gamma VOCs and not significantly present for others (Fig. 20E and Figs. 22-24). In contrast, I.N. vaccination induced more broadly cross-protective antibodies, with more significant neutralization at higher dilutions, which was significant compared to naive controls for all variants tested, including Alpha, Delta, Beta, Gamma, Delta plus, Lambda, Mu, OmicronBA.1 , and OmicronBA.2 (Fig. 20E and Figures 22-24). This increased neutralization was not associated with any significant differences in antibody binding to the S-RBD of each variant by vaccination group (Fig. 21A). Indeed, antigen binding for each variant was not significantly correlated with sVNT titer, and a shift could be seen indicating more efficient neutralization of VOC by sera from I.N. vaccinated animals at these similar binding titers to S.C. vaccinated groups (Fig. 21 B). This suggests that mucosal vaccination alters the breadth of neutralizing antibodies and may promote broadly neutralizing responses.

Given the unique profile of T cell and antibody responses following mucosal vaccination in mice and the suggestion that VOC may be better cross-neutralized by antibodies elicited by mucosal vaccination, the inventors also questioned whether VOC cross-protection would be observed in the hamster challenge model. Using the same experimental time course in Fig. 8, the inventors vaccinated hamsters using the same parental strain S-RBD antigen but challenged them with a virulent isolate of the Omicron VOC (USA/PHC658/2021). As observed for the homologous challenge, the inventors did not observe any changes in lung viral titers on day 4 at the time of necropsy (data not shown), but at the same time point protection from clinical disease was observed in both vaccinated groups since only the unvaccinated, Omicron-infected group still had a significantly increased clinical score above baseline (Fig. 25A). Consistent with observations in humans, the disease induced by Omicron was milder than the disease induced by the parental strain (Hong Kong isolate) based on the clinical score (Figs. 9A and 25A). As with the parental strain challenge (Hong Kong), we also observed reduced pathology in the lungs of hamsters in the I.N. vaccinated group (Fig. 25B), particularly with respect to reduced infiltration of cells into the lung tissue and reduced edema in alveolar spaces compared to S.C. vaccinated animals (Fig. 25C). These data support that there are subtle but quantitative improvements to cross-protection from disease induced by mucosal vaccination.

Here the inventors tested vaccine formulations for I.N. versus S.C. delivered S-RBD antigen, combined with mucosal adjuvant M7, and showed significant protection of SARS-CoV-2- infected hamsters from clinical disease. This protection correlated with improved IgA secretion following I.N. vaccination, production of a T cell-intrinsic phenotype, superior systemic immune responses, and improved antibody responses, including improved antibody persistence in vivo and cross-protection against SARS-CoV-2 variants compared to S.C. vaccination with the same formulation. These outcomes are all desirable correlates of vaccine protection.

The inventors observed the heighted systemic T cell responses in multiple T cell subsets in the spleen during the acute activation phase following mucosal vaccination, which also persisted in the TMEM cell compartment several weeks following challenge. TMEM cells generated by mucosal vaccination also exhibited an improved polyfunctional phenotype, characterized by dual expression of TNF and IFN-y, both upon ex vivo stimulation as well as in vivo memory recall to antigen. In vivo splenic T cell responses during the acute phase following vaccination were also characterized by improved IL-17 production. Interestingly, IL- 17 has been associated with lung IgA secretion (Jaffar, Z., et al., J Immunol 182, 4507-4511 , 2009), which was also observed being improved in the mice following mucosal vaccination. Adoptive transfer of T cells obtained after resolution and contraction of the vaccine-induced response from vaccine recipients who had been given the exact same formulation of antigen and adjuvant, differing only by site of inoculation, confirmed the T cell-intrinsic imprinting of the site of inoculation on the TMEM phenotype. Importantly, improved T cell activation and polyfunctionality in the lungs following antigen-challenge occurred in recipient mice who had been transferred T cells from LN. rather than S.C. vaccination. This occurred even though similar numbers of T cells were recruited into the lung tissue for both recipient groups. Consistent with this study, others have also observed robust T cell activation following mucosal vaccination in animal models of subunit vaccination with S protein (Kingstad-Bakke, B. et al., Proc Natl Acad Sci U S A 119, e2118312119, 2022). This work illustrates that the polyfunctional nature of TMEM cells, independent of their peripheral tissue homing abilities, could contribute to mucosal site protection and highlights the role of T cells in establishing systemic mucosal vaccine-induced memory since these responses can be adoptively transferred by T cells. A goal of vaccination is to induce the type of immune response that most closely approximates natural immune protection against infection, while eliminating risks of disease. For COVID- 19, despite some controversy (Sscemaganda, A. et al., Nat Commun 13, 3357, 2022), human vaccines to parental SARS-CoV-2 do not appear to induce robust airway-resident antigen-specific T cells, unlike those who experienced natural infections (Lim, J. M. E. et al., J Exp Med. 219(10):e20220780, 2022; Tang, J. et al., Sci Immunol, eadd4853, 2022;). This highlights the potential of next-generation COVID- 19 vaccines to improve mucosal and systemic immune responses through modulation of T cells.

Of the TMEM cells affected by the vaccination strategy, it was identified here that T _C cells are a central component of systemic mucosal vaccine- induced immunity. Activated and/or polyfunctional T _C cells were observed in the spleen following vaccination, as well as in the T E compartment that was effectively recalled by antigen re-stimulation. While antigenspecific TCM were also present in subjects that received S.C. administered vaccine, and they could also be reactivated following adoptive transfer, as expected, both their numbers and the magnitude of their cytokine production responses were heightened in mucosal vaccines. T _C M cells are particularly defined by their expression of CD62L, which allows them to roll on high endothelial venules and enter secondary lymphoid tissues (Sallusto, F., et al., Curr Top Microbiol Immunol 251 , 167-171 , 2000). It is likely that the increased numbers of CD62L- expressing cells within the TMEM compartment following mucosal vaccination is key for the homing of these cells to the spleen that typifies increased systemic immunity. These results were observed in the context of antigen delivery with an appropriate mucosal adjuvant, while equivalent concentrations of antigen alone induced sub-optimal T cell activation responses. Efficient conversion to the TCM phenotype could allow broader dissemination of antigenspecific TMEM cells, which could increase the chances of subsequent exposure to antigen and memory recall and/or potential to provide B cell help in other lymphoid organs. During memory recall, TCM are also thought to serve as a pool of T cells that can replenish the TEM population (Abdelsamed, H. A. et al., J Exp Med 214, 1593-1606, 2017; Moskowitz, D. M. et al., Sci Immunol. 2(8):eaag0192, 2017; Kumar, B. V., Connors, T. J. & Farber, D. L. Immunity 48, 202-213, 2018; Ahmed, R., et al., Nat Rev Immunol 9, 662-668, 2009). And consistent with this, in vivo antigen challenge was also associated with significantly increased numbers of CD8 TEM in the lung-draining brachial LNs of recipients of T cells from LN. vaccinated groups, even though ex vivo antigen restimulation of spleen T cells prior to transfer resulted in improved activation for CD8 TEM in the S.C. vaccinated group. These results highlight the potential of site-specific immune responses to influence the balance and tissue homing abilities of T E sub-populations.

Systemic T cell responses are also likely to impact B cell dependent antibody responses, owing to the influence of T cells, particularly CD4 T cells, on B cell help and germinal center activity (Cyster, J. G. & Allen, C. D. C. Cell 177, 524-540, 2019; Song, W. & Craft, J Immunol Rev288, 85-96, 2019). A subset of CD4 T _C expressing CXCR5 are also highly consequential to germinal center production since they can upregulate BCL-6 during memory recall, promote plasma cell differentiation and drive secondary germinal center formation and antibody production (Morita, R. et al., Immunity 34, 108-121 , 2011 ; MacLeod, M. K. et al., J Immunol 186, 2889-2896, 2011 ; Locci, M. et al., Immunity 39, 758-769, 2013; Robinson, A. M. et al., bioRxiv, 2021.2009.2017.460841 , 2021). Consistent with this, improved antibody responses that coincide with the characterization of mucosal vaccine-induced responses as dominated by polyfunctional T _C were identified. Both S.C. and I.N. vaccination strategies induced S- specific antibodies of similar avidity and neutralization towards the parental S protein, yet differences in antibody responses were also significant. I.N. vaccination induced a small but significantly higher level of antibodies at 5 weeks after the final vaccine boost and more broadly neutralizing antibodies against multiple VOC, compared to S.C. vaccination. Often, it is assumed that mucosal vaccination influences antibodies primarily through inducing IgA secretion, and here antigen-specific IgA production was uniquely induced by the I.N. challenge model was observed too. However, these data also emphasize that gains in serum IgG quality could be, at least in certain contexts, an additional benefit to mucosal vaccination. Since broadly-neutralizing antibody responses were induced without altered avidity and without changes in antibody binding to the same S-RBD antigens from multiple VOC, this suggests that the mucosal vaccination strategy might have resulted in the preservation of antibodies against more diverse epitopes within the polyclonal pool.

The results here are unique in that the responses induced by the same dose of antigen for two routes of immunization were directly compared since M7 adjuvant is effective as an adjuvant both when injected in the skin and also when administered at mucosal surfaces. However, the limitations of S.C. vaccination were not the result of the adjuvant alone, as M7 has been shown to perform well as an adjuvant when injected S.C. (St John, A. L. et al., NPJ Vaccines. 5(1): 12, 2020), and these differences were also consistently observed when compared to the human-approved adjuvant, Alum. Even so, it is also possible that some of the vaccine induced effects observed here are adjuvant specific, since the adjuvant’s mechanism of mast cell activation (likely with some other beneficial effects on other myeloid cells (Lentschat, A. et al., J Immunol 174, 4252-4261 , 2005) is unique compared to other strategies, and since mast cell phenotypes in these tissues are different (St John AL, Rathore APS, Ginhoux F. Nat Rev Immunol. 23(1): 55-68, 2022). It was also observed that both vaccine routes could limit clinical disease during a subsequent virulent challenge in hamsters, which emphasizes that significant differences in immune responses may not always convert to unique and enhanced protective capacity. Although a significant reduction in viral genome copies was not observed in this model, it is possible that the infection clearance kinetics could differ at later time points and that the 4 day time point was too early to observe differences in viral clearance. However, humans that are given Spike protein-based vaccines also appear to have significantly reduced risk of severe disease, while viral burden in the nasal passages appears similar between the vaccinated and unvaccinated in many studies8, although not all. This also supports that protection from clinical disease could be linked to the phenotype of vaccine-induced immune responses. Here, hamsters were exposed to the live SARS-CoV-2 challenge 5 weeks following vaccination, which models the immediate host responses to vaccines. Future studies will be needed to determine if the host responses remain equally durable by both routes of immunization and if the improved systemic T _C M activation and VOC cross-neutralizing antibodies function to improve responses during subsequent challenges, which in humans, unlike laboratory animals, could occur many years following vaccination.

Improved systemic immune responses and improved variant cross-neutralizing antibodies generated by mucosal vaccination could be applied to next generation vaccines against SARS-CoV-2 and other respiratory pathogens. Indeed, the current situation where vaccines rely on high titer specific neutralizing antibodies with limited induction of mucosal responses have room for improvements. Strategies of vaccination against SARS-CoV-2 with improved capacity to limit vaccine breakthrough infections and to reduce transmission are still needed and this study and others support that mucosal vaccination is a promising strategy to meet these goals.

For one skilled in the art, various modifications and changes may be made to the present disclosure. Those skilled in the art should understand that any amendments, equivalent replacements, improvements, and so on, made within the spirit and principle of the present disclosure, should be covered within the scope of protection of the present disclosure. Bibliography

1 Lipsitch, M., Krammer, F., Regev-Yochay, G., Lustig, Y. & Balicer, R. D. SARS-CoV-2 breakthrough infections in vaccinated individuals: measurement, causes and impact. Nat Rev Immunol 22, 57-65, doi:10.1038/s41577-021-00662-4 (2022).

2 Mistry, P. et al. SARS-CoV-2 Variants, Vaccines, and Host Immunity. Front Immunol 12, 809244, doi:10.3389/fimmu.2021.809244 (2021).

3 Polack, F. P. et al. Safety and Efficacy of the BNT162b2 mRNA Covid-19 Vaccine. N Engl J Med 383, 2603-2615, doi:10.1056/NEJMoa2034577 (2020).

4 Cao, Y. et al. Omicron escapes the majority of existing SARS-CoV-2 neutralizing antibodies. Nature 602, 657-663, doi:10.1038/s41586-021 -04385-3 (2022).

5 Le Bert, N. et al. Highly functional virus-specific cellular immune response in asymptomatic SARS-CoV-2 infection. J Exp Med 218, doi:10.1084/jem.20202617 (2021).

6 Jing, L. eta/. T cell response to intact SARS-CoV-2 includes coronavirus cross-reactive and variant-specific components. JCI Insight 7, doi: 10.1172/jci.insight.158126 (2022).

7 Moss, P. The T cell immune response against SARS-CoV-2. Nat Immunol 23, 186- 193, doi: 10.1038/s41590-021-01122-w (2022) .

8 Ishii, H. et al. Neutralizing-antibody-independent SARS-CoV-2 control correlated with intranasal-vaccine-induced CD8(+) T cell responses. Cell Rep Med 3, 100520, doi: 10.1016/j.xcrm.2O22.100520 (2022).

9 Tan, A. T. et al. Early induction of functional SARS-CoV-2-specific T cells associates with rapid viral clearance and mild disease in COVID-19 patients. Cell Rep 34, 108728, doi:10.1016/j.celrep.2021.108728 (2021).

10 Wang, N., Shang, J., Jiang, S. & Du, L. Subunit Vaccines Against Emerging Pathogenic Human Coronaviruses. Front Microbiol 11 , 298, doi:10.3389/fmicb.2020.00298 (2020).

11 Fan, J. et al. Advances in Infectious Disease Vaccine Adjuvants. Vaccines (Basel) 10, doi: 10.3390/vaccinesl 0071120 (2022).

12 Garcon, N. et al. Development of an AS04-adjuvanted HPV vaccine with the adjuvant system approach. BioDrugs 25, 217-226, doi: 10.2165/11591760-000000000-00000 (2011). 13 Shi, S. et al. Vaccine adjuvants: Understanding the structure and mechanism of adjuvanticity. Vaccine 37, 3167-3178, doi: 10.1016/j. vaccine.2019.04.055 (2019).

14 Lavelle, E. C. & Ward, R. W. Mucosal vaccines - fortifying the frontiers. Nat Rev Immunol 22, 236-250, doi :10.1038/s41577-021-00583-2 (2022).

15 McLachlan, J. B. et al. Mast cell activators: a new class of highly effective vaccine adjuvants. Nat Med 14, 536-541 , doi:10.1038/nm1757 (2008).

16 St John, A. L. etal. Novel mucosal adjuvant, mastoparan-7, improves cocaine vaccine efficacy. NPJ Vaccines 5, 12, doi: 10.1038/s41541 -020-0161-1 (2020).

17 McNeil, B. D. et al. Identification of a mast-cell-specific receptor crucial for pseudo- allergic drug reactions. Nature 519, 237-241 , doi :10.1038/nature14022 (2015).

18 Kruger PG, Mahata SK, Helle KB. Catestatin (CgA344-364) stimulates rat mast cell release of histamine in a manner comparable to mastoparan and other cationic charged neuropeptides. Regul PeptA 14(1):29-35. doi: 10.1016/s0167-0115(03)00069-7(2003).

19 Hassan, A. O. etal. A Single-Dose Intranasal ChAd Vaccine Protects Upper and Lower

Respiratory Tracts against SARS-CoV-2. Cell 183, 169-184 e113, doi:10.1016/j. cell.2020.08.026 (2020).

20 Wu, S. et al. A single dose of an adenovirus-vectored vaccine provides protection against SARS-CoV-2 challenge. Nat Commun 11 , 4081, doi :10.1038/s41467-020- 17972-1 (2020).

21 Alu, A. et al. Intranasal COVID-19 vaccines: From bench to bed. EBioMedicine 7Q, 103841 , doi:10.1016/j.ebiom.2022.103841 (2022).

22 Afkhami, S. et al. Respiratory mucosal delivery of next-generation COVID-19 vaccine provides robust protection against both ancestral and variant strains of SARS-CoV-2. Cell 185, 896-915 e819, doi:10.1016/j.cell.2022.02.005 (2022).

23 Kingstad-Bakke, B. et al. Vaccine-induced systemic and mucosal T cell immunity to SARS-CoV-2 viral variants. Proc Natl Acad Sci U S A 119, e2118312119, doi:10.1073/pnas.2118312119 (2022).

24 Mao, T. et al. Unadjuvanted intranasal spike vaccine booster elicits robust protective mucosal immunity against sarbecoviruses. bioRxiv, doi:10.1101/2022.01.24.477597 (2022).

25 Mateus, J. et al. Selective and cross- reactive SARS-CoV-2 T cell epitopes in unexposed humans. Science 370, 89-94, doi:10.1126/science.abd3871 (2020). 26 Brandtzaeg, P. Potential of nasopharynx-associated lymphoid tissue for vaccine responses in the airways. Am J Respir Crit Care Med 183, 1595-1604, doi:10.1164/rccm.201011-1783OC (2011).

27 Dong, C. Cytokine Regulation and Function in T Cells. Annu Rev Immunol 39, 51-76, doi: 10.1146/annurev-immunol-061020-053702 (2021).

28 Wang, X. et al. A critical role of IL- 17 in modulating the B-cell response during H5N1 influenza virus infection. Cell Mol Immunol 8, 462-468, doi:10.1038/cmi.2011.38 (2011).

29 Imai, M. et al. Syrian hamsters as a small animal model for SARS-CoV-2 infection and countermeasure development. Proc Natl Acad Sci U S A 117, 16587-16595, doi: 10.1073/pnas.2009799117 (2020).

30 Sia, S. F. et al. Pathogenesis and transmission of SARS-CoV-2 in golden hamsters. Nature 583, 834-838, doi: 10.1038/s41586-020-2342-5 (2020).

31 Sallusto, F., Lenig, D., Forster, R., Lipp, M. & Lanzavecchia, A. Two subsets of memory T lymphocytes with distinct homing potentials and effector functions. Nature 401 , 708-712, doi: 10.1038/44385 (1999).

32 Tan, C. W. et al. A SARS-CoV-2 surrogate virus neutralization test based on antibody- mediated blockage of ACE2-spike protein-protein interaction. Nat Biotechnol 38, 1073-1078, doi: 10.1038/S41587-020-0631 -z (2020).

33 Jaffar, Z., Ferrini, M. E., Herritt, L. A. & Roberts, K. Cutting edge: lung mucosal Th17- mediated responses induce polymeric Ig receptor expression by the airway epithelium and elevate secretory IgA levels. J Immunol 182, 4507-4511 , doi: 10.4049/jimmunol.0900237 (2009).

34 Ssemaganda, A. et al. Expansion of cytotoxic tissue-resident CD8(+) T cells and CCR6(+)CD161(+) CD4(+) T cells in the nasal mucosa following mRNA COVID-19 vaccination. Nat Commun 13, 3357, doi :10.1038/s41467-022-30913-4 (2022).

35 Lim, J. M. E. et al. SARS-CoV-2 breakthrough infection in vaccinees induces virusspecific nasal-resident CD8+ and CD4+ T cells of broad specificity. J Exp Med 219, doi: 10.1084/jem.20220780 (2022).

36 Tang, J. et al. Respiratory mucosal immunity against SARS-CoV-2 following mRNA vaccination. Sci Immunol, eadd4853, doi:10.1126/sciimmunol.add4853 (2022). 37 Sallusto, F., Langenkamp, A., Geginat, J. & Lanzavecchia, A. Functional subsets of memory T cells identified by CCR7 expression. Curr Top Microbiol Immunol 251 , 167-171 , doi : 10.1007/978- 3-642-57276-0_21 (2000) .

38 Abdelsamed, H. A. etal. Human memory CD8 T cell effector potential is epigenetically preserved during in vivo homeostasis. J Exp Med 214, 1593-1606, doi:10.1084/jem.20161760 (2017).

39 Moskowitz, D. M. et al. Epigenomics of human CD8 T cell differentiation and aging. Sci Immunol 2, doi: 10.1126/sciimmunol.aag0192 (2017).

40 Kumar, B. V., Connors, T. J. & Farber, D. L. Human T Cell Development, Localization, and Function throughout Life. Immunity 48, 202-213, doi:10.1016/j.immuni.2018.01.007 (2018).

41 Ahmed, R., Bevan, M. J., Reiner, S. L. & Fearon, D. T. The precursors of memory: models and controversies. Nat Rev Immunol 9, 662-668, doi:10.1038/nri2619 (2009).

42 Cyster, J. G. & Allen, C. D. C. B Cell Responses: Cell Interaction Dynamics and Decisions. Cell 177, 524-540, doi:10.1016/j.cell.2019.03.016 (2019).

43 Song, W. & Craft, J. T follicular helper cell heterogeneity: Time, space, and function. Immunol Rev 288, 85-96, doi:10.1111/imr.1274O (2019).

44 Morita, R. et al. Human blood CXCR5(+)CD4(+) T cells are counterparts of T follicular cells and contain specific subsets that differentially support antibody secretion. Immunity 34, 108-121 , doi:10.1016/j.immuni.2010.12.012 (2011).

45 MacLeod, M. K. et al. Memory CD4 T cells that express CXCR5 provide accelerated help to B cells. J Immunol 186, 2889-2896, doi: 10.4049/jimmunol.1002955 (2011).

46 Locci, M. etal. Human circulating PD-1+CXCR3-CXCR5+ memory Tfh cells are highly functional and correlate with broadly neutralizing HIV antibody responses. Immunity 39, 758- 769, doi:10.1016/j.immuni.2013.08.031 (2013).

47 Robinson, A. M. etal. Evolution of antigen-specific follicular helper T cell transcriptional programs across effector function and through to memory. bioRxiv, 2021.2009.2017.460841, doi:10.1101/2021.09.17.460841 (2021).

48 Lentschat, A. et al. Mastoparan, a G protein agonist peptide, differentially modulates TLR4- and TLR2-mediated signaling in human endothelial cells and murine macrophages. J Immunol 174, 4252-4261, doi: 10.4049/jimmunol.174.7.4252 (2005). 49 St John, A. L., Rathore, A. P. S. & Ginhoux, F. New perspectives on the origins and heterogeneity of mast cells. Nat Rev Immunol 23, 55-68, doi:10.1038/s41577-022-00731 -2 (2022).

50 Babicki, S. et al. Heatmapper: web-enabled heat mapping for all. Nucleic Acids Res 44, W147-153, doi:10.1093/nar/gkw419 (2016).

51 Tan, C. W. et al. Pan-Sarbecovirus Neutralizing Antibodies in BNT162b2-lmmunized SARS-CoV-1 Survivors. N Engl J Med 385, 1401-1406, doi:10.1056/NEJMoa2108453 (2021).

52 Stadlbauer, D. et al. SARS-CoV-2 Seroconversion in Humans: A Detailed Protocol for a Serological Assay, Antigen Production, and Test Setup. Curr Protoc Microbiol 57, e100, doi:10.1002/cpmc.100 (2020).

53 Nakajima T, Yasuhara T, llzu S, Wakamatsu K, Miyazawa T, Fukuda K, Tsukamoto Y. Wasp venom peptides; wasp kinins, new cytotrophic peptide families and their physicochemical properties. Peptides 6 Suppl 3:425-30. doi: 10.1016/0196-9781 (85)90409-7 (1985).

54 Argiolas A, Pisano J J. Isolation and characterization of two new peptides, mastoparan C and crabrolin, from the venom of the European hornet, Vespa crabro. J Biol Chem 259(16):10106-11 (1984).

55 de Souza BM, Marques MR, Tomazela DM, Eberlin MN, Mendes MA, Palma MS. Mass spectrometric characterization of two novel inflammatory peptides from the venom of the social wasp Polybia paulista. Rapid Commun Mass Spectrom 18(10):1095-102. doi: 10.1002/rcm.1452 (2004).

56 Konno K, Hisada M, Naoki H, et al. Structure and biological activities of eumenine mastoparan-AF (EMP-AF), a new mast cell degranulating peptide in the venom of the solitary wasp (Anterhynchium flavomarginatum micado). Toxicon : Official Journal of the International Society on Toxinology.38(11): 1505-1515. DOI: 10.1016/s0041-0101(00)00083-0 (2000).

57 Ziai MR, Russek S, Wang HC, Beer B, Blume AJ. Mast cell degranulating peptide: a multi-functional neurotoxin. J Pharm Pharmacol. 42(7):457-61. doi: 10.1111/j.2O42- 7158.1990.tb06595.x (1990).

58 Bavec A. Novel features of amphiphilic peptide Mas7 in signalling via heterotrimeric G-proteins. J Pept Sci. 10(11):691-9. doi: 10.1002/psc.579 (2004).

59 Radek KA, Lopez-Garcia B, Hupe M, Niesman IR, Elias PM, Taupenot L, Mahata SK, O'Connor DT, Gallo RL. The neuroendocrine peptide catestatin is a cutaneous antimicrobial and induced in the skin after injury. J Invest Dermatol. 128(6): 1525-34. doi: 10.1038/sj.jid.57012259(2008).

60 Aridor M, Rajmilevich G, Beaven MA, Sagi-Eisenberg R. Activation of exocytosis by the heterotrimeric G protein Gi3. Science. 262(5139):1569-72. doi: 10.1126/science.7504324(1993).

61 Mayr SI, Zuberi Rl, Zhang M, de Sousa-Hitzler J, Ngo K, Kuwabara Y, Yu L, Fung- Leung WP, Liu FT. IgE-dependent mast cell activation potentiates airway responses in murine asthma models. J Immunol. 169(4):2061-8. doi: 10.4049/jimmunol.169.4.2061 (2002).