Background to the invention Hepatitis C virus (HCV) is a major causative agent of chronic hepatitis and liver disease. It is estimated that, worldwide, approximately 300 million individuals are infected with the virus, 20% of whom are likely to develop mild to severe liver disease or carcinoma. Apart from the risk of succumbing to the long term effects of infection, these individuals also represent a large reservoir of virus for future transmissions. To date, the only widely used therapy for HCV is treatment with interferon. However, sustained response is achieved in only about 20% of cases. Moreover, no vaccine currently exists to protect against infection. Since growth of the virus has not been possible to date in tissue culture systems, very little is known also about the molecular events which occur during viral replication.

The core protein of HCV is predicted to constitute the capsid of virus particles. From various studies, expression of this protein results in a range of effects on intracellular processes, including a decrease in transcription of genes from HBV and HIV and alterations to apoptosis. There is also evidence from a study on transgenic mice that liver- specific expression of core may be linked to the development of steatosis (fatty liver), a condition commonly found in HCV-infected individuals which is characterised by the accumulation of fat deposits within hepatocytes. Thus, core protein may also influence lipid metabolism within the liver. Other results from studies on human sera suggest that HCV virus particles are found associated with lipoprotein particles which are produced by the liver. It has also been shown that HCV core protein associates with lipid droplets within cells (Barba, G. et a/., 1997; Moradpour, D. et a/., 1996). The droplets are storage compartments for both triacylglycerols and cholesterol esters which can be used as

substrates for oxidation in mitochondria and for the formation of membranes. In specialised cells, stored cholesterol is used for steroid hormone synthesis.

Within the liver, lipid droplets also function as a site for storage of precursors of the lipid which is secreted from this organ in the form of lipoprotein particles. Although lipid droplets were identified several decades ago and they can be readily detected by staining methods, very little is known about the processes of assembly, storage and disassembly within the cell. One protein, termed adipocyte-related differentiation protein (ADRP), has been found to associate with lipid droplets in a range of cell types and in certain organs.

To date, it is the only protein which is apparently not cell-type specific that has this intracellular distribution. It is proposed that ADRP may be required for maintenance of lipid droplets within cells, however the precise function of the protein has not been identified.

Summarv of the Invention Particular sequences within the hepatitis C virus core protein that direct association of HCV core protein with intracellular lipid globules have now been characterised. These sequences can thus be used to target other proteins to lipid globules, including lipid globules secreted by milk-producing cells. We have also shown that expression of core protein and its resultant association with lipid droplets results in loss of ADRP from the droplets. Furthermore, progressive increases in core expression result in diminishing amounts of ADRP to undetectable levels. Since it has been shown previously that ADRP is also secreted as a component of fat globules in milk from humans, cows and rats, proteins comprising HCV core protein sequences may also be secreted into animal milk.

Thus fusion proteins comprising HCV core protein elements fused to proteins of interest may be targeted specifically to lipid globules secreted into the milk produced by a variety of animals and the proteins extracted from the milk. This will facilitate the expression and secretion into milk of proteins of interest and provide an effective method of producing recombinant proteins in transgenic animals.

Accordingly, the present invention provides a protein comprising a lipid globule targeting sequence linked to a protein of interest (POI) wherein the targeting sequence comprises a

hepatitis C virus (HCV) core protein or fragment or homologue thereof. Preferably, the lipid globule targeting sequence comprises amino acids from 125 to 144 and/or 161 to 166 of the HCV core protein as set out in SEQ ID. Nos. 2 and 3, or the equivalent amino acids in other HCV strains/isolates. More preferably, the lipid globule targeting sequence also comprises a hydrophilic amino acid sequence of at least 8 amino acids. The present invention also provides an isolated polypeptide consisting essentially of a lipid globule targeting sequence wherein the targeting sequence comprises from amino acids 125 to 144 and 161 to 166 of an HCV core protein linked to a hydrophilic amino acid sequence of at least 8 amino acids.

The protein of interest is preferably a protein expressed by a pathogen, preferably a viral or bacterial protein or fragment thereof, more preferably comprising at least one epitope.

In another aspect, the present invention provides a polynucleotide encoding a protein of the invention. The present invention also provides a polynucleotide encoding a protein of the invention operably linked to a control sequence permitting expression of the protein in a suitable host cell. Preferred host cells include adipocytes and milk-secreting cells.

The invention further provides a nucleic acid vector comprising a polynucleotide of the invention. The invention also provides a host cell comprising a polynucleotide of the invention or a nucleic acid vector of the invention.

In another aspect, the present invention provides a method for producing a protein of the invention which method comprises culturing a host cell of the invention under conditions which allow expression of the protein, and recovering the protein.

The proteins of the invention may advantageously be extracted from cells associated with the lipid globules to which the proteins have been directed by the lipid globule targeting sequence. In particular, proteins produced in milk-secreting cells in milk-producing animals may conveniently be extracted from the animal's milk. These protein/lipid complexes may be used without further purification. Indeed, lipids have been used as adjuvants in the preparation of vaccine compositions. Consequently, protein/lipid globule

compositions of the invention may be used in the preparation of vaccines, in particular- where the protein of interest is immunogenic.

Thus, the invention also provides a composition comprising a protein of the invention and a lipid globule. Preferably the lipid globule is a consituent of mammalian milk.

The compositions, proteins, polynucleotides and vectors of the present invention may be used in the prevention or treatment of pathogenic infections. Thus, in a further aspect, the present invention provides a vaccine composition comprising a composition, protein, polynucleotide or vector of the invention together with a pharmaceutically acceptable carrier or diluent. It may be preferred to use the proteins of the invention in combination with the active constituents of other vaccine compositions to increase their effectiveness.

The present invention also provides a method of treating or preventing a pathogenic infection in a human or animal which comprises administering to the human or animal an amount of a composition, protein, polynucleotide or vector of the invention sufficient to achieve a beneficial immunological effect.

Detailed Description of the Invention Although in general the techniques mentioned herein are well known in the art, reference may be made in particular to Sambrook et al., Molecular Cloning, A Laboratory Manual (1989) and Ausubel et al., Current Protocols in Molecular Biology (1995), John Wiley & Sons, Inc.

A. Proteins/Polypeptides The term"protein"includes single-chain polypeptide molecules as well as multiple- polypeptide complexes where individual consituent polypeptides are linked by covalent or non-covalent means. The term"polypeptide"includes peptides of two or more amino acids in length, typically having more than 5,10 or 20 amino acids. Proteins of the invention generally comprise at least two components-a lipid globule targeting sequence

which is capable of targeting molecules to lipid globules and a molecule of interest,- typically a protein.

1. Lipid globule targeting sequences The term"lipid globule targeting sequence"means an amino acid sequence which is capable of association with a lipid globule, preferably a biologically occuring lipid globule such as an intracellular lipid globule as found in adipocytes or a secreted lipid globule as found in mammalian milk. In addition, the lipid globule targeting sequence is preferably capable of association with a lipid globule when linked to a protein of interest such that the protein of interest is also associated with the lipid globule by virtue of being linked to the targeting sequence. Lipid globule association may take place within a non-cellular and/or extra- cellular environment, such as in an apparatus-for example a tube or vat. Alternatively, it may take place in a cellular environment where the expressed targeting sequence is directed to intracellular lipid droplets or the membranes of such droplets. It is especially preferred that the targeting sequence is directed to lipid droplets which are subsequently secreted into the extracellular environment, for example during the production by female animals of milk.

The ability of an amino acid sequence to associate with/target lipid globules can be assessed either in vitro or in vivo. For example, a candidate targeting sequence may be added to a dispersion of lipid globules (such as a mixture of phospholipid and triacylglycerol) in an aqueous solvent, the mixture sonicated and the degree of partition between aqueous and lipid phases determined by fractionation. Typically fractionation of the mixture would involve increasing the density of the solution with sorbitol or sodium bromide and ultracentrifuging the solution. The lipid complexes migrate to the top of the centrifuge tube and this upper lipid layer is then examined for candidate targeting sequence. Preferably, a suitable lipid globule targeting sequence should partition at least 50: 50 lipid: aqueous phase, more preferably at least 75: 25,80: 20 or 90: 10.

Another suitable test may involve introducing a polynucleotide encoding a candidate sequence, optionally linked to a protein of interest, into a milk-producing cell in culture and determining whether, the targeting sequence/protein of interest has been secreted into the

culture medium. The immunocytochemical technique illustrated in the Examples may also- be used.

Suitable lipid globule targeting sequences may be obtained from an HCV core protein.

The amino acid sequence of the HCV core protein has been obtained for a large number of different HCV isolates. These sequences are readily available to the skilled person. One such sequence, for HCV strain Glasgow, is set out in SEQ ID No. 1. The means for cloning and identifying new HCV strains, and thus obtaining further core sequences, are described in EP-B-318,216 According to the present invention, it is preferred to use fragments of the HCV core protein which are capable of targeting molecules, to which they are linked, to lipid globules. Amino acid numbering for preferred fragments set out below is with reference to SEQ ID. No. 1.

However it will be understood that equivalent fragments of the core protein of other HCV strains/isolates may also be used. An HCV core protein-derivable lipid globule targeting sequence of the invention is preferably a minimal amino acid sequence which can target a molecule, typically a protein, to lipid globules. The minimal sequence will typically comprise a hydrophobic amino acid sequence derived from amino acids 120 to 169 of an HCV core sequence, preferably linked to a hydrophilic amino acid sequence of at least 8, preferably 10, more preferably at least 12 amino acids. It is not necessary for the hydrophilic sequence to be contiguous with the hydrophobic sequence. For example, a protein of interest may be placed between the two sequences such that the hydrophilic sequence is at the N-terminus and the hydrophobic sequence is at the C-terminus.

The hydrophobic amino acid sequence typically comprises at least 10, preferably at least 15 or 20 contiguous amino acids and has a hydropathy index of at least +40 kJ/mol (determined, for example, theoretically as described by Engelman et a/., 1986). The hydrophilic amino acid sequence typically has a hydropathy plot of less than-20 kJ/mol, preferably less than-40 kJ/mol.

Preferred HCV core fragments contain amino acids 161 to 166 (SEQ ID. No. 3). It is also preferred to use fragments of the HCV core protein that contain amino acids 125 to 144 (SEQ

ID. No. 2). In a preferred embodiment, HCV core protein fragments of the invention contain- both amino acids 125 to 144 and amino acids 161 to 166. In a more general sense, a preferred HCV core fragment comprises substantially all of domain 2 of the HCV core polypeptide (approximately amino acids 123 to 174) although variants which lack residues 155 to 161 and/or are truncated at residue 166,167,168 or 169 are also within the scope of the present invention. Equivalent domain 2 regions and variants thereof (for example comprising deletions based on equivalent amino acid numbering) in other flaviviruses or pestiviruses are also within the scope of the invention.

In an especially preferred embodiment, the lipid targeting sequence of the invention comprises a hydrophilic amino acid sequence containing amino acids 1 to 8 of the HCV core sequence, more preferably amino acids 1 to 48 or a variant thereof. Other preferred fragments contain amino acids 1 to 173 or 1 to 169.

Since it has also now been shown that amino acids 9 to 43,49 to 75,80 to 118 and 155 to 161 are not required for lipid association, preferred HCV core protein fragments of the invention lack one or more of these sequences. In particular, it is preferred that HCV core protein fragments of the invention lack amino acids 9 to 43. Suitable fragments will be at least about 5, e. g. 10,12,15 or 20 amino acids in size and preferably have less than 100,90,80,70,60 or 50 amino acids. In a preferred aspect, fragments contain an HCV epitope.

Lipid globule targeting sequences of the invention, for example HCV core protein sequences and fragments thereof, may, however, be part of a larger polypeptide, for example a fusion protein. In this case, the additional polypeptide sequences are preferably polypeptide sequences with which the lipid globule targeting sequence of the invention is not normally associated.

It will be understood that lipid globule targeting sequences of the invention are not limited to sequences obtained from HCV core protein but also include homologous sequences obtained from any source, for example related viral proteins, cellular homologues and synthetic peptides, as well as variants or derivatives thereof. Thus, the present invention covers variants, homologues or derivatives of the targeting sequences of the present

invention, as well as variants, homologues or derivatives of the nucleotide sequence coding- for the targeting sequences of the present invention.

In the context of the present invention, a homologous sequence is taken to include an amino acid sequence which is at least 60,70,80 or 90% identical, preferably at least 95 or 98% identical at the amino acid level over at least 5, preferably 8,10,15,20,30 or 40 amino acids with an HCV core protein lipid targeting sequence, for example as shown in the sequence listing herein. In particular, homology should typically be considered with respect to those regions of the targeting sequence known to be essential for lipid globule association rather than non-essential neighbouring sequences.

Although homology can also be considered in terms of similarity (i. e. amino acid residues having similar chemical properties/functions), in the context of the present invention it is preferred to express homology in terms of sequence identity.

Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.

% homology may be calculated over contiguous sequences, i. e. one sequence is aligned with the other sequence and each amino acid in one sequence directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped"alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues (for example less than 50 contiguous amino acids).

Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting"gaps"in the sequence alignment to try to maximise local homology.

However, these more complex methods assign"gap penalties"to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible-reflecting higher relatedness between the two compared sequences- will achieve a higher score than one with many gaps."Affine gap costs"are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package (see below) the default gap penalty for amino acid sequences is-12 for a gap and-4 for each extension.

Calculation of maximum % homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U. S. A.; Devereux et al., 1984, Nucleic Acids Research 12: 387). Examples of other software than can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et al., 1999 ibid-Chapter 18), FASTA (Atschul et al., 1990, J. Mol.

Biol., 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999 ibid, pages 7-58 to 7-60). However it is preferred to use the GCG Bestfit program.

Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix-the default matrix for the BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). It is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62.

Once the software has produced an optimal alignment, it is possible to calculate %- homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.

Homologous sequences may be obtained using standard cloning techniques or by database searches, for example using the Blast suite of programs and any one of the SEQ ID. Nos.

Listing herein as the query.

Lipid globule targeting sequences of the invention, for example HCV core protein sequences, variants, homologues and fragments thereof, may be modified for use in the present invention. Typically, modifications are made that maintain the hydrophobicity/hydrophilicity of the sequence Amino acid substitutions may be made, for example from 1,2 or 3 to 10,20 or 30 substitutions provided that the modified sequence retains the ability to target molecules to lipid globules. Amino acid substitutions may include the use of non-naturally occurring analogues, for example to increase blood plasma half-life of a therapeutically administered polypeptide.

Conservative substitutions may be made, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other. ALIPHATIC Non-polar GAP ILV Polar-uncharged C S T M NQ Polar-charged D E KR AROMATIC H F W Y The terms"variant","homologue"or"derivative"in relation to the targeting sequence of the present invention include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acids from or to the sequence providing the

resultant amino acid sequence has a lipid globule targeting activity, preferably having at least- the same activity of the targeting sequence presented in the sequence listings.

The terms"variant","homologue"or"derivative"in relation to the targeting sequence of the present invention include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acids from or to the sequence providing the resultant amino acid sequence has a lipid globule targeting activity, preferably having at least the same activity of the targeting sequence presented in the sequence listings.

2. Proteins of Interest Proteins of interest may include, for example, proteins involved in the regulation of cell division, for example growth factors including neurotrophic growth factors, cytokines (such as a-, p-or y-interferon, interleukins including IL-1, IL-2, tumour necrosis factor, or insulin-like growth factors I or II), protein kinases (such as MAP kinase), protein phosphatases and cellular receptors for any of the above. The protein may also be an enzyme involved in cellular metabolic pathways, for example enzymes involved in amino acid biosynthesis or degradation (such as tyrosine hydroxylase), purine or pyrimidine biosynthesis or degradation, and the biosynthesis or degradation of neurotransmitters, such as dopamine, or a protein involved in the regulation of such pathways, for example protein kinases and phosphatases. The protein may also be a transcription factors or proteins involved in their regulation, for example pocket proteins of the Rb family such as Rb or p 107, membrane proteins, structural proteins or heat shock proteins such as hsp70. Proteins of interest are preferably lipid soluble or contain regions which allow a portion of the protein to be buried in a lipid globule. Preferably the POI will not hinder the lipid targeting effect of the lipid globule targeting sequence.

Preferably, the protein of interest is of therapeutic use, or the function of which may be implicated in a disease process. Proteins of interest may also contain antigenic polypeptides for use as vaccines. Preferably such antigenic polypeptides are derived from pathogenic organisms, for example bacteria or viruses, or from tumours. In particular antigenic polypeptides containing HCV epitopes may be used. Extensive epitope mapping of the HCV genome has already been carried out and the majority of HCV epitopes

characterised. Epitopes may be linear or conformational. In the case of HCV core protein- epitopes, the HCV core protein targeting sequence of the invention may already contain suitable HCV epitopes and this being the case, it may not be necessary to include further antigenic sequences. Consequently an HCV core protein sequence may be used according to the present invention without being fused to a protein of interest. However, proteins of interest should preferably not be sequences with which the lipid globule targeting sequences are normally associated.

In addition to being linked to the lipid globule targeting sequence, proteins of interest may be linked to further fusion proteins. Polypeptides of the invention may also be produced as fusion proteins, for example to aid in extraction and purification. Examples of fusion protein partners include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA binding and/or transcriptional activation domains) and-galactosidase. It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the HCV core protein sequence and/or between the HCV core protein sequence and the protein of interest to allow removal of fusion protein sequences. Preferably the fusion protein will not hinder the lipid targeting effect of the lipid globule targeting sequence. The targeting sequence may be linked to either the N-terminus or the C-terminus of the fusion protein partners or proteins of interest Proteins of the invention are typically made by recombinant means, for example as described below. However they may also be made by synthetic means using techniques well known to skilled persons such as solid phase synthesis.

Proteins of the invention may be in a substantially isolated form. It will be understood that the protein may be mixed with carriers or diluents which will not interfere with the intended purpose of the protein and still be regarded as substantially isolated. A protein of the invention may also be in a substantially purified form, in which case it will generally comprise the protein in a preparation in which more than 90%, e. g. 95%, 98% or 99% of the protein in the preparation is a protein of the invention.

B. Polynucleotides and vectors.

Polynucleotides of the invention comprise nucleic acid sequences encoding the the lipid globule targeting sequences of the invention and proteins of the invention. It will be understood by a skilled person that numerous different polynucleotides can encode the same polypeptide as a result of the degeneracy of the genetic code. In addition, it is to be understood that skilled persons may, using routine techniques, make nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides of the invention to reflect the codon usage of any particular host organism in which the polypeptides of the invention are to be expressed.

Polynucleotides of the invention may comprise DNA or RNA. They may be single- stranded or double-stranded. They may also be polynucleotides which include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones, addition of acridine or polylysine chains at the 3'and/or 5' ends of the molecule. For the purposes of the present invention, it is to be understood that the polynucleotides described herein may be modified by any method available in the art.

Such modifications may be carried out in order to enhance the in vivo activity or life span of polynucleotides of the invention.

The terms"variant","homologue"or"derivative"in relation to the nucleotide sequence coding for the lipid targeting sequence of the present invention include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acid from or to the sequence providing the resultant nucleotide sequence codes for a protein having lipid targeting activity, preferably having at least the same activity of the targeting sequence presented in the sequence listings.

As indicated above, with respect to sequence homology, preferably there is at least 75%, more preferably at least 85%, more preferably at least 90% homology to the sequences shown in the sequence listing herein. More preferably there is at least 95%, more preferably at least 98%, homology. Nucleotide homology comparisons may be conducted as described above.

The present invention also encompasses nucleotide sequences that are capable of hybridising- selectively to the sequences presented herein, or any variant, fragment or derivative thereof, or to the complement of any of the above. Nucleotide sequences are preferably at least 15 nucleotides in length, more preferably at least 20,30,40 or 50 nucleotides in length.

The term"hybridization"as used herein shall include"the process by which a strand of nucleic acid joins with a complementary strand through base pairing" (Coombs J (1994) Dictionary of Biotechnology, Stockton Press, New York NY) as well as the process of amplification as carried out in polymerase chain reaction technologies as described in Dieffenbach CW and GS Dveksler (1995, PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview NY).

Polynucleotides of the invention capable of selectively hybridising to the nucleotide sequences presented herein, or to their complement, will be generally at least 70%, preferably at least 80 or 90% and more preferably at least 95% or 98% homologous to the corresponding nucleotide sequence presented herein over a region of at least 20, preferably at least 25 or 30, for instance at least 40,60 or 100 or more contiguous nucleotides. Preferred polynucleotides of the invention will comprise regions homologous to nucleotides 715 to 774 and/or nucleotides 826 to 840 of SEQ ID No. 1, preferably at least 80 or 90% and more preferably at least 95% homologous to to nucleotides 715 to 774 and/or nucleotides 826 to 840 of SEQ ID No. 1.

The term"selectively hybridizable"means that the polynucleotide used as a probe is used under conditions where a target polynucleotide of the invention is found to hybridize to the probe at a level significantly above background. The background hybridization may occur because of other polynucleotides present, for example, in the cDNA or genomic DNA library being screened. In this event, background implies a level of signal generated by interaction between the probe and a non-specific DNA member of the library which is less than 10 fold, preferably less than 100 fold as intense as the specific interaction observed with the target DNA. The intensity of interaction may be measured, for example, by radiolabelling the probe, e. g. with 32p.

Hybridization conditions are based on the melting temperature (Tm) of the nucleic acid- binding complex, as taught in Berger and Kimmel (1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol 152, Academic Press, San Diego CA), and confer a defined"stringency"as explained below.

Maximum stringency typically occurs at about Tm-5°C (5°C below the Tm of the probe); high stringency at about 5°C to 10°C below Tm; intermediate stringency at about 10°C to 20°C below Tm; and low stringency at about 20°C to 25°C below Tm. As will be understood by those of skill in the art, a maximum stringency hybridization can be used to identify or detect identical polynucleotide sequences while an intermediate (or low) stringency hybridization can be used to identify or detect similar or related polynucleotide sequences.

In a preferred aspect, the present invention covers nucleotide sequences that can hybridise to the nucleotide sequence of the present invention under stringent conditions (e. g. 65°C and 0. IxSSC {IxSSC = 0.15 M NaCl, 0.015 M Na3 citrate pH 7.0).

Where the polynucleotide of the invention is double-stranded, both strands of the duplex, either individually or in combination, are encompassed by the present invention. Where the polynucleotide is single-stranded, it is to be understood that the complementary sequence of that polynucleotide is also included within the scope of the present invention.

Polynucleotides which are not 100% homologous to the sequences of the present invention but fall within the scope of the invention can be obtained in a number of ways. Other HCV core protein variants of the HCV core protein sequence described herein may be obtained for example by probing DNA libraries made from a range of HCV infected individuals, for example individuals from different populations. In addition, other viral, or cellular homologues particularly cellular homologues found in mammalian cells (e. g. rat, mouse, bovine and primate cells), may be obtained and such homologues and fragments thereof in general will be capable of selectively hybridising to the sequences shown in the sequence listing herein. Such sequences may be obtained by probing cDNA libraries made from or

genomic DNA libraries from other animal species, and probing such libraries with probes comprising all or part of SEQ ID. 1 under conditions of medium to high stringency.

Variants and strain/species homologues may also be obtained using degenerate PCR which will use primers designed to target sequences within the variants and homologues encoding conserved amino acid sequences within the lipid globule targeting sequences of the present invention. Conserved sequences can be predicted, for example, by aligning the HCV core protein amino acid sequences from several HCV isolates. Such HCV sequence comparisons are widely available in the art. The primers will contain one or more degenerate positions and will be used at stringency conditions lower than those used for cloning sequences with single sequence primers against known sequences.

Alternatively, such polynucleotides may be obtained by site directed mutagenesis of characterised lipid globule targeting sequences, such as SEQ ID. No 1. This may be useful where for example silent codon changes are required to sequences to optimise codon preferences for a particular host cell in which the polynucleotide sequences are being expressed. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites, or to alter the property or function of the polypeptides encoded by the polynucleotides.

Polynucleotides of the invention may be used to produce a primer, e. g. a PCR primer, a primer for an alternative amplification reaction, a probe e. g. labelled with a revealing label by conventional means using radioactive or non-radioactive labels, or the polynucleotides may be cloned into vectors. Such primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 25,30 or 40 nucleotides in length, and are also encompassed by the term polynucleotides of the invention as used herein.

Polynucleotides such as a DNA polynucleotides and probes according to the invention may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques.

In general, primers will be produced by synthetic means, involving a step wise manufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art.

Longer polynucleotides will generally be produced using recombinant means, for example using a PCR (polymerase chain reaction) cloning techniques. This will involve making a pair of primers (e. g. of about 15 to 30 nucleotides) flanking a region of the lipid targeting sequence/POI which it is desired to clone, bringing the primers into contact with mRNA or cDNA obtained from an animal or human cell, performing a polymerase chain reaction under conditions which bring about amplification of the desired region, isolating the amplified fragment (e. g. by purifying the reaction mixture on an agarose gel) and recovering the amplified DNA. The primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector Polynucleotides of the invention can be incorporated into a recombinant replicable vector.

The vector may be used to replicate the nucleic acid in a compatible host cell. Thus in a further embodiment, the invention provides a method of making polynucleotides of the invention by introducing a polynucleotide of the invention into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector. The vector may be recovered from the host cell. Suitable host cells include bacteria such as E. coli, yeast, mammalian cell lines and other eukaryotic cell lines, for example insect Sf9 cells.

Preferably, a polynucleotide of the invention in a vector is operably linked to a control sequence that is capable of providing for the expression of the coding sequence by the host cell, i. e. the vector is an expression vector. The term"operably linked"means that the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence"operably linked"to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.

Such vectors may be transformed or transfected into a suitable host cell as described below to provide for expression of a protein of the invention. This process may comprise

culturing a host cell transformed with an expression vector as described above under conditions to provide for expression by the vector of a coding sequence encoding the protein, and optionally recovering the expressed protein.

The vectors may be for example, plasmid or virus vectors provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter. The vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian vector. Vectors may be used, for example, to transfect or transform a host cell either in vitro or in vivo.

Control sequences operably linked to sequences encoding the protein of the invention include promoters/enhancers and other expression regulation signals. These control sequences may be selected to be compatible with the host cell for which the expression vector is designed to be used in. The term promoter is well-known in the art and encompasses nucleic acid regions ranging in size and complexity from minimal promoters to promoters including upstream elements and enhancers.

The promoter is typically selected from promoters which are functional in mammalian, cells, although prokaryotic promoters and promoters functional in other eukaryotic cells may be used. The promoter is typically derived from promoter sequences of viral or eukaryotic genes. For example, it may be a promoter derived from the genome of a cell in which expression of the protein is to occur. With respect to eukaryotic promoters, they may be promoters that function in a ubiquitous manner (such as promoters of a-actin, 0-action, tubulin) or, alternatively, a tissue-specific manner (such as promoters of the genes for pyruvate kinase). Tissue-specific promoters specific for adipocyte cells (such as the perilipin promoter), in particular milk-producing cells, are particularly preferred, for example promoters for a-lactalbumin, p-lactoglobulin, whey acidic protein or butyrophilin genes. They may also be promoters that respond to specific stimuli, for example promoters that bind steroid hormone receptors. Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR) promoter, the rous sarcoma virus (RSV) LTR promoter or the human cytomegalovirus (CMV) IE promoter.

It may also be advantageous for the promoters to be inducible so that the levels of- expression of the POI can be regulated during the life-time of the cell. Inducible means that the levels of expression obtained using the promoter can be regulated.

In addition, any of these promoters may be modified by the addition of further regulatory sequences, for example enhancer sequences. Chimeric promoters may also be used comprising sequence elements from two or more different promoters described above.

C. Host cells Vectors and polynucleotides of the invention may be introduced into host cells for the purpose of replicating the vectors/polynucleotides and/or expressing the proteins of the invention encoded by the polynucleotides of the invention. Although the proteins of the invention may be produced using prokaryotic cells as host cells, it is preferred to use eukaryotic cells, for example plant, yeast, insect or mammalian cells, in particular mammalian cells. Particularly preferred cells are those with substantial amounts of intracellular lipid droplets/globules, for example adipocytes. In a preferred embodiment, host cells which secrete lipid globules, for example milk-producing cells, are used.

Mammalian cell lines may be transfected in vitro or alternatively, intact multicellular organisms may be used, for example ungulates such as cows, goats, pigs and sheep.

Preferably animals with high milk yields are used.

Vectors/polynucleotides of the invention may be introduced into suitable host cells using a variety of techniques known in the art, such as transfection, transformation and electroporation. Where vectors/polynucleotides of the invention are to be administered to animals, several techniques are known in the art, for example infection with recombinant viral vectors such as herpes simplex viruses and adenoviruses, direct injection of nucleic acids and biolistic transformation. Alternatively, transgenic animals may be produced using suitable techniques.

For example, one method used to produce a transgenic animal involves microinjecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients. Analysis of

animals which may contain transgenic sequences would be performed by either PCR or- Southern blot analysis following standard methods.

Transgenic animals may also be produced by nuclear transfer technology as described in Schnieke, A. E. et al. (1997) and Cibelli, J. B. et al. (1998). Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for core or any proteins of interest fused to lipid globule targeting sequences under the control of regulatory elements required for optimal expression in mammary cells.

Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.

When constructing suitable nucleic acids of the invention for introduction into mammalian eggs during production of transgenic animals, regulatory sequences typically used are promoter elements that are required for tissue-specific expression, examples of which are listed in Section B. Additionally, regulatory sequences may include introns, enhancer elements and sequences flanking the portion of the coding region which are known to influence expression in transgenic animals and may be required for optimal expression in milk. These regulatory elements may be of natural or synthetic origin and placed upstream of, within and downstream of the coding sequences. The nucleic acid vector used for production of transgenic animals may incorporate also the entire ß-lactoglubulin gene.

Such methodology is known to increase expression levels in transgenic animals (see for example Sola, I. et al., 1998).

D. Protein Expression and Purification Host cells comprising polynucleotides of the invention may be used to express proteins of the invention. Host cells may be cultured under suitable conditions which allow expression of the proteins of the invention. Expression of the proteins of the invention may be constitutive such that they are continually produced, or inducible, requiring a stimulus to initiate expression. In the case of inducible expression, protein production can be initiated when required by, for example, addition of an inducer substance to the culture medium, for example dexamethasone or IPTG.

Proteins of the invention can be extracted from host cells by a variety of techniques known in the art, including enzymatic, chemical and/or osmotic lysis and physical disruption.

Although a large number of different purification protocols may be used, given the ability of the HCV core proteins of the invention to target proteins of interest to lipid globules, a preferred extraction/purification protocol involves centrifuging cell homogenates at high speed (for example 100,000 g for 60 mins at 2 to 4°C) and removing the resulting layer of floating lipids. This will function as a primary purification step. Further purification can then be performed if necessary using, for example, column chromatography such as ion- exchange or affinity chromatography. Cells which secrete lipid globules may also conveniently be used and the lipid globules harvested from the culture supernatant.

Proteins associated with the membrane surrounding fat globules can be fractionated into soluble and insoluble fractions by extraction with 1% (w/v) Triton X-100/1.5 M NaCl/10 mM Tris (pH 7.0), by extraction with 1.5% (w/v) dodecyl P-D maltoside/0.75 M aminohexanoic acid/10 mM Hepes (pH 7.0) or by sequential extraction with these two detergent-containing solutions (Patton, S. and Huston, G. E., 1986, Lipids 21; 170-174). Suspension of the fat globule components in the detergent-containing solution can be achieved by using an all-glass homogenizer, and keeping on ice for 30 to 60 min, after which insoluble and soluble materials can be separated by centrifugation for 60 min at 2°C and 150,000 g. The above conditions can be modified to analyse whether core protein or a fusion protein containing core as a component is attached to fat globules. Other detergents, both ionic and non-ionic, along with salt solutions at various concentrations could be used to derive the proteinaceous material from fat globules. The incubation times and temperatures may be optimised by empirical means.

A particularly preferred method for producing proteins of the invention involves using milk-producing animals stably transfected with suitable expression vectors, or transgenic milk-producing animals. In these cases, the milk is harvested from the animals, and the lipid globule/protein complex extracted.

Milk fat globules can be separated from whole milk by centrifugation at 2000 g for 15 min at room temperature where they collect as a layer at the top of the centrifuge tube (Freudenstein, C. et al., 1979). Alternatively, sucrose can be added to milk (5% w/v) and

this milk solution can be layered below an overlying layer of water, buffer or saline- solution. Following centrifugation at 2000g for 20 min at room temperature, milk fat globules collect as a layer at the top of the centrifuge tube. In both methods, fat globules can be collected by a spoon, pipette or similar device. To enhance purity, the fat globules can be dispersed in a saline solution and collected by centrifugation as described above.

These methods are suitable for volumes of less than lml up to approximately 1 litre. For greater volumes, a cream separator could be employed.

E. Compositions Proteins of the invention may be combined with various components to produce compositions of the invention. These components may include pharmaceutically acceptable carriers or diluents, and/or vaccine components as described below. In particular, a composition of the invention comprises a protein of the invention together with a lipid globule. Since the HCV core protein of the invention targets proteins of interest to lipid globules, one of the products of the purification procedure may be the protein of interest already associated with a lipid globule. Alternatively, proteins of the invention may be produced and/or extracted to provide an aqueous product, substantially free of associated lipids, and lipid globules added to the purified product. Preferred lipid globules are those which occur in mammalian milk.

F. Administration The compositions of the invention may be administered by direct injection. Preferably the compositions are combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition (which may be for human or animal use). Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular or transdermal administration or inhalation. Typically, each protein may be administered at a dose of from 0.01 to 30 mg/kg body weight, preferably from 0.1 to 10 mg/kg, more preferably from 0.1 to 1 mg/kg body weight.

The polynucleotides/vectors of the invention may be administered directly as a naked nucleic acid construct, preferably further comprising flanking sequences homologous to the host cell genome. When the polynucleotides/vectors are administered as a naked nucleic acid, the amount of nucleic acid administered is typically in the range of from 1 Ag to 10 mg, preferably from 100 pg to 1 mg.

Uptake of naked nucleic acid constructs by mammalian cells is enhanced by several known transfection techniques for example those including the use of transfection agents.

Example of these agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants (for example lipofectam and transfectamTM).

Typically, nucleic acid constructs are mixed with the transfection agent to produce a composition.

Preferably the polynucleotide or vector of the invention is combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition.

Suitable carriers and diluents include isotonic saline solutions, for example phosphate- buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular or transdermal administration or inhalation.

The routes of administration and dosages described are intended only as a guide since a skilled practitioner will be able to determine readily the optimum route of administration and dosage for any particular patient and condition.

G. Preparation of Vaccines Vaccines may be prepared from one or more proteins of the invention or compositions of the invention where the proteins are immunogenic, for example comprising epitopes from viral or bacterial pathogens. They may also include one or more additional immunogenic polypeptides known in the art. The preparation of vaccines which contain an immunogenic polypeptide (s) as active ingredient (s), is known to one skilled in the art. Typically, such vaccines are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection may also be prepared.

The preparation may also be emulsified, or the protein encapsulated in liposomes. The

active immunogenic ingredients are often mixed with excipients which are- pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof. In addition, if desired, the vaccine may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and/or adjuvants which enhance the effectiveness of the vaccine. Examples of adjuvants which may be effective include but are not limited to: aluminum hydroxide, N-acetyl-muramyl-L- threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2- (1'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethyla mine (CGP 19835A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2% squalene/Tween 80 emulsion. The effectiveness of an adjuvant may be determined by measuring the amount of antibodies directed against an immunogenic polypeptide containing an antigenic sequence resulting from administration of this polypeptide in vaccines which are also comprised of the various adjuvants.

The vaccines are conventionally administered parenterally, by injection, for example, either subcutaneously or intramuscularly. Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, oral formulations. For suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably 1% to 2%. Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and may contain 10% to 95% of active ingredient, preferably 25% to 70%. Where the vaccine composition is lyophilised, the lyophilised material may be reconstituted prior to administration, e. g. as a suspension. Reconstitution is preferably effected in buffer.

Capsules, tablets and pills for oral administration to a patient may be provided with an enteric coating comprising, for example, Eudragit"S", Eudragit"L", cellulose acetate,

cellulose acetate phthalate or hydroxypropylmethyl cellulose. These capsules may be used- as such, or alternatively, the proteins and compositions of the invention may be formulated into the vaccine as neutral or salt forms. Pharmaceutically acceptable salts include the acid addition salts (formed with free amino groups of the peptide) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids such as acetic, oxalic, tartaric and maleic. Salts formed with the free carboxyl groups may also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, 2-ethylamino ethanol, histidine and procaine.

H. Dosage and Administration of Vaccines The vaccines are administered in a manner compatible with the dosage formulation, and in such amount as will be prophylactically and/or therapeutically effective. The quantity to be administered, which may generally be in the range of 5 mg to 250 mg of antigen per dose, depends on the subject to be treated, capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired. Precise amounts of active ingredient required to be administered may depend on the judgement of the practitioner and may be peculiar to each subject.

The vaccine may be given in a single dose schedule, or preferably in a multiple dose schedule. A multiple dose schedule is one in which a primary course of vaccination may be with 1 to 10 separate doses, followed by other doses given at subsequent time intervals required to maintain and or reinforce the immune response, for example, at 1 to 4 months for a second dose, and if needed, a subsequent dose (s) after several months. The dosage regimen will also. at least in part, be determined by the need of the individual and be dependent upon the judgement of the practitioner.

In addition, the vaccine containing the immunogenic proteins of the invention may be administered in conjunction with other immunoregulatory agents, for example, immunoglobulins.

I. Preparation of antibodies against the polypeptides of the invention The immunogenic proteins of the invention prepared as described above can be used to produce antibodies, both polyclonal and monoclonal. If polyclonal antibodies are desired, a selected mammal (e. g., mouse, rabbit, goat, horse, etc.) is immunised with an immunogenic protein of the invention. Serum from the immunised animal is collected and treated according to known procedures. If serum containing polyclonal antibodies to an immunogenic protein of the invention contains antibodies to other antigens, the polyclonal antibodies can be purified by immunoaffinity chromatography. Techniques for producing and processing polyclonal antisera are known in the art.

Monoclonal antibodies directed against epitopes of interest in the proteins of the invention can also be readily produced by one skilled in the art. The general methodology for making monoclonal antibodies by hybridomas is well known. Immortal antibody-producing cell lines can be created by cell fusion, and also by other techniques such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. Panels of monoclonal antibodies produced against epitopes of interest can be screened for various properties; i. e., for isotype and epitope affinity.

An alternative technique involves screening phage display libraries where, for example the phage express scFv fragments on the surface of their coat with a large variety of complementarity determining regions (CDRs). This technique is well known in the art.

Antibodies, both monoclonal and polyclonal, which are directed against epitopes are particularly useful in diagnosis, and those which are neutralising are useful in passive immunotherapy. Monoclonal antibodies, in particular, may be used to raise anti-idiotype antibodies. Anti-idiotype antibodies are immunoglobulins which carry an"internal image" of the antigen of the infectious agent against which protection is desired.

Techniques for raising anti-idiotype antibodies are known in the art. These anti-idiotype antibodies may also be useful for treatment of viral and/or bacterial diseases, as well as for an elucidation of the immunogenic regions of viral and/or bacterial antigens.

It is also possible to use fragments of the antibodies described above, for example, Fab- fragments.

The invention will be described with reference to the following Examples which are intended to be illustrative only and not limiting. The Examples refer to the following Figures.

Brief Description of the Figures Figure 1 shows (a) the sequence of HCV core protein (amino acids 1 to 195) and (b) a hydropathy plot for the HCV core protein amino acid sequence.

Figure 2 shows Western blots probed with antibodies to HCV core protein Figure 3 shows confocal microscopy images of the intracellular localisation of core proteins and lipid droplets.

Figure 4 shows confocal microscopy images of cells illustrating the effect of expression of HCV core proteins on the ability to detect ADRP in BHKC13 cells.

Figure 5 shows confocal microscopy images of cells illustrating the effect of expression of HCV core protein on the abundance of ADRP.

Figure 6 shows Western blots probed with antibodies to HCV core protein and ADRP Figure 7 shows confocal microscopy images of the intracellular distribution of chimeric proteins containing segments of core protein.

Figure 8 shows confocal microscopy images of the intracellular distribution of fluorescently labelled fatty acids in cells expressing core protein.

Detailed Description of the Figures Figure 1 a. Nucleotide sequence and predicted amino acid sequence for the core coding region of HCV strain Glasgow (supplied by M. McElwee and R. Elliott, personal communication).

Numbers at the end of each line give either the nucleotide sequence number or amino acid residue. Basic amino acids are circled. Same as corresponding sequences shown in SEQ ID. No. 1.

b. Proposed domain structure and hydrophobicity plot of the predicted core amino acid- sequence from HCV strain Glasgow.

Figure 2-Analysis of the core proteins made by the pSFV and pgHCV constructs.

A. Western blot analysis of extracts prepared from cells which were harvested 20 hours after electroporation. Aliquots of extracts containing the same number of cell equivalents were analysed with antibody JM122. The samples were from cells electroporated with RNA from the following constructs: lane 1, pSFV. 1-195; lane 2, pSFV. 1-173; lane 3, pSFV. 1-169; lane 4, pSFV. 1-153; lane 5, pSFV. A155-161; lane 6, pSFV. A161-166; lane 7, no RNA.

Arrows denote the forms of core which have (labelled C) and have not (labelled UC) been cleaved at the internal processing site.

B. In vitro translation of core proteins. Products of reactions were electrophoresed on a 10% polyacrylamide gel and detected by autoradiography. The samples were from reactions containing the following constructs: lane 1, pgHCV. 1-195; lane 2, pgHCV. 1-173; lane 3, pgHCV. I-153.

Figure 3-Confocal images of the intracellular localisation of core proteins and lipid droplets. BHK C 13 cells were harvested 20 hours after electroporation and fixed with 4% paraformaldehyde, 0.1% Triton X-100. Indirect immunofluorescence was performed with antibody JM122 and an anti-mouse secondary antibody conjugated with FITC. Lipid droplets were stained with oil red O. Since the epitope recognised by JM122 lies in the region of core removed in pSFV. A49-75, anti-core rabbit antisera 308 was used along with an anti-rabbit secondary antibody to analyse cells expressing this variant of core protein.

Lipid droplets were stained with oil red O. Panels A, D, F, H, J, L, N, P, R, T, V and X show the distributions of core protein. Panel B shows the location of lipid droplets only.

Panels C, E, G, I, K, M, O, Q, S, U, W and Y are merged images of core protein and lipid droplets. Cells were electroporated with RNA from the following constructs: panels A-C, pSFV. 1-195; panels D and E, pSFV. 1-173; panels F and G, pSFV. 1-153; panels H and I, pSFV. 1-153; panels J and K, pSFV. A2-43; panels L and M; pSFV. A9-43; panels N and O; pSFV. A49-75; panels P and Q; pSFV. A80-118; panels R and S, pSFV. A125-144; panels T and U, pSFV. A1145-154; panels I and W, pSFV. A155-161; panels X and Y, pSFV.A161-166.

Figure 4-Effect of expression of core proteins on the ability to detect ADRP in BHKC13 cells by confocal microscopy. Cells were harvested 20 hours after electroporation and fixed with methanol. ADRP was detected with anti-ADRP antibody and core protein with 308 antisera. Secondary antibodies were an anti-mouse IgG conjugated with FITC (for anti-ADRP) and anti-rabbit IgG conjugated with Cy5 (for 308 antisera). Panels A, D, G, J, M and P are images of ADRP localisation. Panels B, E, H, K, N, and Q are images of core distribution. Panels C, F, I, L, O and R show the merged images of core and ADRP distributions. Cells were electroporated with RNA from the following constructs: panels A, B and C, pSFV. 1-195; panels D, E and F, pSFV. 1-173; panels G, H and I, pSFV. 1-169; panels J, K and L, pSFV. 1-153; panels M, N and O, pSFV. A155-161; panels P, Q and R, pSFV. A161-166.

Figure 5-Effect of expression of core proteins on the ability to detect ADRP in MCA RH7777 cells by confocal microscopy. Cells were examined as described in the legend for Figure 4.

Figure 6-Effect of expression of core protein on the abundance of ADRP. BHK C13 cells were electroporated with RNA from pSFV. 1-195 and pSFV. 1-153 and extracts were prepared at the times indicated following electroporation. Aliquots of cell extracts were electrophoresed on 10% polyacrylamide gels and then the proteins were transferred to nitrocellulose membrane for Western blot analsysis. The upper panels show membranes probed with JM122 antibody while, in the lower panels, membranes were probed with anti-ADRP antibody. Bands corresponding to core proteins, expressed from pSFV. 1-195 and pSFV. 1-153, and ADRP are arrowed.

Figure 7-Intracellular distribution of chimeric proteins containing segments of core protein. Cells were harvested 20 hours after electroporation and fixed with methanol. Chimeric proteins were detected with antisera 308 (panels A and C) and antibody anti- CMV LNP (panels B and D). Secondary antibodies were an anti-mouse IgG conjugated with FITC (for anti-CMV LNP) and anti-rabbit IgG conjugated with TRITC (for 308

antisera). Cells were electroporated with RNA from constructs pSFV. 1-48tagl20-195 (panels A and B) and pSFV. I-48VP22tagl20-195 (panels C and D).

Figure 8-Intracellular localisation of metabolic products of exogenously added fluorescent-labelled fatty acids (BODIPY 558/568 Cl2) in cells expressing core protein. Cells were incubated with BODIPY 558/568 C12 at 16 hours after electroporation with pSFV. 1-195 RNA for 45 min. BODIPY 558/568 C12 was then removed, the cells washed and incubation at 37°C continued for a further 45 min at which point the cells were fixed with 4% paraformaldehyde, 0.1% Triton X-100. Core protein was detected with antibody JM122. Panels A and B show localisation of the metabolised products of BODIPY 558/568 C12 and core protein respectively; panel C is a merged image of panels A and B.

EXAMPLES MATERIALS AND METHODS Cell Lines Baby hamster kidney (BHK) C13 cells were maintained in Glasgow modified Eagle's medium supplemented with 10% newborn calf serum, 100 IU/ml penicillin/streptomycin and 5% tryptose phosphate broth. The rat hepatoma cell line, MCA RH7777, was maintained in minimal essential Eagle's medium supplemented with 20% foetal bovine serum, 100 IU/ml penicillin/streptomycin, 1 x non-essential amino acids and 2 mM L-glutamine.

ImmunologicalReagents Antibody JM122 was a mouse monoclonal antibody raised against a purified fusion protein, expressed in bacteria, which was composed of the N-terminal 118 amino acid residues of core protein encoded by HCV strain Glasgow linked to a histidine tag. Antisera 308 was raised in rabbits against a branched peptide ( A/P KPQRKTKRNT I/N RRPQDVKFPGG) gK7A. The peptide consists of residues 5-27 of core protein encoded by HCV strain Glasgow (SEQ ID. No. 1, Figure 1A). The two degenerate sites at positions 1 and 12 were introduced to obtain antisera which would be reactive against core

proteins from other isolates. AP 125 (anti-ADRP) was obtained from Cymbus- Biotechnology Ltd. ALP98 recognises a linear epitope in HCV glycoprotein E2 and was supplied by Dr. A. Patel. Secondary antibodies were obtained from Sigma with the exception of Cy5 conjugated goat anti-rabbit IgG which was obtained from Amersham.

Construction ofplasmids a. Construction of Core Deletion and Truncation Mutants Plasmids containing the coding region for the core protein of HCV strain Glasgow were obtained by combining fragments from two constructs called core. pTZl8 and 5'-ANS2 (provided by M. McElwee and R. Elliott). Core. pTZ18 possesses nucleotide residues 337-915 of the HCV strain Glasgow genome and 5'-ANS2 contains residues 1-2895. DNA fragments from these plasmids were combined in a vector called pGEMl. The resultant plasmid contained nucleotide residues 337-2895 of the HCV strain Glasgow genome and therefore encodes the core, El and E2 proteins of this isolate. For further cloning purposes, BglII sites were introduced at EcoRI and HindIII sites which lie upstream and downstream from the HCV sequences respectively. The resultant plasmid was called pgHCV. CElE2. Construction of a derivative plasmid, pgHCV. 1-195 was achieved by inserting an oligonucleotide (GCTGAGATCTA) that had both a translational stop codon and the sequences for a Bgl II enzyme site between a Fsp I enzyme site at residue 925 in the HCV genome and a Hind III enzyme in the pGEM backbone. Thus, pgHCV. 1-195 encodes the N-terminal 195 amino acids of HCV strain Glasgow. The nucleotide and predicted amino acid sequence of this region of HCV strain Glasgow is shown in SEQ ID.

No. 1. From pgHCV. 1-195, the following series of constructs were made which had various regions of the HCV coding region removed (Table 1).

Table 1 Construction of HCV Core Mutants Plasmid Sequence of Oligonucleotide Inserted Enzyme Sites used for Insertiona pgHCV/1-173 GTAACCTTCCTGGTTGCTCTTGAGATC BstEII (502)/HindIIIb TA pgHCV/1-169 GTAACCTTTGAGATCTA BstEII (502)/HindIII pgHCV/1-153 CTGGCGCATTGAGATCTA BstXI (453)/HindIIIb pgHCV/A2-43 CTGCACCATGTTGGGTGTG KpnIb/BssHII (141) pgHCV/#9-43 CTGCACCATGAGCACGAATCCTAAAC KpnIb/BssHII (141) CTCAATTOGGTGTG pgHCV/#49-75 CGCGCGTGGGCTCAGCCA BssHII (141)/BlpI (233) BIpI(233)/CIaI(371)pgHCV/#80-118TCAGCCCTTGGGTAAGGTCA CIaI(371)/BstXI(453)pgHCV/#125-144CGATAGAGGCGCTGCCAGGGCC CIaI(371)/BstXI(453)pgHCV/#125-134CGATGGGTACATACCGCTCGTCGGCG CCCCTCTTAGAGGCGCTGCCAGGGCC CIaI(371)/BstXI(453)pgHCV/#135-144CGATACCCTTACGTGCGGCTTCGTCG A TCTCATGAGAGGCGCTGCCAGGGCC pgHCV/A145-154 CATGGGGTACATACCGCTCGTCGGCG BspHr/BstEII (502) CCCCTCTTGTCCGGGTTCTGGAAGACG GTGTGAACTATGCAACAG pgHCV/#155-161 CTGGCCCATGGTGTTAACTATGCAACA BstXI (453)/BstEII (502) pgHCV/AI61-166 CTGGCCCATOGCGTCCGGGTTCTGGAA BstXI (453)/BstEH (502) GACG

bracketsrefertonucleotidepositionsinFig.1aaNumbersin siteswerelocatedinthepGME1vectorbTheseenzyme This site was incorporated into the oligonucleotide (italicised in Table) used to construct pgHCV/Al35-l44 For expression in tissue culture cells, Bgl II DNA n-agments carrying the relevant HCV sequences were prepared from the pgHCV plasmid series and inserted into the Bam HI site of a Semliki Forest virus vector, pSFV1. The resultant plasmids were termed the pSFV series (eg. pSFV 1-195). ofPlasmidsExpressingChimericProteinsb.Construction Plasmids expressing chimeric proteins containing portions of core were constructed in various stages. Firstly, a 67 base pair (bp) oligonucleotide (AtUGCGCGCI° GGGATCCTCT20AGAACTCGAG30AGCGCAAGAC40GCCCCGCGTC50ACCGGCGGT A60AGGTCAT) was inserted between Mfcl and Clal (nucleotide position 371) restriction enzyme sites in pgHCV-A9-43. The resultant plasmid was termed pgHCV. #COREtag. The Miel site was introduced into pgHCV.#9-43 at codon position 8 as a result of insertion of the oligonucleotide used to create this mutant (Table 1). The above 67bp oligonucleotide encoded residues 47 and 48 of HCV core (nucleotide positions 6-11) and those of an epitope tag (nucleotide positions 28-59) derived from the human cytomegalovirus (HCMV) gene, UL83 (Leslie et al., 1996). In addition, it also carried sites for BssHII (position 5), Baz (position 12), XbaI (position 18) and XhoI (position 25) for cloning purposes.

Residues 9 to 46 were introduced into pgHCV. ACORE. by combining a BssHII/XmnI

DNA fragment from pgHCV. 1-195 (encoding amino acid residues 1-46 of core) with a BssHII/XmnI DNA fragment from pgHCV. ACOREtag. The resultant plasmid was called pgHCV. 1-48, tag, 120-195 (numbers refer to the HCV residues encoded by the plasmid).

A BglII fragment containing the core/tag coding sequence was inserted into the BamHI site of pSFV1 to give pSFV. 1-48, tag, 120-195. Residues 172 to 274 from the herpes simplex virus type 1 (HSV-1) protein VP22 (encoded by HSV-1 gene UL49) were then introduced into pSFV. 1-48, tag, 120-195 between core residue 48 and the epitope tag. This was accomplished using a plasmid pFJ20insl72 which had an oligonucleotide containing the sequences for BglII enzyme inserted at a MscI enzyme site at codon 172 in the UL49 gene.

A BglII/XhoI fragment (encoding VP22 residues 173-274; McGeoch et al., 1988) from pFJ20insl72 was combined with BamHI/SpeI and XhoI/SpeI fragments from pSFV. 1-48, tag, 120-195 to give pSFV. 1-48, VP22tag, 120-195. The chimeric protein made by this plasmid consists (in order) of residues 1-48 of HCV core, 173-274 of HSV-1 VP22, an epitope tag followed by residues 120-195 of HCV core.

In Vitro Translation Proteins were translated in vitro using a coupled transcription/translation kit supplied by Promega. Reactions used 1 ug of DNA as template and were carried out according to manufacturer's instructions.

In Vitro Transcription Prior to electroporation, RNA was transcribed in vitro from the appropriate pSFV plasmid which had been linearised at a Spe I enzyme site. Typical reactions were carried out in a volume of 20 ul and contained 40 mM Tris (pH 7.5), 6 mM MgCl2,2 mM spermidine, 10 mM NaCI, 1 mM DTT, 1mM ATP, 1 mM CTP, 1 mM UTP, 0.5 mM GTP, 1 mM m7G (5') ppp (5') G cap analogue, 50 units Rnasin, 50 units SP6 RNA polymerase and 2 u. g linearised DNA. Reactions were performed at 37°C for 2 hours. Products of the reaction were analysed by agarose gel electrophoresis to examine the quality and quantity of RNA synthesised prior to use in electroporations.

Preparation of Cells Competent for Electroporation Cells were washed and treated with trypsin for detachment from tissue culture containers.

Detached cells were suspended in 20 ml of growth medium and centrifuged at 100 g for

5 min at room temperature. Cell pellets were suspended in 50 ml of PBSA and centrifuged as previously. Pellets were suspended in PBSA at a final concentration of about 2 x 107 cells/ml.

Electroporation of Cells, Treatment with MGl 32 and Preparation of Cell Extracts 0.8 ml of competent cells were mixed with in vitro transcribed RNA in an electroporation cuvette (0.4 cm gap) and pulsed twice at either 1.2 kV, 25 pF (for BHK C13 cells) or 0.36 kV, 960 uF (for MCA RH7777 cells). Between pulses, the cell/RNA suspension was gently mixed. Following electroporation, cells were diluted in growth medium and seeded onto either35mm tissue culture dishes or coverslips in 24-well tissue culture plates and then incubated at 37°C.

To treat cells with MG132, cells were incubated for 6 hours after electroporation at 37°C and the media was replaced with fresh media containing the protease inhibitor at a final concentration of 2.5 llg/ml. Incubation was continued at 37°C for a further 10 hours before the cells were harvested.

To prepare extracts. electroporated cells were harvested by removing the growth medium and washing the cell monolayers with PBS. Cells were scraped into PBS and pelleted by centrifugation at 100 g for 5 mins at 4°C. The cell pellet was solubilised in sample buffer consisting of 160 mM Tris (pH 6.7), 2% SDS, 700mM-mercaptoethanol, 10% glycerol, 0.004% bromophenol blue.

Alternatively, sample buffer was added directly to cells which had been washed with PBS.

Cells were solubilised at a concentration of approximately 4 x 106 cell equivalents per ml sample buffer. Samples were heated to 100°C for 5 mins to fully denature proteins and nucleic acids.

SDS-PAGEand WesternBlotAnalysis Samples were prepared for electrophoresis and proteins were separated on polyacrylamide gels cross-linked with 2.5% (wt/wt) N, N'-methylene bisacrylamide using standard techniques. Polypeptides were detected either by autoradiography or by staining using Coomassie brilliant blue.

For Western blot analysis, proteins were separated on polyacrylamide gels and transferred to nitrocellulose membrane using standard techniques. The nitrocellulose membrane was blocked in 3% gelatin, 20 mM Tris (pH 7.5), 500 mM NaCI for at least 6 hours at 37°C prior to incubation with the primary antibody. Incubations with the primary antibody (diluted to 1/500 for ADRP antibody, 1/1000 for JM122 and 1/2000 for ALP98) were performed in 1% gelatin, 20 mM Tris (pH 7.5), 500 mM NaCI, 0.05% Tween 20 at either room temperature or 37°C for approximately 3-4 hours. Following extensive washing with 20 mM Tris (pH 7.5), 500 mM NaCI, 0.05% Tween 20, the membrane was incubated for 2 hours at room temperature with anti-mouse IgG conjugated with horse radish peroxidase in the same solution as for the primary antibody and at a dilution of 1/1000. Bound antibody was detected by enhanced chemiluminescence.

Indirect Immunofluorescence and Staining of Lipids Cells on 13 mm coverslips were fixed in either methanol at-20°C or 4% paraformaldehyde, 0.1% Triton X-100 (prepared in PBS) at 4°C for 30 mins. Following washing with PBS and blocking with PBS/CS (PBS containing 1% newborn calf serum), cells were incubated with primary antibody (diluted in PBS/CS at 1/200 for JM122 antibody, 1/1000 for 308 antisera and 1/100 for ADRP antibody) for 2 hours at room temperature. Cells were washed extensively with PBS/CS and then incubated with conjugated secondary antibody (either anti-mouse or anti-rabbit IgG raised in goat) for 2 hours at room temperature. Cells were washed extensively in solutions of PBS/CS followed by PBS and finally H2O before mounting on slides using Citifluor. Samples were analysed using a Leiss LSM confocal microscope.

Following incubation with both antibodies and washing, lipid droplets were stained in paraformaldehyde-fixed cells by briefly rinsing coverslips in 60% propan-2-ol followed by incubation with 0.5ml 60% propan-2-ol containing oil red O for 1.5-2 mins at room temperature. Coverslips were briefly rinsed with 60% propan-2-ol, washed with PBS and H20 and mounted as described above. The oil red O staining solution was prepared from a saturated stock of approximately 1% oil red O dissolved in propan-2-ol. Before staining, the stock was diluted with H20 and then filtered.

For analysing the incorporation of long chain fatty acids into lipid droplets in living cells, cells were washed with PBS (heated to 37°C) and then BODIPY 558/568 Cl2 (supplied by Molecular Probes) was added to cells. BODIPY 558/568 Cl) was diluted from a stock solution (20 mM in ethanol) to give a final concentration of 20, ug/ml in PBS. Cells were incubated with the fluorescent fatty acid for 45min at 37°C after which the solution was removed, the cells washed with ETC 10 and incubation in ETC 10 continued for a further 45min. Cells were then fixed with paraformaldehyde, Triton X-100 and indirect immunofluorescence performed with anti-core antibody JM 122 as described above.

RESULTS Example 1-Predicted Domain Structure of the HCV Core Protein Previous studies have highlighted the overall basic nature of the HCV core protein. Closer examination of the predicted amino acid sequences for strain Glasgow and other HCV strains reveals that the basic residues are clustered at the N-terminal end of the protein (Bukh et al., 1994). These clusters correspond to hydrophilic regions which are found between residues 1-122 as predicted from hydropathicity profiles; the overall basic amino acid content in this region is approximately 24% (Figure 1A, B). Beyond residue 122, there are very few basic residues and the hydrophobicity content is generally higher, in particular between amino acids 123 and 145 (Figure 1A, B). Another area of yet higher hydrophobicity is found from residue 170 to 190. This latter region corresponds to the signal sequence for El which is removed during processing of core protein to the mature form (see Example 2). Based on this evidence, we propose that core protein can be divided into three domains (Figure 1B); the N-terminal region (domain 1; residues 1-122), a central domain (domain 2; residues 123-174) and the signal sequence for El (domain 3; residues 175-191). These limits for the domains are somewhat arbitrary, for example the C-terminal end of the central domain would be defined by the cleavage event which gives the mature form of the protein and as yet, the precise cleavage site has not been unambiguously characterised. Therefore, the mature core protein would consist of domains 1 and 2.

Example 2-Expression of HCV core protein and variants in tissue culture cells Presently, there is no system available for propagating HCV in tissue culture cells.

Therefore, expression of HCV gene products necessitates the use of heterologous expression systems. For short-term expression in mammalian cells, a variety of viral vectors have been utilised including vaccinia virus, Sendai virus and adenovirus. A further alternative is the Semliki Forest virus (SFV) system in which in vitro transcribed RNA, that encodes the SFV replication proteins as well as a heterologous protein but not the SFV structural proteins, is introduced into tissue culture cells. Introduction of nucleic acid into cells may be achieved by several routes but, in the examples given, the method of choice is electroporation.

BHK cells were electroporated with RNA from the series of pSFV constructs. 20 hours following electroporation, cells were harvested and extracts prepared. Samples were electrophoresed on a 10% polyacrylamide gel and, following electrophoresis, the proteins were transferred to nitrocellulose membrane for Western blot analysis.

Probing the membrane with the core-specific monoclonal antibody JM122 revealed a major single species in each sample which corresponds to core protein. The apparent molecular weights of the proteins made by pSFV. 1-195 and two truncated variants, pSFV. 1-173 and pSFV. 1-169, are approximately 21 kDa and are almost identical (Figure 2A, lanes 1-3).

Cleavage between the core and E1 coding regions occurs between residues 191 and 192.

However, there is additional data which reveals that the core protein is further processed by cleavage around residue 174 (Moradpour et al., 1996) this cleavage site will be referred to as the internal processing site. The precise residue at which this second cleavage event occurs is not known. Hence, in agreement with Figure 2A, lanes 1-3, it would be predicted that the three constructs named above would generate products of similar molecular weights.

Additional evidence for a cleavage event close to residues 169-173 occurring within tissue culture cells is shown in Figure 2B. Here, polypeptides translated in vitro from the pGEM 1 versions of 3 core variants reveal that the unprocessed species made from pgHCV. 1-195 is larger than that from pgHCV. 1-173 (compare lanes 1 and 2). As would be predicted from

the coding sequences for the third truncated form of core, the major species synthesised from pSFV. 1-153 has a lower apparent molecular weight than that from pSFV. 1-195 (Figure 2A, compare lanes 1 and 4). The major species made by the internal deletion mutants pSFV. A155-161 and pSFV. A161-166 are intermediate in size between those produced by pSFV. I-195 and pSFV. 1-153 (Figure 2A, lanes 5 and 6). Again, this agrees well with predictions based on the number of amino acids removed in these variants (7 in pSFV. A155-161 and 6 in pSFV. A161-166). It is also evident that there is a significant amount of material produced by the two internal deletion variants which has a higher molecular weight than the fully processed form of core. This presumably represents reduced cleavage at the internal processing site which may result from the removal of certain residues in these mutants which are necessary for fully efficient processing. To conclude therefore, the core proteins and its variants (data not shown) produced by the SFV constructs can be detected by a core-specific antibody and their apparent molecular weights are in agreement with predictions from the nucleotide sequences and previously published data.

Example 3-The Intracellular Distribution of the Native Core Species and its Variants Previous studies have revealed that the HCV core protein can associate with lipid droplets within the cytoplasm of cells (Barba, G. et al., 1997; Moradpour et al., 1996). This conclusion was arrived at by combining the techniques of immune electron microscopy with the ability to stain lipid with osmium tetroxide. However, this method suffers from the disadvantages that it is time-consuming and osmium tetroxide can stain other biological molecules (e. g proteins) in addition to lipid. Therefore, we developed a method for detecting proteins firstly by indirect immunofluorescence followed by staining of lipid droplets with the oil-soluble colourant oil red O. Combined with the method of confocal microscopy, it is possible to visualise the intracellular localisations of core protein and lipid droplets separately and together. A typical example is shown in Fig. 3, panels A-C. Here, BHK C13 cells have been electroporated with pSFV. 1-195 RNA and, following incubation at 37°C for 20 hours, the cells have been examined by both indirect immunofluorescence and staining with oil red O. In panel A, the core protein produced by pSFV. 1-195 is seen to locate to vesicular structures in the cytoplasm. Panel B reveals the distribution of lipid

droplets in the same cell. By merging these data (panel C), it is evident that core protein is sited around the lipid droplets. These data therefore agree with previously published results for constructs expressing the full-length coding region of core. Core protein also associated with lipid droplets in a rat hepatoma cell line called MCA RH7777 (data not shown).

Results with the constructs which produce truncated forms of core protein indicated that proteins consisting of 173 and 169 amino acids of the core coding region also locate to droplets (Fig. 3, panels D-G). By contrast, expressing only the N-terminal 153 residues results in loss of localisation to droplets and a diffuse cytoplasmic distribution is observed (Fig. 3, panels H and 1). Thus, residues of core protein between amino acids 154 and 169 are required for localisation to droplets.

Further analysis with the variants containing internal deletions showed that lipid droplet association was not prevented by removing various segments spanning residues 2 and 118 from within domain 1 (Fig. 3, panels J-Q). The most notable feature from these variants was that there was an increase in the relative sizes of some lipid droplets in a proportion of cells. Such an example is shown for mutant A2-43 (panels J and K) and there was apparent fusion of droplets also with mutant A9-43 (panels L and M). These phenomena were reproducible over several experiments. Nonetheless, with each of the domain 1 variants, association of core protein at the surface of lipid droplets was not abolished. By contrast, lipid droplet association was not detected for proteins which lacked various regions between residues 125 and 166 within domain 2 (Fig. 3, panels R-Y). Indeed, the only sequences dispensable in this portion of core protein lay between amino acids 155 and 161 (panels V, W). From these data we conclude that domain 2 contains critical elements which are necessary for lipid droplet association. By contrast, no specific sequences in domain 1 apparently play an essential part in this localisation of core protein although they may contribute through less specific interactions (e. g. neutralisation of the negative charge on phospholipids at the surface of droplets by basic amino acids in the N-terminal region).

Example 4-Effect of Localisation of Core Protein on the Lipid Droplet Associated Protein ADRP At present, there are few proteins identified in mammalian cells which are known to associate with lipid droplets. One protein which has been recently identified is adipocyte differentiation related protein (ADRP) which is ubiquitously expressed in a number of tissue culture cell lines; ADRP mRNA has also been detected in a range of tissue types in mice. To examine whether the localisation of core to lipid droplets had any affect on ADRP, BHK C13 cells were electroporated with the series of pSFV constructs expressing core protein and its variants. An example of the data is shown in Fig. 4. Panels A to C show images of three cells following electroporation with pSFV. 1-195, only one of which contains core protein (Panel B). Immunofluorescent results with the ADRP antibody (panel A) reveal that ADRP is located on vesicular structures, consistent with its previously assigned association with lipid droplets. The protein is readily detected in the cells which do not express core protein, however, it is considerably reduced in abundance in the core-expressing cell. Observations from this and a series of other experiments consistently revealed that cells expressing core protein from pSFV. 1-195 either lacked or contained barely detectable amounts of ADRP. Nonetheless, some cells in which both core protein and ADRP were present also were found; in general, such cells gave reduced fluorescence for the core protein. Hence, it was concluded that the loss of ADRP was related to the levels of expression of core in individual cells. Results with the variants of core which continue to locate to lipid droplets gave identical data (see panels D-1 and M-O). Thus, the majority of cells expressing core protein from constructs pSFV. 1-173, pSFV. 1-169 and pSFV. A155-161 contained quantities of ADRP which were barely detectable. By contrast, ADRP continued to be readily found in cells producing core proteins from pSFV. 1-153 and pSFV. A161-166, the variants which do not associate with lipid droplets (see panels J-L and P-R). Thus, association of core protein with lipid droplets correlates with a loss of ability to detect ADRP by immunofluorescence. Any cell type specificity for this affect was tested by performing identical experiments in the rat hepatoma cell line, MCA RH7777. In these cells, core protein and its variants gave identical results for their ability to associate with lipid droplets and this again correlated with the levels of ADRP detected in core-expressing cells (Figure 5). Thus the effect of core protein on ADRP is not cell-type specific.

Example 5-The Ability of Core Protein to Associate with Lipid Droplets Induces a Loss of ADRP The immunofluorescence data revealed that the association of core protein and its variants with lipid droplets led to an inability to detect ADRP. It was possible that this was due to masking of ADRP by core. To examine directly the effect of core protein on the levels of ADRP, Western blot analysis was performed on cell extracts prepared at various times following electroporation with either pSFV. 1-195 or pSFV. 1-153 RNA. In parallel, immunofluorescence analysis was also performed on these cells and this revealed that expression of the core protein produced by the two RNAs was apparent in greater than 90% of cells. Analysis with antibody JM122 indicated that core protein could be detected from both constructs at 10 hours following electroporation and peaked by about 20 hours (Figure 6). The abundance of core protein produced by the two constructs was very similar by this time-point. From analysis of these samples with the ADRP-specific antibody, it is apparent that there is no change in the abundance of ADRP following electroporation with the pSFV. 1-153 RNA. A third set of cells in this experiment which was electroporated with SFV RNA which expresses the HCV El and E2 proteins also showed no reduction in ADRP levels with time. By contrast, there is a rapid reduction in ADRP levels to barely detectable quantities which mirrors the rise in core protein made from pSFV. 1-195.

From staining of polyacrylamide gels with Coomassie brilliant blue, there were approximately equivalent amounts of protein in all samples. In addition, probing the membranes with another antibody for an endoplasmic reticulum-specific protein, calnexin, indicated that both pSFV. 1-195 and pSFV. 1-153 samples had similar quantities of this protein at the various times following electroporation. This affect of core expression on ADRP was consistently found in other experiments. Thus, the association of core protein with lipid droplets directly correlates with a specific reduction in the abundance of this protein in cells.

Example 6-Targeting of Heterologous Peptide Sequences to Lipid Droplets by HCV Core Sequences Example 3 provided evidence for regions in core which are required for targeting of the

protein to lipid droplets. To determine whether HCV core protein is capable of targeting a linked protein of interest to intracellular lipid droplets, fusion constructs were made in which foreign peptide sequences were flanked by portions of the HCV core coding region.

Figure 7 provides two examples of chimeric proteins. In both examples, the N-terminal and C-terminal portions of the chimera were composed of residues 1-48 and 120-195 respectively of the core coding region. In the first example (construct pSFV. 1-48, tag, 120- 195), the two core regions were separated by a short peptide sequence (ERKTPRVTGG) which is derived from the HCMV UL83 gene and is the epitope for a monoclonal antibody, anti-CMV LNP (Leslie et al., 1996). In the second example (construct pSFV. 1-48, VP22tag, 120-195), a segment encoding residues 173-274 of the HSV-1 protein VP22 and the anti-CMV LNP epitope sequences were flanked by core sequences. Cells were electroporated with both constructs and the intracellular distribution of the chimeric proteins analysed with antibodies 308 (anti-core) and anti-CMV LNP (anti-epitope tag).

With both constructs, the chimeric protein could be located at the surface of lipid droplets using either antibody (Figure 7, panels A-D). Western blot analysis showed also that the chimeric proteins were of the correct predicted sizes (data not shown). Data from other constructs in which the N-terminal portion of core coding region used was reduced from 48 to 8 residues showed reduced ability to direct the chimeric proteins to lipid droplets (data not shown). Hence, these results indicate that, in addition to domain 2, residues in domain 1 do contribute to the efficiency of lipid droplet binding.

Example 7-Targeting of Fatty Acids to Lipid Droplets in Cells Expressing Core Protein Fatty acids, added exogenously to cells, are internalised and metabolised to give a number of lipid products. In particular, long chain fatty acids (LCFAs) are converted to triacylglycerols and cholesterol esters, the principal components of lipid droplets. Thus, LCFAs conjugated with a fluorescent marker can be used to monitor localisation and trafficking of triacylglycerols and cholesterol esters. In this example, the ability of a fluorescent LCFA (BODIPY 558/568 C12) to incorporate into lipid droplets in cells expressing core protein was analysed. Cells, electroporated with pSFV. 1-195 RNA, were incubated with BODIPY 558/568 C12 for 45min after which the fluorescent LCFA was removed. Following a further incubation at 37°C for 45min, the cells were fixed and

analysed by indirect immunofluorescence using antibody JM122 to detect core protein. In Figure 8 (panel A), two cells are shown in which lipid droplets have stained by incorporation and metabolism of BODIPY 558/568 C, 2. Panel B shows that the upper of these cells contains core protein surrounding lipid droplets and in the merged image, (panel C), these droplets contain the metabolised fluorescent fatty acid. Thus, trafficking of metabolised LCFAs from an exogenous source to lipid droplets is not inhibited by either the loss of ADRP or the presence of core protein at their surface.

All publications mentioned in the above specification are herein incorporated by reference.

Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.

References Atschul et al., 1990, J Mol Biol: 403-410.

Altschul et al., 1994, Nature Genetics 6: 119-129 Barba, G. et al., 1997. Proc. Natl. Acad. Sci. 94: 1200-1205 Brasaemle et al., 1997, J. Lip. Res, 38; 2249-2263 Bukh et al., 1994, Proc Natl Acad Sci USA 91; 8239-8243.

Cibelli, et al., 1998, Science 280; 1256-1258 Claverie & States (1993) Computers and Chemistry 17: 191-201 Devereux et al, 1984, Nucleic Acids Research 12: 387 Engelman et al., 1986, Ann Rev, Biophys. Chem 15: 343 Freudenstein, C. et al., 1979, Experimental Cell Research 118; 277-294 Heid et al., 1998, Cell Tiss Res 294: 309-321 Leslie et al., 1996, Virology 220; 60-68 McGeoch et al., 1988, J. Gen. Virol. 69; 1531-1574.

McLauchlan, J. et al., 1994, J. Gen Virol. 75; 2047-2052.

Moradpour, D. et al., 1996, Virology 222; 51-63 Moriya, K. et al., 1998, Nature Medicine 4; 1065-1067 Moriya, K. et al., 1997, J. Gen. Virol. 78; 1527-1531 Patton, S. and Huston, G. E., 1986, Lipids 21; 170-174 Schnieke, A. E. et al., 1997, Science 278; 2130-2133 Sola, I. et al., 1998, J. Virol. 72; 3762-3772 Wootton & Federhen, 1993, Computers and Chemistry 17: 149-163