More particularly the present invention provides in a first aspect, a compound of formula I wherein X is =CR°-or =N- ; each of R°, R', R2, R3 and R4 independently is hydrogen; hydroxy; C1-C8alkyl ; C2-C8alkenyl ; C3-C8cycloalkyl ; C3-C8cycloalkyl-C1-C8alkyl ; hydroxyC,-C8alkyl ; C1-C8alkoxyC1-C8alkyl ; hydroxyCi-C8alkoxyC,-C8alkyl ; aryiCi-C8aikyl which optionally may be substituted on the ring by hydroxy, C1-C8alkoxy, carboxy or C1-C8alkoxycarbonyl ; or R3 and R4 form together with the nitrogen and carbon atoms to which they are attached a 5 to 10 membered heterocyclic ring and comprising additionally 1,2 or 3 heteroatoms selected from N, O and S; or each of R1, R2 and R3, independently, is halogen ; halo-C1-C8alkyl ; C1-C8alkoxy ; halo-Cl- C8alkoxy ; hydroxyC1-C8alkoxy ; C1-C8alkoxyC1-C8alkoxy ; aryl ; arylCi-C8alkoxy ; heteroaryl ; heteroaryl-C1-C4alkyl ; 5 to 10 membered heterocyclic ring; nitro; carboxy; C2-C8alkoxycarbonyl ; C2-C8alkylcarbonyl ; -N (C1-C8alkyl) C (O) Ci-C8alkyl ; -N (R'°) R11 ; -CON(R10)R11; -SO2N(R10)R11 ; or -C1-C4-alkylene-SO2N(R10)R11; wherein each of R'° and R"independently is hydrogen ; hydroxy; C1-C8alkyl ; C2-C8alkenyl ; C3-C8cycloalkyl ; C3-C8cycloalkyl-C1-C8alkyl ; C1-C8alkoxyC1-C8alkyl ; hydroxyC1-C8alkoxyC1-C8alkyl ; hydroxyC1-C8alkyl ; (C1-C8alkyl)-carbonyl ; arylC1-C8alkyl which optionally may be substituted on the ring by hydroxy, C1-C8alkoxy, carboxy or C2-C8alkoxycarbonyl ; or 5 to 10 membered heterocyclic ring; or R'and R2 form together with the C-atoms to which they are attached aryl or a 5 to 10 membered heteroaryl residue comprising one or two heteroatoms selected from N, O and S; or each of R5 and R6 independently is hydrogen; halogen ; cyano; C1-C8alkyl ; halo-C1-C8alkyl ; Cz-Cgaikenyi ; C2-C8alkynyl ; C3-C8cycloalkyl ; C3-C8CycIoalkylCi-C8alkyl ; C5-C10arylC1-C8alkyl ; each of R7, R8 and R9 is independently hydrogen; hydroxy; Ci-Cgaiky) ; C2-C8alkenyl ; halo-C-C8alkyl ; C1-CBalkoxy ; C3-C8cycloalkyl ; C3-C8cycloalylC1-C8alkyl ; arylCi-C8alkyl ; -Y-R12 wherein Y is a direct bond or O and R12 is a substituted or unsubstituted 5,6 or 7 membered heterocyclic ring comprising 1,2 or 3 heteroatoms selected from N, O and S; carboxy; (C1-C8alkoxy)-carbonyl ; -N (C1-8alkyl)-CO-NR10R11; -CONR10R11; -N(R10) (R"); - S02N (R1°) R" ; or R7 and R8 or R8 and R9, respectively form together with the carbon atoms to which they are attached, a 5 or 6 membered heteroaryl comprising 1,2 or 3 heteroatoms selected from N, O and S; or a 5 or 6 membered carbocyclic ring. in free form or salt form.

Any aryl may be phenyl, naphthyl or 1,2, 3, 4-tetrahydronaphthyl, preferably phenyl. Heteroaryl is an aromatic heterocyclic ring, e. g. a 5 or 6 membered aromatic heterocyclic ring, optionally condensed to 1 or 2 benzene rings and/or to a further heterocylic ring.

Any heterocyclic ring may be saturated or unsaturated and optionally condensed to 1 or 2 benzene rings and/or to a further heterocyclic ring.

Examples of heterocyclic rings or heteroaryl include e. g. morpholinyl, piperazinyl, piperidyl, pyrrolidinyl, pyridyl, purinyl, pyrimidinyl, N-methyl-aza-cycloheptan-4-yl, indolyl, quinolinyl, isoquinolinyl, 1,2, 3, 4-tetrahydroquinolinyl, benzothiazolyl, thiazolyl, imidazolyl, benzimidazolyl, benzoxadiazolyl, benzotriazolyl, indanyl, oxadiazolyl, pyrazolyl, triazolyl, and tetrazolyl.

Preferred heterocyclic rings or heteroaryl are morpholinyl, piperazinyl, piperidyl, pyrrolidinyl, pyridyl, N-methyl-aza-cycloheptan-4-yl, thiazolyl, imidazolyl and tetrazolyl.

When R7 and R8 or R8 and R9 form together with the carbon atoms to which they are attached a 5 or 6 membered carbocyclic ring, this may preferably be cyclopentyl or cyclohexyl.

Halo-alkyl is alkyl wherein one or more H are replaced by halogen, e. g. CF3.

Any alkyl or alkyl moiety may be linear or branched. C, 8alkyl is preferably C, 4alkyl. C 8alkoxy is preferably C, 4alkoxy. Any alkyl, alkoxy, alkenyl, cycloalkyl, heterocyclic ring, aryl or heteroaryl may be, unless otherwise stated, unsubstituted or substituted by one or more substituents selected from halogen ; OH; C1-C8alkyl ; C1-C8alkoxy ; nitro; cyano; COOH; carbamoyl ; C (NH2) =NOH;-N (R10) R" ; C3-C6cycloalkyl ; 3 to 7 membered heterocyclic ring; phenyl ; phenyl- C1-4alkyl ; 5 or 6 membered heteroaryl. When alkyl, alkoxy or alkenyl is substituted, the substituent is preferably on the terminal C atom. When the heterocyclic ring or heteroaryl is substituted, e. g. as disclosed above, this may be on one or more ring carbon atoms and/or ring nitrogen atom when present. Examples of a substituent on a ring nitrogen atom are e. g.

C1 8alkyl, carbamoyl,-C (NH2) =NOH,-NR'OR", C3-6cycloalkyl or phenyl-C, 4alkyl, preferably C 8alkyl, C3 6cycloalkyl or phenyl-C1-4alkyl.

Preferably substituted alkyl or alkoxy as R7 is alkyl or alkoxy substituted on the terminal C atom by OH, C1-4alkoxy or a heterocyclic ring. When R'° or R is a 5 to 10 membered heterocyclic ring, it may be e. g. thiazolyl.

Halogen may be F, Cl, Br, or 1.

Preferably at most one of R', R2 or R3 is CONR10R11 or SO2NR10R11, more preferably SO2NR10R11.

The compounds of the invention may exist in free form or in salt form, e. g. addition salts with e. g. organic or inorganic acids, for example trifluoroacetic acid or hydrochloride acid, or salts obtainable when they comprise a carboxy group, e. g. with a base, for example alkali salts such as sodium, potassium, or substituted or unsubstituted ammonium salts.

In formula I the following significances are preferred independently, collectively or in any combination or sub-combination: (a) X is =CR0 ; (b) R° is hydrogen; halogen, e. g. Cl ; C,-C4alkyl, e. g. methyl or ethyl ; C1 4alkoxy, e. g. methoxy; preferably hydrogen; (c) R'is hydrogen; halogen, e. g. Cl or F; OH; Ci-C8alkyl, e. g. methyl or ethyl ; substituted C1 8alkyl, e. g. terminally OH substituted C1-8alkyl; -SO2N(R10)R11 ; -N (C, 4alkyl) C (O) C1-4alkyl ; a 5 or 6 membered heterocyclic ring optionally substituted on a ring N atom (when possible); Ci-C8alkoxy, e. g. methoxy; aryl, e. g. phenyl ; or form together with R2 and the C-atoms to which R'and R2 are attached 5 to 10 membered aryl or heteroaryl, the latter comprising 1 or 2 nitrogen atoms; (d) R2 is hydrogen; hydroxy; C1-C8alkyl, e. g. methyl or ethyl ; substituted C1-8alkyl, e. g. terminally OH-or C, 4-alkoxy substituted C 8alkyl ; Cl-alkoxy ; C1-C4alkoxyC1-C8alkoxy ; -CON (R'°) R'l ; -SO2N(R10)R11 ; or forms together with R'and the C-atoms to which R'and R2 are attached a 5 to 10 membered aryl or heteroaryl, the latter comprising 1 or 2 nitrogen atoms; (e) R3 is hydrogen; halogen, e. g. Cl, Br; hydroxy; C1-C8alkyl, e. g. methyl or ethyl ; substituted Chalky), e. g. terminally OH substituted C1-8alkyl ; carboxy; CONR10R11; -SO2N(R10)R11 ; a 5 or 6 membered heterocyclic ring optionally substituted on a ring nitrogen atom (when possible) ; or forms together with R4 and the N and C atoms to which R3 and R4 are attached a 6 membered heterocyclic ring; (f) R4 is hydrogen; or forms together with R3 and the N and C atoms to which R3 and R4 are attached a 6 membered heterocyclic ring; preferably hydrogen; (g) R5 is hydrogen; halogen ; C1-4alkyl ; or CF3 ; (h) R6 is hydrogen; (i) R7 is hydrogen; hydroxy; C1-4alkyl ; substituted C1-4alkyl, e. g. terminally OH substituted C1-4alkyl ; C, 8alkoxy ; substituted C 8alkoxy, e. g. terminally substituted by OH, C1-4alkoxy or a heterocyclic ring; NR10R11 ; -SO2N (R10) R11; -Y-R12 ; CF3 ; or R7 forms together with R8 and the C-atoms to which R 7and R8 are attached a 5 membered heteroaryl residue, e. g. bridged by-NH-CH=CH-,-CH=CH-NH-,-NH-N=CH-,-CH=N-NH-,-NH-N=N-or-N=N-N H- ; (k) R8 is hydrogen; hydroxy; C1-4alkoxy ; carboxy; a 5 or 6 membered heterocyclic ring optionally substituted on a ring C or N atom; N (C1-4alkyl)-CO- NR10R11; or forms with R 7or R9 and the C-atoms to which R7 and R8 or R8 and R9, respectively, are attached a 5 membered heteroaryl residue, e. g. bridged by-NH-CH=CH-,-CH=CH-NH-,-NH-N=CH-,-CH=N-NH-, - NH-N=N-or-N=N-NH- ; (I) R9 is hydrogen; C1-4alkoxy ; NR10R11; or forms with Ré an the C atoms to which R8 and R9 are attached a 5 membered heteroaryl, e. g. bridged by-NH-CH=CH-,-CH=CH-NH-,-NH- N=CH-,-CH=N-NH-,-NH-N=N-or-N=N-NH- ; (m) one of R'° and R11, independently, is hydrogen or Cr4alkyl and the other is hydrogen; OH; C1-8alkyl, substituted C, 8alkyl, e. g. terminally substituted by OH, C3-6cycloalkyl or a heterocyclic ring; C2-8alkenyl ; C3-8cycloalkyl ; hydroxyC1-8alkoxyC1-8alkyl ; or a 5 membered heterocyclic ring.

R3 is preferably SO2NR10R11. The present invention also provides a process for the production of a compound of formula 1, comprising reacting a compound of formula 11 wherein R', R2, R3, R4, R5, R6 and X are as defined above, and Y is a leaving group, preferably halogen such as bromide, iodine, or in particular chloride ; with a compound of formula III wherein R R3 and R9 are as defined above; and recovering the resulting compound of formula I in free or in form of a salt, and, where required, converting the compound of formula I obtained in free form into the desired salt form, or vice versa.

The process may be performed according to methods known in the art, e. g. as described in examples 1 to 4.

The compound of formula 11 used as starting materials may be obtained by reacting a compound of formula IV with a compound of formula V wherein Rt, R2, R3, R4, R5, R, Y and X are as defined above.

The compounds of formula IV and V are known or may be produced in accordance with known procedures.

The following examples illustrate the invention without any limitation.

The following abbreviations are employed: APC = allophycocyanine, BINAP = 2,2'- bis (diphenylphosphino)-1, 1'-binaphthyl, cDNA = complementary DNA, DCM = dichloromethane, DIAD = diisopropyl azodicarboxylate, DMAP = 4-dimethylaminopyridine, DMF = dimethylformamide, DMSO = dimethylsulfoxide, DMF = dimethylformamide ; Pmc = 2,2, 5,7, 8- pentamethylchroman ; tBu = tert.-butyl ; DIPCDI = N, N'-diisopropylcarbodiimid ; DTT = 1,4-dithio- D, L-treitol, DNA = deoxyribonucleic acid, EDTA = ethylenediaminetetra-acetic acid, Lck = lymphoid T-cell protein tyrosine kinase, LAT-11 = linker for activation of T cell, RT = room temperature; RT-PCR = reverse transcription polymerase chain reaction, MS = molecular ion (e. g. M+H'+) determined by electrospray mass spectroscopy; Eu = europium; ZAP-70 = zeta chain-associated protein of 70 kD; Syk = p72syk protein tyrosine kinase; SA = streptavidin.

Example 1: 2-[2-(1 H-lndazol-6-ylamino)-pyrimidin-4-ylamino]-benzenesulfonamide (a) 2- (2-Chloro-pyrimidin-4-ylamino)-benzenesulfonamide : To a suspension of 8.52 g (49.47 mmol) 2-aminobenzenesulfonamide in 200 mi isopropanol is added 22.1 g (148.42 mmol, 3 equivalent) 2, 4-dichloropyrimidine and 20 ml 10 M hydrochloric acid (200 mmol, 4 equivalent). The suspension is stirred at 60°C for 2 h 15 min. The reaction mixture is diluted with 2 1 ethyl acetate and 500 mi water is added. The pH is adjusted to 8-9 by addition of sodium bicarbonate. The layers are separated and the aqueous layer is reextracted with 500 ml ethyl acetate. The organic layers are dried with sodium sulfate, filtered and evaporated to a volume of 300 mi. A crystalline precipitate is formed and removed by filtration (side product).

The filtrate is evaporated to 100 mi whereupon the product crystallizes to give 2- (2-chloro- pyrimidin-4-ylamino)-benzenesulfonamide (97% purity by HPLC). The mother liquor of this cristallisation is further purified by column chromatography and crystallisation to give further 2- (2-chloro-pyrimidin-4-ylamino)-benzenesulfonamide.

(b) 2-[2- (1H-Indazol-6-ylamino)-pyrimidin-4-ylamino]-benzenesulfonami de : To a suspension of 7.25 g (25.46 mmol) 2- (2-Chloro-pyrimidin-4-ylamino)-benzenesulfonamide and 4.07 g (30.55 mmol, 1.2 equivalent) 6-aminoindazole in 400 mi isopropanol is added 13 ml conc. HCI* (130 mmol, 5 equivalent). The suspension is refluxed for 4 h 30 min. The reaction mixture is diluted with 1.5 1 ethyl acetate and 1 I water is added. The pH is adjusted to 8-9 by addition of sodium bicarbonate. The layers are separated and the aqueous layer is re-extracted with 500 ml ethyl acetate. The organic layers are dried with sodium sulfate, filtered and evaporated to a volume of 300 mi. A crystalline precipitate (1.01 g) is formed and removed by filtration (side product). The filtrate is purified by chromatography on 200 g silica gel eluting with ethyl acetate/methanol 95/5 v/v. Upon evaporation crystals are formed which are filtered to give the title compound.

'H NMR (400 MHz, DMSO-d6) : 69. 42 (s, 1H), 8.34 (d, 1 h), 8.28 (d, 1H), 8.27 (s, 1H), 7.93 (s, 1 H, 7.88 (d, 1 H), 7.62 (m, 2H), 7.32 (d, 1 H), 7.24 (t, 1 H), 6.40 (d, 1 H).

MS m/z (%): 382 (M+H, 100); Example 2 : 2- [2- (3, 4, 5-Trimethoxy-phenylamino)-pyrimidin-4-ylamino]- benzenesulfonamide The title compound is prepared from 2- (2-chloro-pyrimidin-4-ylamino)-benzenesulfonamide as described in Example 1 using 3,4, 5-Trimethoxy-phenylamine instead of 6-aminoindazole in step (b).

'H NMR (400 MHz, DMSO-d6) : E9. 18 (s, 1H), 8.22 (d, 1H), 8.17 (d, 1H), 7.89 (d, 1H), 7.55 (t, 1H), 7.25 (t, 1H), 7.14 (s, 2H), 6.40 (d, 1H), 3.69 (s, 6H), 3.62 (s, 3H). MS mlz (%): 432 (M+H, 100) ; Example 3: 2-methyl-6- [2- (3, 4, 5-Trimethoxy-phenylamino)-pyrimidin-4-ylamino]- benzenesulfonamide The tilte compound is prepared as described in Example 1 with the difference that in step (a) 2- amino-6-methyl-benzenesulfonamide is used instead of 2-aminobenzenesulfonamide.

2-Amino-6-methyl-benzenesulfonamide may be prepared as described by Girard, Y el al. ; J. J.

Chem. Soc. Perkin Trans. I 1979, 4, 1043-1047 : Under an atmosphere of nitrogen m-toluidin (32.1 g, 32.5 ml, 0.30 mmol) is added dropwise to a solution of chlorosulfonyl isocyanate (51.3 ml, 83.6 g, 0.59 mmol) in nitroethane (400 mi) at-55-49°C. The cold bath is removed and the mixture allowed to warm to-8°C, whereupon aluminium chloride (51 g, 0.38 mmol) is added.

Heating the mixture to 100°C for 20 min forms a clear brown solution, which is cooled to RT and poured on ice. After filtration, washing with ice water and diethyl ether the precipitate is collected and dissolved in dioxane (300 ml). Water (1000 ml) and conc. HCI (1500 ml) are added to form a suspension, which is heated to 120°C for 18h. After cooling to RT the clear brown solution is washed with diethyl ether/hexane (1400 ml, 1/1 v/v) and adjusted to pH = 8 by addition of sodium carbonate. Extraction using ethyl acetate (2 x 1000 ml), washing of the organic phase with water (500 ml) and brine (500 ml), drying (magnesium sulfate) and concentration yields a brown solid, which is purified by chromatography on silica using methylene chloride/ethanol (100/1 v/v) to yield the desired product as a white solid.

Melting point: 72-75°C (Propan-2-ol) ; 'H NMR (400 MHz, DMSO-d6) : # 2.64 (s, 3H, Me), 3.63 (s, 3H, OMe), 3.68 (s, 6H, OMe), 6.31 (d, J = 5Hz, 1H, pyrimidine CH), 7.07 (d, J = 8Hz, 1H, arom. CH), 7.15 (s, 2H, arom. CH), 7.40 (t, J = 8Hz, 1H, arom. CH), 7.65 (s, 2H, S02NH2), 8. 04 (d, J = 8Hz, 1H, arom. CH), 8.12 (d, J = 5Hz, 1H, pyrimidine CH), 9.14 (s, 1H, NH), 9.40 (s, 1H, NH).

MS (ES+) m/z: 446 (MH+), 468 (MNa+) MS (ES-) : 444 (M-H)- Example 4 : 2-Methoxy-6-[2-(3,4,5-trimethoxy-phenylamino)-pyrimidin-4-yl amino]- benzenesulfonamide The title compound is prepared as described in Example 1 with the difference that in step (a) 2- amino-6-methoxy-benzenesulfonamide is used instead of 2-Amino-6-methyl- benzenesulfonamide.

2-Amino-6-methoxy-benzenesulfonamide may be prepared from 12.3 g of meta-anisidine following an analogous procedure as described in Example 1 a. NMR (400 MHz, DMSO-d6) : J3. 62 (s, 3H, OMe), 3.69 (s, 6H, OMe), 3.91 (s, 3H, OMe), 6.31 (d, J = 5Hz, 1 H, pyrimidine CH), 6.86 (d, J = 8Hz, 1 H, arom. CH), 7.12 (s, 2H, arom. CH), 7.43 (t, J = 8Hz, 1 H, arom. CH), 8.01 (d, J = 8Hz, 1 H, arom. CH), 8.11 (d, J = 5Hz, 1 H, pyrimidine CH), 9.18 (s, 1 H, NH), 9.79 (br, 1 H, NH).

MS (ES+) : 462.2 (MH+), 484. 2 (MNa+) MS (ES-): 460.3 (M-H)- The compounds of formula Xi wherein R3, R7 and R8 are as defined in Table 1, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 1 Example R3 R7 R8 MS Data *ES+ *ES- *EI 5 -OH -O-(1-methyl)-azacyclhept-4-yl -H 406 404 6 -SO2NH2 -O-(1-methyl)-azacyclohept-4-yl -H 469. 3 7-S02NH2-0-2- (1-methyl-azacyclopent-2--H 469.3 I)-ethyl 8 -OH -O-2-(1-piperidyl)-ethyl -OCH3 436.3 434.4 9 -OH -O-2-(1-methyl-azacyclopent-2- -H 406 404 I)-ethyl 10 -SO2NH2 -O-CH2CH2CH2-1-imidazolyl -OCH3 496 494 11-S02NH2-0-2-1-piperidyl)-ethyl-OCH3 499.2 497.3 12 -SO2NH2 -O-CH2CH2-1-methyl-imidazol-1- -H 466 464 yl 13 -OH -O-2-[1-(1, 2, 4-triazolyl)]-ethyl -H 390 388 14-OH-0-2-hydroxyethyl-OCH3 369.4 367.3 15 -SO2NH2 -O-2-hydroxyethyl -OCH3 431 16-S02NH2-O-CH2CH2-1-imidazolyl-OCH3 17 -SO2NH2 -O-2-[1-(1, 2, 4-triazolyl)]-ethyl -H 452 18 -SO2NH2 -NH-N=N- 381 19-SO2NHCH3-O-CH2CH2-1-imida-OCH3 496 494 20-S02NH2-0-2-1-piperidyl)-ethyl-H 469 467 21-S02NH2-O-CH2CH2-1-imidazolyl-H 452 450 22-OH-0-2-1-piperidyl)-ethyl-H 406 23-COOH-4-morpholino-H 24-OH-O-CH2CH2CH2-1-imidazolyl-OCH3 433 431 25 -SO2NHCH3 -CH=N-NH- 396 394 26 -SO2NH2 -O-2-(4-morpholino)ethyl -H 471 469 27 -SO2NH2 -OCH3 -OCH3 402 400 28-OH-0-2- (4-morpholino) eth I-H 408 406 29 -SO2NH2 -CH=N-NH- 381 30-SO2NHCH3-O-CH2CH2-1-imidazol l-H 31 -COOH amino-H 322 32-S02NH2-O-CH2CH2CH2-1-imidazolyl-H 466. 2 464.3 33-COOH-N CH3 2-H 34-5- (1, 2,3, 4--NH-C (O) CH3-H 388 386 tetrazol I 35-SO2NHCH3-NH-N=CH- 36-COOH-OH-H 37 -COOH -H -4-piperidyl 38-COOH-CH2-OH-H 39 -OH -O-CH2CH2-1-imidazolyl -OCH3 40 -SO2NH- -O-CH2CH2-1-imidazolyl -H 496 494 CH2CH2-OH 41-C (O) NH2 amino-H 321 42-S02NH2-CH=CH-NH-381 43-5- (1, 2,3, 4- -NHCH2-3-pyridyl -H 435 tetrazolyl 44-S02NH2-NH-CH=CH-379 45-COOH-H-4- morpholin 46-COOH-H-1- (4- amino)- piperidyl 47 -SO2NH2 -OCH3 -H 372 370 48 -SO2N(CH3)2 -O-CH2CH2-1-imidazolyl -H 480 478 The compounds of formula X2 wherein R3 and R8 are as defined in Table 2, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 2 Example R3 R8 MS Data *ES+ *ES- 49 -COOH -OCH3 397 395 50-S02NH2-OH 51-SO2NHCH3-OCH3 52 -5-(1, 2,3, 4-tetrazolyl) -OCH3 421 53-SO2NH-cyclopropI-OCH3 472. 2 470.3 54-C (O) NHOH-OCH3 412 410 55 -SO2NH- -OCH3 476 474 CH2CH2-OH 56 -SO2N(CH3)2 -OCH3 460. 3 458.3 57-OH-OCH3 369 367 58-S02NH-CH2CH2CH3-OCH3 474 472 59 -CH2OH -OCH3 60 -SO2NH2 -H 402 The compounds of formula X3 wherein R', R7, R8 and R9 are as defined in Table 3, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 3 Example R1 R7 R8 R9 MS Data *ES+ *ES- 61 -SO2NH-CH2CH2-O- -H -N (CH3)--H CH2CH2-OH C (O) CH3 62 -SO2NH2 -OCH3 -OCH3 -OCH3 63-S02NH2-O-CH2CH2-1-imidazolyl-OCH3-H 64 -SO2NH-CH2CH2-O- -OCH3 -OCH3 -OCH3 520 518 CH2CH2-OH 65-N (CH3) C (O) CH3-OCH3-OCH3-OCH3 424 422 66 -CH2CH2-OH -SO2NH-CH2CH2CH2CH3 -H -H 67-S02NH2-OCH3-H-OCH3 68-S02NH2-O-CH2CH2-1-imidazolyl-H-H 69-CH2CH2-OH-O-CH2CH2-1-imidazolyl-H-H 70-CH2CH2-OH-OCH3-H-OCH3 71-SO2NH2-OH-H-H 72 -O-CH2CH2-OH -O-CH2CH2-1-imidazolyl -H -H 73 -SO2NH-2-thiazolyl -OCH3 -OCH3 -OCH3 515 513 The compounds of formula X4 wherein R2, R5, R7, R8 and R9 are as defined in Table 4, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 4 Example R2 R5 R7 R8 R9 MS Data *ES+ *ES- 74-S02NH-2--H-OCH3-OCH3-OCH3 472 470 propenyl 75-SO2NH2-H-OCH3-OCH3-OCH3 76 -OH -H -O-(1-methyl)- -H -H 406.3 404.3 azacyclohept-4-yl 77-OH-H-O-CH2CH2-OH-OCH3-H 369 367 78-S02NH2-Br-OCH3-OCH3-OCH3 510. 1/ 508. 1/ 512.1 510.2 79-S02NH2-H-CH=N-NH--H 382 80-S02NH2-CH3-OCH3-OCH3-OCH3 446 444 81 -SO2NH2 -H -O-CH2CH2-1-imidazolyl -OCH3 -H 482 480 82 -OH -H -O-CH2CH2-1-piperidyl -OCH3 -H 436. 3 434.3 83 -OH -H -O-CH2CH2-1-imidazolyl -OCH3 -H 419 417 84 -SO2NH2 -H -O-CH2CH2-1-imidazolyl -H -H 452 450 85 -CH3 -C#N -OCH3 -OCH3 -OCH3 392 86 -SO2NH2 -H -NH-N=CH- -H 382 87-OH-H-OCH3-OCH3-OCH3 369 367 88-SO2NHCH3-CH3-OCH3-OCH3-OCH3 460 458 89-OH-H-OH-COOH-OCH3 90-OH-H-O-CH2CH2-1-piperidyl-H-H 406 404 91-S02NH-2--H-O-CH2CH2-1-imidazolyl-H-H 492.3 490.3 propenyl 92-S02NH2-Br-O-CH2CH2-1- (1-methyl)--H-H 544. 1/ 542/ imidazol 546 544.2 93 -SO2NH2 -H -O-CH2CH2-OH -OCH3 -H 94 -OH -H -O-(1-methyl)- -H -H azacyclopent-2-yl 95-OH-H-0-CH2CH2-1-imidazolyl-H-H 389 387 96-OH-H-O-CH2CH2CH2-1--OCH3-H 433.4 431.4 imidazolyl 97-S02NH2-H-OCH3-H-OCH3 98-OH-H-OCH3-OCH3-H 339 337 99-S02NHCH2--H-OCH3-OCH3-OCH3 488 486 CH2CH2CH3 100 -SO2NH-CH3 -CH3 -O-CH2H2-1-imidazolyl -OCH3 -H 510 508 101 -SO2NHCH2- -H -O-CH2CH2-1-imidazolyl -H -H 08 506 CH2CH2CH3 102-OH-H-O-CH2CH2-4-morpholino-H-H 408 103-OH-H-NH-N=CH--H 319 317 104-OH-H-CHN-NH--H 319 317 105 -OH -H -O-CH2CH2-1-imidazolyl -H -H 106 -SO2NH-CH3 -CH2- -OCH3 -OCH3 -OCH3 474.3 472. 3 1-CH3 I- 107-S02NH2-H-OCH3-OCH3-OCH3 The compounds of formula X5 wherein R°, R', R2, R3 and R4 are as defined in Table 5, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 5 Example R0 R1 R2 R3 R4 MS Data *ES+ *ES- 108-H-OCH3-OH-H-H 109-H nitro-H-OH-H 414 412 110-H-N=CH-CH=CH--H-H 111 -H -CH=N-NH- -H -H 393 391 112-H-NH-N=CH--H-H 393 113-H-H-OH-CH2CH2CH2-409 407 114-CH3-H-CH3-OH-H 397 115-H phenyl-H-SO2NH2-H 508 506 116-CH3-H-H-SO2NH2-H 446 444 The compounds of formula X6 wherein R5, R7, R8 and R9 are as defined in Table 6, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 6 Example R5 R7 R8 R9 *ES+ *ES- 117 -CH3 -O-CH2CH2-1-imidazolyl -H -H 466 118-CH2CH3-OCH3-OCH3-OCH3 460 458 119-Br-NH-N=CH--H 461 120 -CH3 -O-CH2CH2-1-imidazolyl -OCH3 -H 496 121-CH3-OCH3-OCH3-OCH3 446 122-CH3-N=N-NH--H 397.2 395. 2 123 -CH3 -O-CH2CH2-1-methyl-imidazol-1-yl -H -H 480 124-Br-CH=N-NH--H 461.3 458.1 /460 125 -CH3 -NH-N=CH- -H 396 126-Br-OCH2CH2- (4-methyl-piperazin-1--H-H 562/560/ yl) 564 562 The compounds of formula X7 wherein R1, R2, R3, R7 and R8 are as defined in Table 7, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 7 Ex R1 R2 R3 R7 R8 *ES+ *ES- 127-OCH3-OH-H-OH-OCH3 128-H-CH3-SO2NH2-O-CH2CH2-1-imidazolyl-H 466 464 129-OCH3-OH-H-O-CH2CH2-1-imidazolyl-OCH3 130-OCH3-OH-H-O-CH2CH2-OH-OCH3 399 397 131-OCH3-OH-H-0-1-methyl-azacyclohept-4-yl)-H 436 132 -CH3 -H -SO2NH2 -O-CH2CH2-1-imidazolyl -H 466 464 133-OCH3-OH-H-0-CH2CH2- (l-methyl)--H 436 434 azacyclopent-2-yl 134-OCH3-OH-H-CF3-H 135-N=CH-CH=CH--H-O-CH2CH2-1-imidazol l-OCH3 136-OCH3-OH-H-O-CH2CH2CH2-1-imidazolyl-OCH3 463 461 137 -OCH3 -OH -H -O-CH2CH2-1-piperidyl -OCH3 466. 4 464.4 138-CH=N-NH--H-NH-N=CH- 139-CH=N-NH--H-CH-N=NH- 140-OCH3-OH-H-O-CH2CH2-1-iperidyl-H 436 434 141 -H -OCH3 -SO2NH2 -O-CH2CH2-1-pyrrolidinyl -H 485. 3 483.3 142 -h -OCH3 -SO2NH2 -O-CH2CH2-1-pyrrolidinyl -CH3 499.2 497.3 143 -H -OCH3 -SO2NH2 -O-CH2CH2CH2-morpholino -OCH3 545.2 545.3 144-H-OCH (CH3) 2 -SO2NH2 -O-CH2CH2-(4-methyl-piperazin- -OCH3 572.2 570.3 1-yl 145 -H -OCH3 -SO2NH2 -O-CH2CH2-1-piperidinyl -H 499. 2 497.3 146-CH3-OCH3-SO2NH2-O-CH2CH2CH2-1-pyrrolidinyl-OCH3 543.2 147 -CH3 -OCH3 -SO2NH2 -O-CH2CH2CH2-1-pyrrolidinyl -H 513. 2 511.2 148-H-OCH (CH3) 2-S02NH2-O-CH2CH2-1-piperidinyl-H 527. 2 525.3 149 -H -CH3 -SO2NH2 -N(CH3)2 -OCH3 429.3 427.3 150 -CH3 -CH3 -SO2NH2 -O-CH2CH2CH2-1-pyrrolidinyl -OCH3 527. 2 525.3 151-OCH3-H-S02NH2-O-CH2CH2CH2-1-pyrrolidinyl-OCH3 529.2 527.3 152-H-F-S02NH2-N (CH3) 2-OCH3 433.1 153-H-CH3-S02NH2-O-CH2CH2- (1-methyf-pyrrolidin--H 2-yl) 154 -H -OCH3 -SO2NH2 -O-CH2CH2-OH -H 432.2 430. 2 1 (1-methyl-pyrrolidin--OCH3 513.2 511.3 2-yl) 156 -OCH3 -H -SO2NH2 -O-CH2CH2-1-piperidinyl -H 499. 2 497.3 157 -OCH3 -H -SO2NH2 -O-CH2CH2-1-pyrrolidinyl -OCH3 515.2 513.2 158 -H -CH3 -SO2NH2 -O-CH2CH2-OH -OCH3 446.2 444.2 159-OC2H5-H-S02NH2-O-CH2CH2-1-pyrrolidinyl-CH3 513. 3 511.3 160-OCH3-OCH3-S02NH2-0-CH2CH2- (4-methyl-piperazin--OCH3 574.2 572.2 1-yl) 161 -H -CI -SO2NH2 -(4-methyl-piperazin-1-yl) -H 474. 5 472.5 162 -H -CH3 -SO2NH2 -O-CH2CH2-(4-cyclopentyl- -H 552. 3 550.3 piperazin-1-yl) 163-CH=CH-CH=CH--S02NH2- (4-methyl-piperazin-1-yl)-H 490. 5 488*4 164 -H -H -SO2NH2 -O-CH2CH2-piperazin-1-yl -H 470.2 468.3 165-H-OCH3-S02NH2-H-OCH3 402.2 400.2 166-H-OCH3-S02NH2-O-CH2CH2- (4-benzyl-piperazin--H 590. 3 588.3 1-yl) 167 -CH3 -H -SO2NH2 -O-CH2CH2-1-pyrrolidinyl -H 469.2 467.3 168 -Br -H -SO2NH2 -O-CH2CH2-1-piperidinyl -H 549. 1 547.2 The compounds of formula X8 wherein R1, R2, R3 and R8 are as defined in Table 8, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 8 Ex R R2 R3 R8 *ES+ *ES- 169 4-morpholino -H -H -H 170-CH=N-NH--H-H 363 361 171-OCH3-OH-H-H 172-CH3-H-S02NH2-OCH3 446 The compounds of formula Xg wherein R7, R8 and R9 are as defined in Table 9, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 9 Example R7 R8 R9 *ES+ *ES- 173 -O-CH2CH2-1-piperidyl -OCH3 -H 470.3 468.3 174 -O-(1-methyl-azacyclohept-4-yl) -H -H 440 175 -O-(1-methyl-azacyclopent-2-yl) -H -H 440 438 176-O-CH2CH2-CH2-1-imidazolyl-OCH3-H 467 465 177-OCH3-OCH3-OCH3 178 -O-CH2CH2-1-(1, 2, 4-triazol I-H-H 424 422 179-O-CH2CH2-1-piperidyl-H-H 180-O-CH2CH2-OH-OCH3-H 181-O-CH2CH2-4-morpholino-H-H 442 440 182 -O-CH2CH2CH2-1-imidazolyl -H -H The compounds of formula X10 wherein Rt, R7 and R9 are as defined in Table 10, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 10 EX R1 R7 R9 *ES+ *ES- 183 -CH2CH2-OH -OCH3 -OCH3 411 409 184-S02NH2-O-CH2CH2-1-imidazolyl-H 496. 3 494.3 The compounds of formula Xii wherein R8 is-OCH3 (Example 185) or-OH (Example 186), may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

The compounds of formula X12 wherein R°, R1, R7, R8 and R9 are as defined in Table 12, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 12 Example R0 R1 R7 R8 R 187-H-H-H-S02NH2-H 188-H-H-H-H-CH3 189-H-H-H-CH3-H 190-H-F-OCH3-OCH-OCH3 191-H-H-H-CH3-CH3 192 -H -H -CH3 -H -CH3 193-H-H-OCH3-CH3-H 194 -H -H -H -H -N(CH3)2 195-H-H-OCH (CH3) 2-HH 196 -H -H -H -OCH (CH3) 2-H 197-H-H-CH (CH3) 2-H-H 198-H-H-H-CH=N-NH- 199 -H -H -OCH3 -CH3 -OCH3 200-OCH3-H-OCH3-OCH3-OCH3 201-H-H-H-H-H 202 -CH3 -Cl -OCH3 -OCH3 -OCH3 203 -H -H -H -H -CF3 204 -Cl -CH3 -OCH3 -OCH3 -OCH3 205-H-H-H-NH-CH=N- 206 -H -H -H -N(-CH2CH2CH2-4-morpholino)-CH=CH- 207-H-H-CH2CH2-CH2--H The compounds of formula X13 wherein R1, R2, R3 and R5 are as defined in Table 13, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 13 Example R1 R2 R3 R5 *ES+ *ES- 208 -H -H -SO2NHCH3 -CF3 514. 0 209 -H -H -SO2NHC3H7 -Br 210-H-H-SO2NH-CH2CH--Br cyclopropyl 211-H-H-S02NHCH3-CH3 212 -H -H -SO2N (CH3) 2-Br 213 -H -H -SO2NHCH3 -Cl 214-H-H-S02NHCH3-I 215 -H -H -SO2NHCH3 -Br 216 -CH3 -OCH3 -SO2NH2 -H 476 474 217 -H piperidino -SO2NH2 -H 515.5 513.4 218 -H morpholino -SO2NH2 -H 517.4 515. 4 219-H-C2H5-S02NH2-H 220 -H -CH3 -SO2NH2 -Cl 221-H-CH3-S02NHCH3-H 460. 4 222 -H phenyl -SO2NH2 -H 508.2 506. 3 The compounds of formula Xi4 wherein R2, R3, R5, R7, R8 and R9 are as defined in Table 14, may be prepared by following the procedure of Example 1 but using the appropriate starting materials.

TABLE 14 Ex R2 R3 R5 R7 R8 R9 *ES+ *ES- 223 -OCH3 -SO2NH2 -H -H -CH=N-N(CH3)- 424 224 -OCH3 -SO2NH2 -H -O-CH2CH2-OCH3 -OCH3 -H 476.2 474.3 225-OCH (CH3) 2-S02NH2-H-O-CH2CH2--OCH3-H 551.2 555.3 piperidin 226 -OCH3 -SO2NH2 -H -O-CH2CH2-(4- -H -H 514.3 512.3 methyl-piperazin-1-yl) 227 -OCH3 -SO2NH2 -H -morpholino -OCH3 -H 487. 1 485.2 228-CH3-S02NH2-H-O-CH2CH2CH2--OCH3-H 527.3 piperidin 229-CH3-S02NH2-H-O-CH2CH2CH2-1--OCH3-H 513.2 511.3 pyrrolidinyl 230-O-CH2CH2--S02NH2-H-H-CH=N-N (CH3)- 539 537 OCH3 231- (4-methyl--S02NH2-H-OCH3-OCH3-530. 4 528.4 piperazin-1-yl) OCH 3 232 -OCH3 -SO2NH2 -H -O-CH2CH2-OH -OCH3 -H 462.2 460. 3 233-OCH3-S02NH2-Br-O-CH2CH2-OCH3-OCH3-H 234-CH3-S02NH2-H (4- -OCH3 -H 528.2 526.3 methyl-piperazin-1-yl 235 -CH3 -SO2NH2 -H -O- CH2CH2-N(CH3 2-H-H 443.2 441.3 236-H-S02NH2-H-O-CH2CH2-1--OCH3-H 485.2 483.3 rrolidinyl 237 -CH3 -SO2NH2 -H -H -N (CH3)-N=CH- 410 238 -CH3 -SO2NH2 -H -CH3 -OCH3 OCH3 239-CH3-SO2NH2-Br-O-CH2CH2-OCH3-OCH3-H 538/ 540 240-OCH3-S02NH2-H-OCH3-H-H 402.2 400. 2 241-H-S02NH2-H-H-CO--H NH- CHzCHs - OCH3 ES+ means electrospray MS positive mode; ES-means electrospray MS negative mode; and EL means electron impact MS.

The compounds of formula I and their pharmaceutically acceptable saits, exhibit valuable pharmacological properties when tested in in vitro assays, and are therefore useful as pharmaceuticals.

In particular the compounds of the invention exhibit ZAP-70 (zeta chain-associated protein of 70 kD), Focal Adhesion Kinase (FAK) and/or Syk protein tyrosine kinases inhibiting activity. More particularly the compounds of the invention are active at the human ZAP-70, FAK and/or Syk protein tyrosine kinases. ZAP-70, FAK and/or Syk protein tyrosine kinase interaction of the compounds of the invention may be demonstrated by their ability to prevent phosphorylation of e. g.

LAT-11 (SEQ ID NO: 1) by human ZAP-70 protein tyrosine kinase, to prevent phosphorylation of e. g. Biot-Y397 (SEQ I D NO : 2) by human FAK protein tyrosine kinase, and/or to prevent phosphorylation of e. g. polymeric glutamic acid-tyrosine (Glu, Tyr) by human Syk protein tyrosine kinase in, e. g. aqueous solution, e. g. as demonstrated in accordance with the following test methods.

1. Cell-free kinase assays: ZAP-70 and Syk Kinase assays ZAP-70, Lck and Syk are commercially available from Upstate Biotechnology, Lake Placid, NY.

Preparation of LAT-11 (SEQ ID NO : 1) : The peptide LAT-11 used as a substrate in the ZAP-70 kinase assay may be prepared as disclosed in Example 1 A of WO 02/12275, the contents of which, particularly with reference to Example 1A, is incorporated herein by reference.

ZAP-70 Kinase assay : The activities of the agents of invention are determined in a homogenous ZAP-70 kinase assay based on time-resolved fluorescence resonance energy transfer. Briefly, 80 nM ZAP-70 are incubated with 80 nM Lck and 4 uM ATP in ZAP-70 kinase buffer (20 mM Tris, pH 7.5, 10 1M Na3VO4, 1 mM DTT, 1 mM MnCI2, 0. 01 % bovine serum albumin, 0.05 % Tween 20) for 1 hour at room temperature in a siliconized polypropylene tube. Then, the selective Lck inhibitor PP2 (4-amino-5- (4-chioro-phenyl)-7- (t-butyl) pyrazolo [3,4-d] pyrimidine; Alexis Biochemicals) is added (final concentration 1. 2 uM) and incubated for further 10 min. Ten zizi of this solution is mixed with the 10 jii biotinytated peptide LAT-11 (1, uM) as substrate and 20 zizi of serial dilutions of inhibitors and incubated for 4 hours at room temperature. The kinase reaction is terminated with 10 lli of a 10 mM EDTA solution in detection buffer (20 mM Tris, pH 7.5, 0.01 % bovine serum albumin, 0.05 % Tween 20). The detection phase is performed by addition of 50 RI europium (Eu)-labelled anti-phosphotyrosine antibody (e. g. Eu-PT66; final concentration 0.125 nM; Advant/Wallac) and 50 RI streptavidin-allophycocyanine (SA-APC; final concentration 40 nM) in detection buffer. After 1 hour incubation at room temperature fluorescence is measured, e. g. , on the Victor2 Multilabel Counter (Wallac) at 665 nm.

Background values (low control) are obtained in the absence of test samples and ATP and are subtracted from all values. Signals obtained in the absence of test samples are taken as 100% (high control). The inhibition obtained in the presence of test compounds was calculated as percent inhibition of the high control. The concentration of test compounds resulting in 50% inhibition (IC5o) was determined from the dose-response curves. In this assay, the compounds of the invention have IC50 values in the range of 10 nM to 2 pM, preferably from 10 nM to 100 nM.

Compound of Example 4 shows an IC50 value of 12 nM.

Syk Kinase assay : The activities of the agents of invention are determined in a heterogenous Syk kinase assay based on the dissociation-enhanced lanthanide fluoroimmunoassay (DELFIA) technology. This method utilizes europium chelate-labelled anti-phosphotyrosine antibodies to detect phosphate transfer by Syk to a polymeric glutamic acid-tyrosine (Glu, Tyr) substrate coated onto microtiter plates as described (Braunwalder AF, Yarwood DR, Sills MA, Lipson KE.

Measurement of the protein tyrosine kinase activity of c-src using time-resolved fluorometry of europium chelates. Anal. Biochem. 1996; 238 (2): 159-64). The amount of phosphorylation is then quantified with time-resolved, dissociation-enhanced fluorescence. Briefly, hundred pi of poly (Glu, Tyr) (4: 1; 2 ug/ml in phosphate-buffered saline, PBS) are coated to ELISA plates overnight at room temperature. The poly (Glu, Tyr) solution is removed and 250 pi of 1 % bovine serum albumin in PBS are added for one hour at room temperature. Plates are then washed three times with 350 ul of washing buffer (25 mM Tris-HCI, pH 7.4 containing 0.03% Tween-20). The kinase reaction is performed for one hour at room temperature by mixing serial dilutions of inhibitors in 30 pi with 30 pi of Syk kinase (20 ng/ml) and ATP (1 uM) in kinase buffer (20 mM Tris, pH 7.5, 10 RM Na3VO4, 1 mM DTT, 10 mM MnCiz, 2 mM MgCI2, 0. 01 % bovine serum albumin, 0.05 % Tween 20). After washing the plates four times as described above 60 pI DELFIA europium N1-labelled anti- phosphotyrosine antibody PY20 (Advant/Wallac) are added (100 ng/ml in 50 mM Tris-HCI, pH7.4, 150 mM NaCI, 20 uM Titriplex V, 0.2% bovine serum albumine, 0.05% Tween-20) and incubated for one hour at room temperature. Plates are washed eight times and 60 ut enhancement solution (Wallac) are added. Fluorescence is determined at 615 nm (Victor2; Wallac). High control values (100% signal) are obtained in absence of test samples and low control values (background) in absence of test samples and ATP. Low controls were subtracted from all values. The inhibition obtained in the presence of test compounds was calculated as percent inhibition of the high control. The concentration of test compounds resulting in 50% inhibition (IC50) was determined from the dose-response curves. In this assay, the compounds of the invention have IC50 values in the range of 100 nM to 10 pM, preferably from 100 to 1 uM.

Compound of Example 128 has an IC50 value of 150 nM.

2. Allogeneic Mixed Lymphocyte Reaction (MLR) Compounds of the invention exhibit T cell inhibiting activity. More particular the compounds of the invention prevent T cell activation and/or proliferation in e. g. aqueous solution, e. g. as demonstrated in accordance with the following test method. The two-way MLR is performed according to standard procedures (J. Immunol. Methods, 1973,2, 279 and Meo T. et al., Immunological Methods, New York, Academic Press, 1979,227-39). Briefly, spleen cells from CBA and BALB/c mice (1.6 x 105 cells from each strain per well in flat bottom tissue culture microtiter plates, 3.2 x 105 in total) are incubated in RPMI medium containing 10% FCS, 100 U/ml penicillin, 100 ug/ml streptomycin (Gibco BRL, Basel, Switzerland), 50 uM 2-mercaptoethanol (Fluka, Buchs, Switzerland) and serially diluted compounds. Seven three-fold dilution steps in duplicates per test compound are performed. After four days of incubation 1 uCi 3H-thymidine is added. Cells are harvested after an additional five-hour incubation period, and incorporated 3H-thymidine is determined according to standard procedures. Background values (low control) of the MLR are the proliferation of BALB/c cells alone. Low controls are subtracted from all values. High controls without any sample are taken as 100% proliferation. Percent inhibition by the samples is calculated, and the concentrations required for 50% inhibition (IC5o values) are determined. In this assay, the compounds of the invention have IC50 values in the range of 10 nM to 10 uM, preferably from 10 nM to 100 nM. Compound of Example 120 shows an IC50 value of 13 nM.

3. FAK assay All steps are performed in a 96-well black microtiter plate. Purified recombinant hexahistidine- tagged human FAK kinase domain is diluted with dilution buffer (50 mM HEPES, pH 7.5, 0.01% BSA, 0.05% Tween-20 in water) to a concentration of 94 ng/mL (2.5 nM). The reaction mixture is prepared by mixing 10 uL 5x kinase buffer (250 mM HEPES, pH 7.5, 50 uM Na3VO4, 5 mM DTT, 10 mM MgCI2, 50 mM MnCI2, 0.05% BSA, 0.25% Tween-20 in water), 20 uL water, 5 uL of 4 uM biotinylated peptide substrate (Biot-Y397) in aqueous solution, 5 uL of test compound in DMSO, and 5 uL of recombinant enzyme solution and incubated for 30 min at room temperature. The enzyme reaction is started by addition of 5 pL of 5 uM ATP in water and the mixture is incubated for 3 hours at 37°C. The reaction is terminated by addition of 200 pL of detection mixture (1 nM Eu-PT66,2. 5 ug/mL SA- (SL) APC, 6.25 mM EDTA in dilution buffer), and the FRET signal from europium to allophycocyanin is measured by ARVOsx+L (Perkin Elmer) after 30 min of incubation at room temperature. The ratio of fluorescence intensity of 665 nm to 615 nm is used as a FRET signal for data analysis in order to cancel the colour quenching effect by a test compound. The results are determined as percent inhibition of enzyme activity.

DMSO and 0.5 M EDTA are used as a control of 0% and 100% inhibition, respectively. IC50 values are determined by non-linear curve fit analysis using the OriginPro 6.1 program (OriginLab). In this assay the compounds of formula I inhibit FAK activity at a IC50 < 1 uM.

Examples 188, 208 and 213 show IC50 values of 15 nM, 1 nM and 7 nM respectively.

The Biot-Y397 peptide (Biotin-SETDDYAEIID ammonium salt, SEQ ID NO : 2) is designed to have the same amino acid sequence as the region from S392 to D402 of human (GenBank Accession Number L13616) and is prepared by standard methods.

Purified recombinant hexahistidine-tagged human FAK kinase domain is obtained in the following way: Full-length human FAK cDNA is isolated by PCR amplification from human placenta Marathon-Ready cDNA (Clontech, No. 7411-1) with the 5'PCR primer (ATGGCAGCTGCTTACCTTGAC, SEQ ID NO : 3) and the 3'PCR primer (TCAGTGTGGTCTCGTCTGCCC, SEQ ID NO : 4) and subcloned into a pGEM-T vector (Promega, No. A3600). After digestion with Accill, the purified DNA fragment is treated with Klenow fragment. The cDNA fragment is digested with BamHl and cloned into pFastBacHTb plasmid (Invitrogen Japan K. K. , Tokyo) previously cut with BamHl and Stu I. The resultant plasmid, hFAK KD (M384-G706) /pFastBacHTb, is sequenced to confirm its structure. The resulting DNA encodes a 364 amino acid protein containing a hexahistidine tag, a spacer region and a rTEV protease cleavage site at the N-terminal and the kinase domain of FAK (Met384- Gly706) from position 29 to 351.

Donor plasmid is transposed into the baculovirus genome, using MaxEfficacy DHlOBac Ecoli cells. Bacmid DNA is prepared by a simple alkaline lysis protocol described in the Bac-to-Bac2 Baculovirus Expression system (Invitrogen). Sf9 insect cells are transfected based on the protocol provided by the vendor (CellFECTIN#, Invitrogen). The expression of FAK in each lysate is analysed by SDS-PAGE and Western blotting with anti-human FAK monoclonal antibody (clone &num 77 from Transduction Laboratories).

The virus clone that shows the highest expression is further amplified by infection to Sf9 cells.

Expression in ExpresSF+# cells (Protein Sciences Corp. , Meriden, Connecticut, USA) gives high level of protein with little degradation. Cell lysates are loaded onto a column of HiTrapT"" Cheating Sepharose HP (Amersham Biosciences) charged with nickel sulfate and equilibrated with 50 mM HEPES pH 7.5, 0.5 M NaCI and 10 mM imidazole. Captured protein is eluted with increasing amounts of imidazole in HEPES buffer/NaCI, and further purified by dialysis in 50 mM HEPES pH 7.5, 10% glycerol and 1 mM DTT.

4. Phosphorylation levels of FAK Phosphorylation levels of FAK at Tyr397 are quantified by the sandwich ELISA. Mouse mammary carcinoma 4T1 cells (1 x 105) are plated in wells of 96-well culture plates and incubated with or without various concentrations of a compound of formula I for 1 h in Dulbecco's modified eagle medium containing 10% FBS. The medium is removed and cells are lysed in 200 iL 50 mM Tris-HCI, pH 7.4, containing 1 % NP-40,0. 25% sodium deoxycholate, 150 mM NaCI, 1 mM EDTA, 1 mM PMSF, 1 mM Na3VO4, 1 mM NaF, 1 ug/mL aprotinin, 1 µg/mL leupeptin and 1, ug/mL pepstatin. After centrifugation, the supernatants are subjected to a sandwich ELISA to quantify the phosphorylated FAK and total FAK. Cell lysates are applied to 96-well flat-bottom ELISA plates which have been pre-coated with 100 uUwell of 4 gg/mL mouse monoclonal anti-FAK antibody (clone 77, Becton Dickinson Transduction Laboratories) in 50 mM Tris-HCI, pH 9.5, containing 150 mM NaCI for 18 h at 4°C and blocked with 300 RL of BlockAce (Dainippon Pharmaceuticals Co. ) diluted at 1: 4 with H20 at room temperature for 2 h.

After washing with TBSN (20 mM Tris-HCI, pH 8.3, containing 300 mM NaCI, 0.1% SDS and 0.05% NP-40), total FAK is detected with 100 uL of 1 ug/ml anti-FAK polyclonal antibody (#65- 6140, Upstate Biology Inc.), and phosphorylated FAK is detected with 100 µL of 0.25 gg/gL anti- phosphorylated FAK (Y397) antibody (Affinity BioReagents, &num OPA1-03071) in BlockAce diluted at 1: 10 with H20. After 1 h incubation at room temperature, plates are washed with TBSN and 100 uL of biotinylated anti-rabbit IgG (&num 65-6140, Zymed Laboratolies Inc.) diluted at 1: 2000 with BlockAce diluted at 1: 10 with HzO is incubated at room temperature for 1 h. After washing with TBSN, ABTS solution substrate kit (#00-2011, Zymed Lobolatories Inc.) is used for color development. Absorbance at 405 nm is measured after 20 min incubation at room temparature.

The concentration of compound causing 50% reduction of phosphorylation level of FAK (IC5o) is determined. In this assay, compounds of formula I reduce phosphorylation at an IC50 of < 1 uM.

Examples 190,198 and 210 show Ego values of 0.44 uM, 0.043 uM and 0. 01 uM respectively.

5. Anchorage-independent tumor cell growth assay Mouse mammary carcinoma 4T1 cells (5 x 103) are plated in 96-well Ultra low Attachment plates (#3474, Corning Inc.) in 100 gL of Dulbecco's modified eagle medium containing 10% FBS.

Cells are cultured for 2 h and inhibitors are added at various concentrations in a final concentration of 0. 1% DMSO. After 48 h, cell growth is assayed with the cell counting kit-8 (Wako Pure Chemical), which uses a water soluble tetrazolium salt WST8. Twenty iL of the reagent is added into each well and cells are further cultured for 2 h. The optical density is measured at 450 nm. The concentration of compound causing 50 % inhibition of growth may thus be determined. Examples 204,213 and 206 show ICro values of 0. 4 uM, 0. 016 uM and 0. 09 uM respectively.

The compounds of the invention are therefore useful in the prevention or treatment of disorders or diseases where ZAP-70 inhibition, and/or Syk inhibition play a role, e. g. diseases or disorders mediated by T lymphocytes, B lymphocytes, mast cells and/or eosinophils e. g. acute or chronic rejection of organ or tissue allo-or xenografts, atheriosclerosis, vascular occlusion due to vacular injury such as angioplasty, restenosis, hypertension, heart failure, chronic obstructive pulmonary disease, CNS disease such as Alzheimer disease or amyotrophic lateral sclerosis, cancer, infectious disease such as AIDS, septic shock or adult respiratory distress syndrome, ischemia/reperfusion injury e. g. myocardial infarction, stroke, gut ischemia, renal ailure or hermorrhage shock, or traumatic shock. The agent of the invention are also useful in the treatment and/or prevention of acute or chronic inflammatory diseases or disorders or autoimmune diseases e. g. rheumatoid arthritis, osteoarthritis, systemic lupus erythematosus, Hashimoto's thyroidis, multiple sclerosis, myasthenia gravis, diabetes (type I and 11) and the disorders associated with therewith, respiratory diseases such as asthma or inflammatory liver injury, inflammatory glomerular injury, cutaneous manifestations of immunologically-mediated disorders or illnesses, inflammatory and hyperproliferative skin diseases (such as psoriasis, atopic dermatitis, allergic contact dermatitis, irritant contact dermatitis and further eczematous dermatitises, seborrhoeic dermatitis), inflammatory eye diseases, e. g. Sjoegren's syndrome, keratoconjunctivitis or uveitis, inflammatory bowel disease, Crohn's disease or ulcerative colitis.

Compounds of the invention are also useful in the prevention or treatment of conditions caused by a malfunction of signal cascades connected with FAK, e. g. tumors, for example brain and other central nervous system tumors (eg. tumors of the meninges, brain, spinal cord, cranial nerves and other parts of central nervous system, e. g. glioblastomas or medulla blastomas) ; head and/or neck cancer; breast tumors; circulatory system tumors (e. g. heart, mediastinum and pleura, and other intrathoracic organs, vascular tumors and tumor-associated vascular tissue); excretory system tumors (e. g. kidney, renal pelvis, ureter, bladder, other and unspecified urinary organs); gastrointestinal tract tumors (e. g. oesophagus, stomach, small intestine, colon, colorectal, rectosigmoid junction, rectum, anus and anal canal), tumors involving the liver and intrahepatic bile ducts, gall bladder, other and unspecified parts of biliary tract, pancreas, other and digestive organs); head and neck; oral cavity (lip, tongue, gum, floor of mouth, palate, and other parts of mouth, parotid gland, and other parts of the salivary glands, tonsil, oropharynx, nasopharynx, pyriform sinus, hypopharynx, and other sites in the lip, oral cavity and pharynx); reproductive system tumors (e. g. vulva, vagina, Cervix uteri, Corpus uteri, uterus, ovary, and other sites associated with female genital organs, placenta, penis, prostate, testis, and other sites associated with male genital organs); respiratory tract tumors (e. g. nasal cavity and middle ear, accessory sinuses, larynx, trachea, bronchus and lung, e. g. small cell lung cancer or non-small cell lung cancer); skeletal system tumors (e. g. bone and articular cartilage of limbs, bone articular cartilage and other sites); skin tumors (e. g. malignant melanoma of the skin, non-melanoma skin cancer, basal cell carcinoma of skin, squamous cell carcinoma of skin, mesothelioma, Kapos's sarcoma); and tumors involving other tissues incluing peripheral nerves and autonomic nervous system, connective and soft tissue, retroperitoneum and peritoneum, eye and adnexa, thyroid, adrenal gland and other endocrine glands and related structures, secondary and unspecified malignant neoplasm of lymph nodes, secondary malignant neoplasm of respiratory and digestive systems and secondary malignant neoplasm of other sites, tumors of blood and lymphatic system (e. g.

Hodgkin's disease, Non-Hodgkin's lymphom, Burkitt's lymphom, AIDS-related lymphomas, malignant immunoproliferative diseases, multiple myeloma and malignant plasma cell neoplasms, lymphoid leukemia, acute or chronic myeloid leukemia, acute or chronic lymphocytic leukemia, monocytic leukemia, other leukemias of specified cell type, leukemia of unspecified cell type, other and unspecified malignant neoplasms of lymphoid, haematopoietic and related tissues, for example diffuse large cell lymphom, T-cell lymphoma or cutaneous T-cell lymphoma). Myeloid cancer includes e. g. acute or chronic myeloid leukaemia.

Where hereinbefore and subsequently a tumor, a tumor disease, a carcinoma or a cancer is mentioned, also metastasis in the original organ or tissue and/or in any other location are implied alternatively or in addition, whatever the location of the tumor and/or metastasis is.

The compositions of the invention may be administered by any conventional route, in particular parenterally, for example in the form of injectable solutions or suspensions, enterally, e. g. orally, for example in the form of tablets or capsules, topically, e. g. in the form of lotions, gels, ointments or creams, or in a nasal or a suppository form. Pharmaceutical compositions comprising an agent of the invention in association with at least one pharmaceutical acceptable carrier or diluent may be manufactured in conventional manner by mixing with a pharmaceutical acceptable carrier or diluent. Unit dosage forms for oral administration contain, for example, from about 0.1 mg to about 500 mg of active substance. Topical administration is e. g. to the skin. A further form of topical administration is to the eye.

The compounds of formula I may be administered in free form or in pharmaceutically acceptable salt form, e. g. as indicated above. Such salts may be prepared in conventional manner and exhibit the same order of activity as the free compounds.

In accordance with the foregoing, the present invention also provides: (1) A compound of formula I or a pharmaceutical acceptable salt thereof, for use as a pharmaceutical ; (2) A compound of formula I or a pharmaceutical acceptable salt thereof, for use as a ZAP-70, FAK and/or Syk tyrosine kinase inhibitor, for example for use in any of the particular indications hereinbefore set forth; (3) A pharmaceutical composition, e. g. for use in any of the indications herein before set forth, comprising a compound of formula I or a pharmaceutical acceptable salt thereof, together with one or more pharmaceutical acceptable diluents or carriers therefor.

(4) A method for the treatment of any of particular indication hereinbefore set forth in a subject in need thereof which comprises administering an effective amount of a compound of formula I or a pharmaceutically acceptable salt thereof; (5) The use of a compound of formula I or a pharmaceutically acceptable salt thereof, for the manufacture of a medicament for the treatment or prevention of a disease or condition in which ZAP-70, FAK and/or Syk tyrosine kinase activation plays a role or is implicated ; e. g. as discussed above.

Compounds of the invention may be administered as the sole active ingredient or together with other drugs useful against neoplastic diseases, inflammatory disorders or in immunomodulating regimens. For example, the compounds of the invention may be used in combination with an active agent effective in various diseases as described above, e. g. with cyclosporins, rapamycins or ascomycins, or their immunosuppressive analogs or derivatives, e. g. cyclosporin A, cyclosporin G, sa tx247, FK-506, sirolimus or everolimus ; CCI-779, ABT578, AP23573, corticosteroids e. g. prednisone; cyclophosphamide ; azathioprene; methotrexate; gold salts, sulfasalazine, antimalarials ; leflunomide ; mizoribine; mycophenolic acid; mycophenolate mofetil ; 15-deoxyspergualine ; an EDG receptor agonist having accelerating lymphocyte homing activity, e. g FTY720 or an analogue thereof, immuno-suppressive monoclonal antibodies, e. g. monoclonal antibodies to leukocyte receptors, e. g. MHC, CD2, CD3, CD4, CD7, CD25, CD28, CD40, CD45, CD58, CD80, CD86, CD152, CD137, CD154, ICOS, LFA-1, VLA-4 or their ligands ; or other immunomodulatory compounds, e. g. CTLA41g.

A compound of formula I may also be used to advantage in combination with other antiproliferative agents. Such antiproliferative agents include, but are not limited to aromatase inhibitors, antiestrogens, topoisomerase I inhibitors, topoisomerase 11 inhibitors, microtubule active agents, alkylating agents, histone deacetylase inhibitors, farnesyl transferase inhibitors, COX-2 inhibitors, MMP inhibitors, mTOR inhibitors, antineoplastic antimetabolites, platin compounds, compounds decreasing the protein kinase activity and further anti-angiogenic compounds, gonadorelin agonists, anti-androgens, bengamides, bisphosphonates, antiproliferative antibodies and temozolomide (TEMODALO).

The term"aromatase inhibitors"as used herein relates to compounds which inhibit the estrogen production, i. e. the conversion of the substrates androstenedione and testosterone to estrone and estradiol, respectively. The term includes, but is not limited to steroids, especially exemestane and formestane and, in particular, non-steroids, especially aminoglutethimide, vorozole, fadrozole, anastrozole and, very especially, letrozole. A combination of the invention comprising an antineoplastic agent which is an aromatase inhibitor may particularly be useful for the treatment of hormone receptor positive breast tumors.

The term"antiestrogens"as used herein relates to compounds which antagonize the effect of estrogens at the estrogen receptor level. The term includes, but is not limited to tamoxifen, fulvestrant, raloxifene and raloxifene hydrochloride.

The term"topoisomerase I inhibitors"as used herein includes, but is not limited to topotecan, irinotecan, 9-nitrocamptothecin and the macromolecular camptothecin conjugate PNU-166148 (compound A1 in W099/17804).

The term"topoisomerase 11 inhibitors"as used herein includes, but is not limited to the antracyclines doxorubicin (including liposomal formulation, e. g. CAELYXM), epirubicin, idarubicin and nemorubicin, the anthraquinones mitoxantrone and losoxantrone, and the podophillotoxines etoposide and teniposide.

The term"microtubule active agents"relates to microtubule stabilizing and microtubule destabilizing agents including, but not limited to the taxanes paclitaxel and docetaxel, the vinca alkaloid, e. g., vinblastine, especially vinblastine sulfate, vincristine especially vincristine sulfate, and vinorelbine, discodermolide and epothilones, such as epothilone B and D.

The term"alkylating agents"as used herein includes, but is not limited to cyclophosphamide, ifosfamide and melphalan.

The term"histone deacetylase inhibitors"relates to compounds which inhibit the histone deacetylase and which possess antiproliferative activity.

The term"farnesyl transferase inhibitors"relates to compounds which inhibit the farnesyl transferase and which possess antiproliferative activity.

The term"COX-2 inhibitors"relates to compounds which inhibit the cyclooxygenase type 2 enyzme (COX-2) and which possess antiproliferative activity such as celecoxib (Celebrex@), rofecoxib (Vioxx (D) and lumiracoxib (COX189).

The term"MMP inhibitors"relates to compounds which inhibit the matrix metalloproteinase (MMP) and which possess antiproliferative activity.

The term"antineoplastic antimetabolites"includes, but is not limited to 5-fluorouracil, tegafur, capecitabine, cladribine, cytarabine, fludarabine phosphate, fluorouridine, gemcitabine, 6- mercaptopurine, hydroxyurea, methotrexate, edatrexate and salts of such compounds, and furthermore ZD 1694 (RALTITREXEDT""), LY231514 (ALITA), LY264618 (LOMOTREXOL) and OGT719.

The term"platin compounds"as used herein includes, but is not limited to carboplatin, cis-platin and oxaliplatin.

The term"compounds decreasing the protein kinase activity and further anti-angiogenic compounds"as used herein includes, but is not limited to compounds which decrease the activity of e. g. the Vascular Endothelial Growth Factor (VEGF), the Epidermal Growth Factor (EGF), c-Src, protein kinase C, Platelet-derived Growth Factor (PDGF), Bcr-Abl tyrosine kinase, c-kit, Flt-3 and Insulin-like Growth Factor I Receptor (IGF-IR) and Cyclin-dependent kinases (CDKs), and anti-angiogenic compounds having another mechanism of action than decreasing the protein kinase activity.

Compounds which decrease the activity of VEGF are especially compounds which inhibit the VEGF receptor, especially the tyrosine kinase activity of the VEGF receptor, and compounds binding to VEGF, and are in particular those compounds, proteins and monoclonal antibodies generically and specifically disclosed in WO 98/35958 (describing compounds of formula 1), WO 00/09495, WO 00/27820, WO 00/59509, WO 98/11223, WO 00/27819, WO 01/55114, WO 01/58899 and EP 0 769 947; those as described by M. Prewett et al in Cancer Research 59 (1999) 5209-5218, by F. Yuan et al in Proc. Natl. Acad. Sci. USA, vol. 93, pp. 14765-14770, December 1996, by Z. Zhu et al in Cancer Res. 58,1998, 3209-3214, and by J. Mordenti et al in Toxicologic Pathology, vol. 27, no. 1, pp 14-21,1999 ; in WO 00/37502 and WO 94/10202; AngiostatinT"", described by M. S. O'Reilly et al, Cell 79,1994, 315-328; and Endostatin TM described by M. S. O'Reilly et al, Cell 88,1997, 277-285; compounds which decrease the activity of EGF are especially compounds which inhibit the EGF receptor, especially the tyrosine kinase activity of the EGF receptor, and compounds binding to EGF, and are in particular those compounds generically and specifically disclosed in WO 97/02266 (describing compounds of formula IV), EP 0 564 409, WO 99/03854, EP 0520722, EP 0 566 226, EP 0 787 722, EP 0 837 063, WO 98/10767, WO 97/30034, WO 97/49688, WO 97/38983 and, especially, WO 96/33980; compounds which decrease the activity of c-Src include, but are not limited to, compounds inhibiting the c-Src protein tyrosine kinase activity as defined below and to SH2 interaction inhibitors such as those disclosed in W097/07131 and W097/08193 ; compounds inhibiting the c-Src protein tyrosine kinase activity include, but are not limited to, compounds belonging to the structure classes of pyrrolopyrimidines, especially pyrrolo [2,3- d] pyrimidines, purines, pyrazopyrimidines, especially pyrazo [3,4-d] pyrimidines, pyrazopyrimidines, especially pyrazo [3,4-d] pyrimidines and pyridopyrimidines, especially pyrido [2,3-d] pyrimidines. Preferably, the term relates to those compounds disclosed in WO 96/10028, WO 97/28161, W097/32879 and W097/49706; compounds which decreases the activity of the protein kinase C are especially those staurosporine derivatives disclosed in EP 0 296 110 (pharmaceutical preparation described in WO 00/48571) which compounds are protein kinase C inhibitors; further specific compounds that decrease protein kinase activity and which may also be used in combination with the compounds of the present invention are Imatinib (Gleevec@/Glivec@), PKC412, tressas (ZD1839), PKI166, PTK787, ZD6474, GW2016, CHIR-200131, CEP- 7055/CEP-5214, CP-547632 and KRN-633 ; anti-angiogenic compounds having another mechanism of action than decreasing the protein kinase activity include, but are not limited to e. g. thalidomide (THALOMID), celecoxib (Celebrex), SU5416 and ZD6126.

The term"gonadorelin agonist"as used herein includes, but is not limited to abarelix, goserelin and goserelin acetate. Goserelin is disclosed in US 4,100, 274.

The term"anti-androgens"as used herein includes, but is not limited to bicalutamide (CASODEXTM), which can be formulated, e. g. as disclosed in US 4,636, 505.

The term"bengamides"relates to bengamides and derivatives thereof having aniproliferative properties.

The term"bisphosphonates"as used herein includes, but is not limited to etridonic acid, clodronic acid, tiludronic acid, pamidronic acid, alendronic acid, ibandronic acid, risedronic acid and zoledronic acid.

The term"antiproliferative antibodies"as used herein includes, but is not limited to trastuzumab (HerceptinTM), Trastuzumab-DM1, erlotinib (Tarcevam), bevacizumab (AvastinTM), rituximab (Rituxan@), PR064553 (anti-CD40) and 2C4 Antibody.

The structure of the active agents identified by code nos. , generic or trade names may be taken from the actual edition of the standard compendium"The Merck Index"or from databases, e. g.

Patents International (e. g. IMS World Publications).

In accordance with the foregoing the present invention provides in a yet further aspect: (6) A method as defined above comprising co-administration, e. g. concomitantly or in sequence, of a therapeutically effective amount of a) a compound of formula I or a pharmaceutically acceptable salt thereof, and b) a second drug substance, said second drug substance being for example for use in any of the particular indications hereinbefore set forth.

(7) A combination comprising a therapeutically effective amount of a ZAP-70, FAK and/or Syk tyrosine kinase inhibitor, e. g. a compound of formula I or a pharmaceutical acceptable salt thereof, and a second drug substance, said second drug substance being for example as disclosed above.

Where a ZAP-70, FAK and/or Syk tyrosine kinase inhibitor, e. g. a compound of formula 1, is administered in conjunction with other immunosuppressive/immunomodulatory, anti-inflammatory or antineoplastic agent, e. g. as disclosed above, dosages of the co-administered drug or agent will of course vary depending on the type of co-drug or-agent employed, or the specific drug or agent used, or the condition being treated and so forth.

Representative FAK inhibitors are the compounds of Examples Nos. 187-203 and 209-212.