BACKGROUND OF THE INVENTION Many immunologically-mediated clinical diseases including autoimmune diseases, allergic diseases, and infectious diseases are reported to be highly relevant to the ratio of CD4+ T helper cell type 1 (Thl) to CD4+ T helper cell type 2 (Th2) (Heinzel, F. P., et al., (1989) J. Exp. Med. 169: 59-72; Pearce, E. J., et al. (1991) J.

Exp. Med. 173: 159-166; Shearer, G. M. and Clerici, M. (1992) Prog. Chem.

Immunol. 54: 21-43). To alter or regulate the ratios of Thl and Th 2 cells, therefore, may give a clue to treat or prevent immunologically-mediated diseases.

The mechanisms by which the Thl and Th 2 ratio is determined involve the differentiation of CD4 T helper precursor cells (Thp) to choose to become Thl or Th 2 effector cells. The differentiation is partly regulated by cytokines, such as IL-2, IL- 4, and IL-12, whose expression can be induced by transcription factors, some of the most important of which are proteins of the NFAT (Nuclear Factor of Activated T cells) family. NFAT proteins are expressed in most immune cell types and play an important role in the transcription of many cytokines, such as IL-2, IL-3, IL-4, IL-5, IL-13, GM-CSF, IFN-y, and TNF-a, as well as several other genes involved in immune cell responses. To increase or decrease the level of selected cytokines is one way to regulate Thl to Th2 ratio.

Recently, a protein of 45 kDa derived from murine tissue that interacts with members of the NFAT family of proteins has been isolated and termed NIP45 (Hodge MR, Chun HJ, Rengarajan J, Alt A, Lieberson R, Glimcher LH. NF-AT-Driven interleukin-4 transcription potentiated by NIP45. Science, 1996 Dec 13 ; 274 (5294): 1903-5 ; Hodge MR et al., WO 97/39721, USP 5,858,711, and USP 5,958,671).

Further, WO 99/21993 discloses human NIP45 polypeptide and polynucleotide sequences.

NIP45 has been shown to interact with NFATp and to potentiate the transcription of the IL-4 gene induced by the binding of NFATp to the IL-4 gene promoter. The nature of this interaction is unclear, but one possibility is that NIP45 is an accessory protein that is involved in the transport of NFATp from the cytoplasm into the nucleus where it can bind to the IL-4 gene promoter. In the absence of such an accessory protein, NFATp may be inactive because of its inability to cross through the nuclear membrane on its own. Experiments with NFATp knockout mice have shown that NFATp deficiency leads to the accumulation of peripheral T cells with a preactivated phenotype, enhanced immune responses of T cells after secondary stimulation in vitro, and severe defects in the proper termination of antigen responses (Schuh, K. et al. (1998) Eur. J. Immunol. 28 (8) : 2456-66). In some of these mice, large germinal centers develop in the spleen and peripheral lymph nodes and there is a pronounced retardation in the involution of the thymus.

There is a need in the art to identify additional members of the NFAT interacting protein variant whose activity can be regulated to provide therapeutic effects, particularly for diseases and conditions involving immunologically-mediated responses.

SUMMARY OF THE INVENTION It is an object of the invention to provide reagents and methods of regulating NF-AT interacting proteins. This and others objects of the invention are provided by one or more of the embodiments described below.

One embodiment of the invention is a NIP45V polypeptide comprising an amino acid sequence selected from the group consisting of : amino acid sequences which are at least about 85% identical to the amino acid sequence shown in SEQ ID NO: 8 ; the amino acid sequence shown in SEQ ID NO: 8; amino acid sequences which are at least about 99% identical to the amino acid sequence shown in SEQ ID NO: 9; the amino acid sequence shown in SEQ ID NO: 9; amino acid sequences which are at least about 96% identical to the amino acid sequence shown in SEQ ID NO: 10; the amino acid sequence shown in SEQ ID NO: 10; amino acid sequences which are at least about 95% identical to the amino acid sequence shown in SEQ ID NO: 11; and the amino acid sequence shown in SEQ ID NO: 11.

Yet another embodiment of the invention is a method of screening for agents which decrease the activity of NIP45V. A test compound is contacted with a NIP45V

polypeptide comprising an amino acid sequence selected from the group consisting of : amino acid sequences which are at least about 85% identical to the amino acid sequence shown in SEQ ID NO: 8; the amino acid sequence shown in SEQ ID NO: 8 ; amino acid sequences which are at least about 99% identical to the amino acid sequence shown in SEQ ID NO: 9; the amino acid sequence shown in SEQ ID NO: 9; amino acid sequences which are at least about 96% identical to the amino acid sequence shown in SEQ ID NO: 10; the amino acid sequence shown in SEQ ID NO: 10; amino acid sequences which are at least about 95% identical to the amino acid sequence shown in SEQ ID NO: 11; and the amino acid sequence shown in SEQ ID NO: 11.

Binding between the test compound and the NIP45V polypeptide is detected. A test compound which binds to the NIP45V polypeptide is thereby identified as a potential agent for decreasing the activity of NIP45V.

Another embodiment of the invention is a method of screening for agents which decrease the activity of NIP45V. A test compound is contacted with a polynucleotide encoding a NIP45V polypeptide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of :

nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1 ; the nucleotide sequence shown in SEQ ID NO. 1; nucleotide sequences which are at least about 85% identical to the nucleotide sequence shown in SEQ ID NO. 2; the nucleotide sequence shown in SEQ ID NO. 2; nucleotide sequences which are at least about 99% identical to the nucleotide sequence shown in SEQ ID NO. 3; the nucleotide sequence shown in SEQ ID NO. 3 ; nucleotide sequences which are at least about 96% identical to the nucleotide sequence shown in SEQ ID NO. 4; the nucleotide sequence shown in SEQ ID NO. 4; nucleotide sequences which are at least about 95% identical to the nucleotide sequence shown in SEQ ID NO. 5; and the nucleotide sequence shown in SEQ ID NO. 5.

Binding of the test compound to the polynucleotide is detected. A test compound which binds to the polynucleotide is identified as a potential agent for decreasing the activity of NIP45V. The agent can work by decreasing the amount of the NIP45V through interacting with the NIP45V mRNA.

Another embodiment of the invention is a method of screening for agents which regulate the activity of NIP45V. A test compound is contacted with a NIP45V polypeptide comprising an amino acid sequence selected from the group consisting of : amino acid sequences which are at least about 85% identical to the amino acid sequence shown in SEQ ID NO: 8; the amino acid sequence shown in SEQ ID NO: 8; amino acid sequences which are at least about 99% identical to the amino acid sequence shown in SEQ ID NO: 9; the amino acid sequence shown in SEQ ID NO: 9; amino acid sequences which are at least about 96% identical to the amino acid sequence shown in SEQ ID NO: 10; the amino acid sequence shown in SEQ ID NO: 10; amino acid sequences which are at least about 95% identical to the amino acid sequence shown in SEQ ID NO: 11; and the amino acid sequence shown in SEQ ID NO: 11.

A NIP45V activity of the polypeptide is detected. A test compound which increases NIP45V activity of the polypeptide relative to NIP45V activity in the absence of the test compound is thereby identified as a potential agent for increasing the activity of NIP45V. A test compound which decreases NIP45V activity of the polypeptide relative to NIP45V activity in the absence of the test compound is thereby identified as a potential agent for decreasing the activity of NIP45V.

Even another embodiment of the invention is a method of screening for agents which decrease the activity of NIP45V. A test compound is contacted with a NIP45V product of a polynucleotide which comprises a nucleotide sequence selected from the group consisting of : nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1; the nucleotide sequence shown in SEQ ID NO. 1; nucleotide sequences which are at least about 85% identical to the nucleotide sequence shown in SEQ ID NO. 2; the nucleotide sequence shown in SEQ ID NO. 2; nucleotide sequences which are at least about 99% identical to the nucleotide sequence shown in SEQ ID NO. 3; the nucleotide sequence shown in SEQ ID N0. 3 ; nucleotide sequences which are at least about 96% identical to the nucleotide sequence shown in SEQ ID NO. 4; the nucleotide sequence shown in SEQ ID NO. 4; nucleotide sequences which are at least about 95% identical to the nucleotide sequence shown in SEQ ID NO. 5; and the nucleotide sequence shown in SEQ ID NO. 5.

Binding of the test compound to the NIP45V product is detected. A test compound which binds to the NIP45V product is thereby identified as a potential agent for decreasing the activity of NIP45V.

Still another embodiment of the invention is a method of reducing the activity of NIP45V. A cell is contacted with a reagent which specifically binds to a poly- nucleotide encoding a NIP45V polypeptide or the product encoded by the poly- nucleotide, wherein the polynucleotide comprises a nucleotide sequence selected from the group consisting of : nucleotide sequences which are at least about 50% identical to the nucleotide sequence shown in SEQ ID NO. 1; the nucleotide sequence shown in SEQ ID NO. 1 ; nucleotide sequences which are at least about 85% identical to the nucleotide sequence shown in SEQ ID NO. 2; the nucleotide sequence shown in SEQ ID NO. 2; nucleotide sequences which are at least about 99% identical to the nucleotide sequence shown in SEQ ID NO. 3; the nucleotide sequence shown in SEQ ID NO. 3; nucleotide sequences which are at least about 96% identical to the nucleotide sequence shown in SEQ ID NO. 4; the nucleotide sequence shown in SEQ ID NO. 4;

nucleotide sequences which are at least about 95% identical to the nucleotide sequence shown in SEQ ID NO. 5; and the nucleotide sequence shown in SEQ ID NO. 5.

NIP45V activity in the cell is thereby decreased.

BRIEF DESCRIPTION OF THE DRAWING Fig. 1 shows the DNA-sequence encoding a NIP45V1 polypeptide.

Fig. 2 shows the DNA-sequence (ORF) encoding a NIP45V1 polypeptide.

Fig. 3 shows the DNA-sequence encoding a NIP45V2 polypeptide.

Fig. 4 shows the DNA-sequence encoding a NIP45V3 polypeptide.

Fig. 5 shows the DNA-sequence encoding a NIP45V4 polypeptide.

Fig. 6 shows the DNA-sequence encoding NIP45.

Fig. 7 shows the DNA-sequence (ORF) encoding NIP45.

Fig. 8 shows the amino acid sequence deduced from the DNA-sequence of Fig. 2.

Fig. 9 shows the amino acid sequence deduced from the DNA-sequence of Fig. 3.

Fig. 10 shows the amino acid sequence deduced from the DNA-sequence of Fig. 4.

Fig. 11 shows the amino acid sequence deduced from the DNA-sequence of Fig. 5.

Fig. 12 shows the amino acid sequence deduced from the DNA-sequence of Fig. 6.

Fig. 13 shows PCR amplified bands of NIP45 and NIP45V in various immune related tissues.

Fig. 14 shows the alignment of NIP 45 V (v 1,2,3, and 4 proteins) and NIP 45.

DETAILED DESCRIPTION OF THE INVENTION The invention relates to an isolated polynucleotide encoding a NIP45V polypeptide and being selected from the group consisting of : a) a polynucleotide encoding a NIP45V polypeptide comprising an amino acid sequence selected from the group consisting of : amino acid sequences which are at least about 85% identical to the amino acid sequence shown in SEQ ID NO: 8; the amino acid sequence shown in SEQ ID NO: 8; amino acid sequences which are at least about 99% identical to the amino acid sequence shown in SEQ ID NO: 9; the amino acid sequence shown in SEQ ID NO: 9; amino acid sequences which are at least about 96% identical to the amino acid sequence shown in SEQ ID NO: 10; the amino acid sequence shown in SEQ ID NO: 10; amino acid sequences which are at least about 95% identical to the amino acid sequence shown in SEQ ID NO: 11; and the amino acid sequence shown in SEQ ID NO: 11. b) a polynucleotide comprising the sequence of SEQ ID NOS. 1, 2,3,4 or 5;

c) a polynucleotide the sequence of which deviates from the polynucleotide sequences specified in (a) and (b) due to the degeneration of the genetic code; and d) a polynucleotide which represents a fragment, derivative or allelic variation of a polynucleotide sequence specified in (a) to (c).

Furthermore, it has been discovered by the present applicant that NIP 45 splice variant, particularly human NIP45 splice variant, activity can be regulated to control autoimmune diseases, allergic diseases, and infectious diseases, and other chronic inflammatory diseases. Such diseases include asthma, allergic rhinitis, atopic dermatitis, hives, conjunctivitis, vernal catarrh, chronic arthrorheumatism, systemic lupus erythematosus, myasthenia gravis, psoriasis, diabrotic colitis, systemic inflammatory response syndrome (SIRS), llymphofollicular thymitis, sepsis, polymyositis, dermatomyositis, polyaritis nodoa, mixed connective tissue disease (MCTD), Sjoegren's syndrome, gout, and the like.

NIP45 is known to interact with NFATp and to potentiate the transcription of the IL- 4 gene induced by the binding of NFATp to the IL-4 gene promoter. The nature of this interaction is unclear, but one possibility is that NIP45 is an accessory protein that is involved in the transport of NFATp from the cytoplasm into the nucleus where it can bind to the IL-4 gene promoter. In the absence of such an accessory protein, NFATp may be inactive because of its inability to cross through the nuclear membrane on its own. Experiments with NFATp knockout mice have shown that NFATp deficiency leads to the accumulation of peripheral T cells with a preactivated phenotype, enhanced immune responses of T cells after secondary stimulation in vitro, and severe defects in the proper termination of antigen responses. In some of these mice, large germinal centers develop in the spleen and peripheral lymph nodes and there is a pronounced retardation in the involution of the thymus.

The expression of a NIP45vl splice variant of NIP45 in the thymus, spleen, and

lymph nodes may play an important role in the normal formation of germinal centers in these lymphoid organs. The NIP45vl splice variant lacks a large portion of the full-length NIP45 protein, most significant of which are regions of homology to Ubiquitin and Sentrin molecules. Ubiquitins are involved in the regulated turnover of proteins required for controlling cell cycle progression. Sentrins are small ubiquitin- like proteins that are thought to be covalently attached to other proteins to mark them for transport into the nucleus. Lack of the Ubiqitin-homology domain and part of the Sentrin-homolgy domain may make NIP45vl ineffective at transporting NFATp into the nucleus (Kamitani, T. et al. (1997) J. Biol. Chem. 272 (22): 14001-4; Okura, T. et al. (1996) J. Immunol. 157 (10): 4277-81). Similarly, the deletion in NIP45vl may alter the interaction with NFATp so that the coexpression of NIP45vl and NFATp no longer has a synergistic effect on transcription via the IL-4 promoter. The effect, therefore, of NIP45vl in the cell may be to disable NFATp or to block the interaction between NIP45 and NFATp and thereby promote the formation of germinal centers, preactivate T cells, enhance secondary immune responses, and delay termination of antigen responses.

On the other hand, the deletion in NIP45vl may bring together two parts of the NIP45 molecule to enhance the function of NIP45vl in such a way that its interaction with NFATp has a greater enhancing effect on IL-4 transcription than that of the full- length NIP45.

The increased formation of germinal centers in the thymus is a property of human patients with lymphofollicular thymitis and is often connected with the development of autoimmune diseases such as myasthenia gravis (Muller-Hermelink, H. K., Marx, A. Kirchner, T. Thymus and mediastinum. In Damjanov, I, Linder, J (eds.), Mosby- Year Book. Mosby, St. Louis 1996, pp. 1218-43). Additionally, NFATp deficient mice exhibit a strong tendency toward the development of Th2 type immune responses, with paradoxically strong enhancement of the transcription of several Th2 type genes, including IL-4, IL-5, and IL-13 (Kiani, A. et al. (1997) Immunity 7 (6): 849-60). This preferential development of Th2 type immune responses may lead to

overactive allergic responses and Th2-dependent autoimmune diseases and other disorders.

NIP45v2 has a deletion that removes almost entirely both the Ubiquitin-and Sentrin- homolgy domains from the molecule. Its function is expected to be similar to that of NIP45vl, except that since the Sentrin-homology domain is entirely deleted, NIP45v2 will lack any Sentrin-like function and therefore may be more effective at blocking the transport of NFATp into the nucleus.

NIP45v3 differs from the full-length NIP45 only in its N-terminal sequence. The deleted region of the molecule may be important in the specific binding of NIP45 to NFATp, and therefore, NIP45v3 may bind with less affinity to NFATp or bind instead to other NFAT family members.

NIP45v4 contains only the Sentrin-homology domain of NIP45, and similar to NIP45v3, may have decreased specificity for NFATp while retaining Sentrin-like function.

The four NIP45 alternative splice variants can be used as targets to develop selective inhibitors or activators directed against each of the variants.

NIP45 VPolypeptides NIP45V polypeptides according to the present invention comprise the amino acid sequence shown in any of SEQ ID NO. 8 (NIP 45 vl), SEQ ID NO. 9 (NIP 45 v2), SEQ ID NO. 10 (NIP 45 v3), or SEQ ID NO. 11 (NIP 45 v4), a portion of that sequence, or a biologically active variant of that amino acid sequence, as defined below. An NIP45 V polypeptide of the invention therefore can be a portion of an NIP45 V, a full-length NIP45 V, or a fusion protein comprising all or a portion of an NIP45 V.

Biologically Active Variants Preferably, naturally or non-naturally occurring variants for NIP45 V of the present invention have amino acid sequences which are at least about 85, preferably about 95,96, or 99% identical to the complete, continuous amino acid sequence shown in any of SEQ ID NO. 8 to 11. Percent identity between a putative NIP45 V variant and an amino acid sequence of SEQ ID NO. 8 to 11 is determined using the Blast2 alignment program.

Variations in percent identity can be due, for example, to amino acid substitutions, insertions, or deletions. Amino acid substitutions are defined as one for one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine.

Amino acid insertions or deletions are changes to or within an amino acid sequence.

They typically fall in the range of about 1 to 5 amino acids. Guidance in determining which amino acid residues can be substituted, inserted, or deleted without abolishing biological or immunological activity of an NIP 45 V polypeptide can be found using computer programs well known in the art, such as DNASTAR software. Whether an amino acid change results in a biologically active NIP45 variant polypeptide can readily be determined by assaying for NIP 45 V polypeptide activity, as described, for example, in the specific examples, below.

Fusion Proteins Fusion proteins can comprise at least 5,6,8,10,25, or 50 or more contiguous amino acids of an amino acid sequence shown in any of SEQ ID NO. 8 to 11. Fusion proteins are useful for generating antibodies against NIP45 V polypeptide amino acid sequences and for use in various assay systems. For example, fusion proteins can be used to identify proteins which interact with portions of an NIP 45 V

polypeptide. Protein affinity chromatography or library-based assays for protein- protein interactions, such as the yeast two-hybrid or phage display systems, can be used for this purpose. Such methods are well known in the art and also can be used as drug screens.

An NIP 45 V polypeptide fusion protein comprises two polypeptide segments fused together by means of a peptide bond. The first polypeptide segment comprises at least 5,6,8,10,25, or 50 or more contiguous amino acids of any of SEQ ID NO. 8 to 11 or of a biologically active variant, such as those described above. The first polypeptide segment also can comprise full-length NIP45-variant.

The second polypeptide segment can be a full-length protein or a protein fragment.

Proteins commonly used in fusion protein construction include p-galactosidase, ß- glucuronidase, green fluorescent protein (GFP), autofluorescent proteins, including blue fluorescent protein (BFP), glutathione-S-transferase (GST), luciferase, horse- radish peroxidase (HRP), and chloramphenicol acetyltransferase (CAT). Addition- ally, epitope tags are used in fusion protein constructions, including histidine (His) tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Other fusion constructions can include maltose binding protein (MBP), S-tag, Lex a DNA binding domain (DBD) fusions, GAL4 DNA binding domain fusions, and herpes simplex virus (HSV) BP16 protein fusions. A fusion protein also can be engineered to contain a cleavage site located between the NIP 45 V polypeptide-encoding sequence and the heterologous protein sequence, so that the NIP 45 V polypeptide can be cleaved and purified away from the heterologous moiety.

A fusion protein can be synthesized chemically, as is known in the art. Preferably, a fusion protein is produced by covalently linking two polypeptide segments or by standard procedures in the art of molecular biology. Recombinant DNA methods can be used to prepare fusion proteins, for example, by making a DNA construct which

comprises coding sequences selected from the group consisting of SEQ ID NO. 1 to 5 in proper reading frame with nucleotides encoding the second polypeptide segment and expressing the DNA construct in a host cell, as is known in the art. Many kits for constructing fusion proteins are available from companies such as Promega Corporation (Madison, WI), Stratagene (La Jolla, CA), CLONTECH (Mountain View, CA), Santa Cruz Biotechnology (Santa Cruz, CA), MBL International Corporation (MIC ; Watertown, MA), and Quantum Biotechnologies (Montreal, Canada; 1-888-DNA-KITS).

Identification of Species Homologs Species homologs of the NIP 45 V polypeptide can be obtained using NIP 45 V polypeptide polynucleotides (described below) to make suitable probes or primers for screening cDNA expression libraries from other species, such as mice, monkeys, or yeast, identifying cDNAs which encode homologs of the NIP 45 V polypeptide, and expressing the cDNAs as is known in the art.

NIP 45 V Polynucleotides An NIP45 like polynucleotide can be single-or double-stranded and comprise a coding sequence or the complement of a coding sequence for an NIP 45 V polypeptide. The coding sequence for human NIP45 V polypeptide is shown in SEQ ID NO. 1, 2,3,4, or 5.

Degenerate nucleotide sequences encoding human NIP 45 V polypeptides, as well as homologous nucleotide sequences which are at least about 50, preferably about 75, 85,90,95,96,98 or 99% identical to the nucleotide sequence shown in SEQ ID NO.

1,2,3,4, or 5 also are NIP 45 V polynucleotides. Percent sequence identity between the sequences of two polynucleotides is determined using computer programs such as ALIGN which employ the FASTA algorithm, using an affine gap search with a gap open penalty of-12 and a gap extension penalty of-2. Complementary DNA (cDNA) molecules, species homologs, and variants of NIP 45 V polynucleotides which encode biologically active NIP45 V polypeptides also are NIP 45 V poly- nucleotides.

Identification of Variants and Homologs of NIP 45 V Polynucleotides Variants and homologs of the NIP 45 V polynucleotides described above also are NIP 45 V polynucleotides. Typically, homologous NIP 45 V polynucleotide sequences can be identified by hybridization of candidate polynucleotides to known NIP 45 V polynucleotides under stringent conditions, as is known in the art. For example, using the following wash conditions--2X SSC (0.3 M NaCl, 0.03 M sodium citrate, pH 7.0), 0.1% SDS, room temperature twice, 30 minutes each; then 2X SSC, 0.1% SDS, 50°C once, 30 minutes; then 2X SSC, room temperature twice, 10 minutes each--homologous sequences can be identified which contain at most about 25-30% basepair mismatches. More preferably, homologous nucleic acid strands contain 15-25% basepair mismatches, even more preferably 5-15% basepair mismatches.

Species homologs of the NIP 45 V polynucleotides disclosed herein also can be identified by making suitable probes or primers and screening cDNA expression libraries from other species, such as mice, monkeys, or yeast. Human variants of NIP 45 V polynucleotides can be identified, for example, by screening human cDNA expression libraries. It is well known that the T. of a double-stranded DNA decreases by 1-1.5 °C with every 1% decrease in homology (Bonner et al., J. Mol.

Biol. 81, 123 (1973). Variants of human NIP 45 V polynucleotides or NIP45 V polynucleotides of other species can therefore be identified by hybridizing a putative homologous NIP 45 V polynucleotide with a polynucleotide having a nucleotide sequence of any of SEQ ID NO. 1 to 5 or the complement thereof to form a test hybrid. The melting temperature of the test hybrid is compared with the melting temperature of a hybrid comprising transformylase polynucleotides having perfectly

complementary nucleotide sequences, and the number or percent of basepair mismatches within the test hybrid is calculated.

Nucleotide sequences which hybridize to transformylase polynucleotides or their complements following stringent hybridization and/or wash conditions also are NIP 45 V polynucleotides. Stringent wash conditions are well known and understood in the art and are disclosed, for example, in Sambrook et al., MOLECULAR CLONING : A LABORATORY MANUAL, 2d ed., 1989, at pages 9.50-9.51.

Typically, for stringent hybridization conditions a combination of temperature and salt concentration should be chosen that is approximately 12-20°C below the calculated Tm of the hybrid under study. The Tm of a hybrid between an NIP 45 V polynucleotide having a nucleotide sequence shown in any of SEQ ID NO. 1 to 5 or the complement thereof and a polynucleotide sequence which is at least about 50, preferably about 75,90,96, or 98% identical to one of those nucleotide sequences can be calculated, for example, using the equation of Bolton and McCarthy, Proc.

Natl. Acad. Sci. U. Sua. 48, 1390 (1962): Tm = 81.5 °C-16.6 (log, o [Na]) + 0.41 (% G + C)-0.63 (% formamide)-600/1), where/= the length of the hybrid in basepairs.

Stringent wash conditions include, for example, 4X SSC at 65°C, or 50% formamide, 4X SSC at 42°C, or 0. 5X SSC, 0.1% SDS at 65°C. Highly stringent wash conditions include, for example, 0.2X SSC at 65°C.

Preparation of NIP 45 V Polynucleotides A naturally occurring NIP 45 V polynucleotides can be isolated free of other cellular components such as membrane components, proteins, and lipids. Polynucleotides can be made by a cell and isolated using standard nucleic acid purification techniques, or synthesized using an amplification technique, such as the polymerase

chain reaction (PCR), or by using an automatic synthesizer. Methods for isolating polynucleotides are routine and are known in the art. Any such technique for obtaining a polynucleotide can be used to obtain isolated NIP 45 V polynucleotides.

For example, restriction enzymes and probes can be used to isolate polynucleotide fragments which comprise NIP 45 V nucleotide sequences. Isolated polynucleotides are in preparations which are free or at least 70,80, or 90% free of other molecules.

NIP 45 V cDNA molecules can be made with standard molecular biology techniques, using NIP 45 V mRNA as a template. NIP 45 V cDNA molecules can thereafter be replicated using molecular biology techniques known in the art and disclosed in manuals such as Sambrook et al. (1989). An amplification technique, such as PCR, can be used to obtain additional copies of polynucleotides of the invention, using either human genomic DNA or cDNA as a template.

Alternatively, synthetic chemistry techniques can be used to synthesizes NIP 45 V polynucleotides. The degeneracy of the genetic code allows alternate nucleotide sequences to be synthesized which will encode an NIP 45 V polypeptide having, for example, an amino acid sequence shown in any of SEQ ID NO. 8 to 11 or a biologically active variant thereof.

Extending NIP 45 V Polynucleotides Various PCR-based methods can be used to extend the nucleic acid sequences encoding the disclosed portions of human NIP 45 V polypeptide to detect upstream sequences such as promoters and regulatory elements. For example, restriction-site PCR uses universal primers to retrieve unknown sequence adjacent to a known locus (Sarkar, PCR Methods Applic. 2,318-322,1993). Genomic DNA is first amplified in the presence of a primer to a linker sequence and a primer specific to the known region. The amplified sequences are then subjected to a second round of PCR with the same linker primer and another specific primer internal to the first one. Products

of each round of PCR are transcribed with an appropriate RNA polymerase and sequenced using reverse transcriptase.

Inverse PCR also can be used to amplify or extend sequences using divergent primers based on a known region (Triglia et al., Nucleic Acids Res. 16, 8186,1988). Primers can be designed using commercially available software, such as OLIGO 4.06 Primer Analysis software (National Biosciences Inc., Plymouth, Minn.), to be 22-30 nucleotides in length, to have a GC content of 50% or more, and to anneal to the target sequence at temperatures about 68-72°C. The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template.

Another method which can be used is capture PCR, which involves PCR amplification of DNA fragments adjacent to a known sequence in human and yeast artificial chromosome DNA (Lagerstrom et al., PCR Methods Applic. 1, 111-119, 1991). In this method, multiple restriction enzyme digestions and ligations also can be used to place an engineered double-stranded sequence into an unknown fragment of the DNA molecule before performing PCR.

Another method which can be used to retrieve unknown sequences is that of Parker et al., Nucleic Acids Res. 19, 3055-3060,1991). Additionally, PCR, nested primers, and PROMOTERFINDER libraries (CLONTECH, Palo Alto, Calif.) can be used to walk genomic DNA (CLONTECH, Palo Alto, Calif.). This process avoids the need to screen libraries and is useful in finding intron/exon junctions.

When screening for full-length cDNAs, it is preferable to use libraries that have been size-selected to include larger cDNAs. Randomly-primed libraries are preferable, in that they will contain more sequences which contain the 5'regions of genes. Use of a randomly primed library may be especially preferable for situations in which an oligo d (T) library does not yield a full-length cDNA. Genomic libraries can be useful for extension of sequence into 5'non-transcribed regulatory regions.

Commercially available capillary electrophoresis systems can be used to analyze the size or confirm the nucleotide sequence of PCR or sequencing products. For example, capillary sequencing can employ flowable polymers for electrophoretic separation, four different fluorescent dyes (one for each nucleotide) which are laser activated, and detection of the emitted wavelengths by a charge coupled device camera. Output/light intensity can be converted to electrical signal using appropriate software (e. g. GENOTYPER and Sequence NAVIGATOR, Perkin Elmer), and the entire process from loading of samples to computer analysis and electronic data display can be computer controlled. Capillary electrophoresis is especially preferable for the sequencing of small pieces of DNA which might be present in limited amounts in a particular sample.

Obtaining NIP 45 V Polypeptides NIP 45 V polypeptides can be obtained, for example, by purification from human cells, by expression of NIP 45 V polynucleotides, or by direct chemical synthesis.

Protein Purification NIP 45 V polypeptides (NIP 45 vl-4 polypeptides) can be purified from any human cell which expresses the protein, including host cells which have been transfected with NIP 45 V polynucleotides. Thymus, spleen, lymph node, and other immune related tissues are particularly useful sources of NIP45 V polypeptides. A purified NIP45 V polypeptide is separated from other compounds which normally associate with the NIP 45 V polypeptide in the cell, such as certain proteins, carbohydrates, or lipids, using methods well-known in the art. Such methods include, but are not limited to, size exclusion chromatography, ammonium sulfate fractionation, ion exchange chromatography, affinity chromatography, and preparative gel electro- phoresis.

A preparation of purified NIP 45 V polypeptides is at least 80% pure; preferably, the preparations are 90%, 95%, or 99% pure. Purity of the preparations can be assessed by any means known in the art, such as SDS-polyacrylamide gel electrophoresis.

Expression of NIP 45 VPolynucleotides To express an NIP 45 V polypeptide, an NIP 45 V polynucleotide can be inserted into an expression vector which contains the necessary elements for the transcription and translation of the inserted coding sequence. Methods which are well known to those skilled in the art can be used to construct expression vectors containing sequences encoding NIP 45 V polypeptides and appropriate transcriptional and translational control elements. These methods include in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. Such techniques are described, for example, in Sambrook et al. (1989) and in Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, N. Y., 1989.

A variety of expression vector/host systems can be utilized to contain and express sequences encoding an NIP 45 V polypeptide. These include, but are not limited to, microorganisms, such as bacteria transformed with recombinant bacteriophage, plasmid, or cosmid DNA expression vectors; yeast transformed with yeast expression vectors, insect cell systems infected with virus expression vectors (e. g., baculovirus), plant cell systems transformed with virus expression vectors (e. g., cauliflower mosaic virus, CaMV ; tobacco mosaic virus, TMV) or with bacterial expression vectors (e. g., Ti or pBR322 plasmids), or animal cell systems.

The control elements or regulatory sequences are those non-translated regions of the vector--enhancers, promoters, 5'and 3'untranslated regions--which interact with host cellular proteins to carry out transcription and translation. Such elements can vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, can be used. For example, when cloning in

bacterial systems, inducible promoters such as the hybrid lacZ promoter of the BLUESCRIPT phagemid (Stratagene, LaJolla, Calif.) or pSPORTl plasmid (Life Technologies) and the like can be used. The baculovirus polyhedrin promoter can be used in insect cells. Promoters or enhancers derived from the genomes of plant cells (e. g., heat shock, RUBISCO, and storage protein genes) or from plant viruses (e. g., viral promoters or leader sequences) can be cloned into the vector. In mammalian cell systems, promoters from mammalian genes or from mammalian viruses are preferable. If it is necessary to generate a cell line that contains multiple copies of a nucleotide sequence encoding an NIP 45 V polypeptide, vectors based on SV40 or EBV can be used with an appropriate selectable marker.

Bacterial and Yeast Expression Systems In bacterial systems, a number of expression vectors can be selected depending upon the use intended for the NIP 45 V polypeptide. For example, when a large quantity of an NIP 45 V polypeptide is needed for the induction of antibodies, vectors which direct high level expression of fusion proteins that are readily purified can be used.

Such vectors include, but are not limited to, multifunctional E. coli cloning and expression vectors such as BLUESCRIPT (Stratagene). In a BLUESCRIPT vector, a sequence encoding the NIP 45 V polypeptide can be ligated into the vector in frame with sequences for the amino-terminal Met and the subsequent 7 residues of ß- galactosidase so that a hybrid protein is produced. pIN vectors (Van Heeke & Schuster, J. Biol. Chem. 264, 5503-5509,1989) or pGEX vectors (Promega, Madison, Wis.) also can be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. Proteins made in such systems can be designed to include heparin, thrombin, or factor Xa protease cleavage sites so that the cloned polypeptide of interest can be released from the GST moiety at will.

In the yeast Saccharomyces cerevisiae, a number of vectors containing constitutive or inducible promoters such as alpha factor, alcohol oxidase, and PGH can be used.

For reviews, see Ausubel et al. (1989) and Grant et al., Methods Enzymol. 153, 516- 544,1987.

Plant and Insect Expression System If plant expression vectors are used, the expression of sequences encoding NIP 45 V polypeptides can be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV can be used alone or in combination with the omega leader sequence from TMV (Takamatsu, EMBO J. 6,

307-311,1987). Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters can be used (Coruzzi et al., EMBO J. 3, 1671- 1680,1984; Broglie et al., Science 224, 838-843, 1984; Winter et al., Results Probl.

Cell Differ. 17, 85-105, 1991). These constructs can be introduced into plant cells by direct DNA transformation or by pathogen-mediated transfection. Such techniques are described in a number of generally available reviews (e. g., Hobbs or Murray, in McGRAW HfLL YEARBOOK OF SCIENCE AND TECHNOLOGY, McGraw Hill, New York, N. Y., pp. 191-196,1992).

An insect system also can be used to express an NIP 45 V polypeptide. For example, in one such system Autographa californica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. Sequences encoding NIP45 LIKE polypeptides can be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of NIP 45 V polypeptides will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses can then be used to infect S. frugiperda cells or Trichoplusia larvae in which NIP 45 V polypeptides can be expressed (Engelhard et al., Proc. Nat. Acad. Sci. 91, 3224-3227,1994).

Mammalian Expression Systems A number of viral-based expression systems can be used to express NIP45 V polypeptides in mammalian host cells. For example, if an adenovirus is used as an expression vector, sequences encoding NIP 45 V polypeptides can be ligated into an adenovirus transcription/translation complex comprising the late promoter and tripartite leader sequence. Insertion in a non-essential E1 or E3 region of the viral genome can be used to obtain a viable virus which is capable of expressing an NIP 45 V polypeptide in infected host cells (Logan & Shenk, Proc. Natl. Acad. Sci. 81, 3655-3659,1984). If desired, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, can be used to increase expression in mammalian host cells.

Human artificial chromosomes (HACs) also can be used to deliver larger fragments of DNA than can be contained and expressed in a plasmid. HACs of 6M to 1 OM are constructed and delivered to cells via conventional delivery methods (e. g., liposomes, polycationic amino polymers, or vesicles).

Specific initiation signals also can be used to achieve more efficient translation of sequences encoding NIP 45 V polypeptides. Such signals include the ATG initiation codon and adjacent sequences. In cases where sequences encoding an NIP 45 V polypeptide, its initiation codon, and upstream sequences are inserted into the appropriate expression vector, no additional transcriptional or translational control signals may be needed. However, in cases where only coding sequence, or a fragment thereof, is inserted, exogenous translational control signals (including the ATG initiation codon) should be provided. The initiation codon should be in the correct reading frame to ensure translation of the entire insert. Exogenous translational elements and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression can be enhanced by the inclusion of enhancers which are appropriate for the particular cell system which is used (see Scharf et al., Results Probl. Cell DiXer. 20,125-162,1994).

Host Cells A host cell strain can be chosen for its ability to modulate the expression of the inserted sequences or to process the expressed NIP 45 V polypeptide in the desired fashion. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation, and acylation.

Post-translational processing which cleaves a"prepro"form of the polypeptide also can be used to facilitate correct insertion, folding and/or function. Different host cells which have specific cellular machinery and characteristic mechanisms for post- translational activities (e. g., CHO, HeLa, MDCK, HEK293, B-lymphoma cells and Wu38), are available from the American Type Culture Collection (ATCC; 10801

University Boulevard, Manassas, VA 20110-2209) and can be chosen to ensure the correct modification and processing of the foreign protein.

Stable expression is preferred for long-term, high-yield production of recombinant proteins. For example, cell lines which stably express NIP 45 V polypeptides can be transformed using expression vectors which can contain viral origins of replication and/or endogenous expression elements and a selectable marker gene on the same or on a separate vector. Following the introduction of the vector, cells can be allowed to grow for 1-2 days in an enriched medium before they are switched to a selective medium. The purpose of the selectable marker is to confer resistance to selection, and its presence allows growth and recovery of cells which successfully express the introduced NIP 45 V sequences. Resistant clones of stably transformed cells can be proliferated using tissue culture techniques appropriate to the cell type. See, for example, ANIMAL CELL CULTURE, R. I. Freshney, ed., 1986.

Any number of selection systems can be used to recover transformed cell lines.

These include, but are not limited to, the herpes simplex virus thymidine kinase (Wigler et al., Cell 11, 223-32,1977) and adenine phosphoribosyltransferase (Lowy et al., Cell 22, 817-23,1980) genes which can be employed in tk or aprt-cells, respectively. Also, antimetabolite, antibiotic, or herbicide resistance can be used as the basis for selection. For example, dhfr confers resistance to methotrexate (Wigler et al., Proc. Natl. Acad. Sci. 77,3567-70,1980), npt confers resistance to the aminoglycosides, neomycin and G-418 (Colbere-Garapin et al., J ; Mol. Biol. 150, 1- 14,1981), and als and pat confer resistance to chlorsulfuron and phosphinotricin acetyltransferase, respectively (Murray, 1992, supra). Additional selectable genes have been described. For example, trpB allows cells to utilize indole in place of tryptophan, or hisD, which allows cells to utilize histinol in place of histidine (Hartman & Mulligan, Proc. Natl. Acad. Sci. 85, 8047-51,1988). Visible markers such as anthocyanins, p-glucuronidase and its substrate GUS, and luciferase and its substrate luciferin, can be used to identify transformants and to quantify the amount

of transient or stable protein expression attributable to a specific vector system (Rhodes et al., Methods Mol. Biol. 55, 121-131,1995).

Detecting Expression of NIP 45 V Polypeptides Although the presence of marker gene expression suggests that the NIP 45 V polynucleotide is also present, its presence and expression may need to be confirmed.

For example, if a sequence encoding an NIP 45 V polypeptide is inserted within a marker gene sequence, transformed cells containing sequences which encode an NIP 45 V polypeptide can be identified by the absence of marker gene function.

Alternatively, a marker gene can be placed in tandem with a sequence encoding an NIP45 V polypeptide under the control of a single promoter. Expression of the marker gene in response to induction or selection usually indicates expression of the NIP 45 V polynucleotide.

Alternatively, host cells which contain an NIP 45 V polynucleotide and which express an NIP 45 V polypeptide can be identified by a variety of procedures known to those of skill in the art. These procedures include, but are not limited to, DNA- DNA or DNA-RNA hybridizations and protein bioassay or immunoassay techniques which include membrane, solution, or chip-based technologies for the detection and/or quantification of nucleic acid or protein. For example, the presence of a polynucleotide sequence encoding an NIP 45 V polypeptide can be detected by DNA-DNA or DNA-RNA hybridization or amplification using probes or fragments or fragments of polynucleotides encoding an NIP 45 V polypeptide. Nucleic acid amplification-based assays involve the use of oligonucleotides selected from sequences encoding an NIP 45 V polypeptide to detect transformants which contain an NIP 45 V polynucleotide.

A variety of protocols for detecting and measuring the expression of an NIP 45 V polypeptide, using either polyclonal or monoclonal antibodies specific for the polypeptide, are known in the art. Examples include enzyme-linked immunosorbent

assay (ELISA), radioimmunoassay (RIA), and fluorescence activated cell sorting (FACS). A two-site, monoclonal-based immunoassay using monoclonal antibodies reactive to two non-interfering epitopes on an NIP 45 V polypeptide can be used, or a competitive binding assay can be employed. These and other assays are described in Hampton et al., SEROLOGICAL METHODS: A LABORATORY MANUAL, APS Press, St.

Paul, Minn., 1990) and Maddox et al., J. Exp. Med. 158, 1211-1216,1983).

A wide variety of labels and conjugation techniques are known by those skilled in the art and can be used in various nucleic acid and amino acid assays. Means for producing labeled hybridization or PCR probes for detecting sequences related to polynucleotides encoding NIP45 V polypeptides include oligolabeling, nick translation, end-labeling, or PCR amplification using a labeled nucleotide.

Alternatively, sequences encoding an NIP 45 V polypeptide can be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and can be used to synthesize RNA probes in vitro by addition of labeled nucleotides and an appropriate RNA polymerase such as T7, T3, or SP6. These procedures can be conducted using a variety of commercially available kits (Amersham Pharmacia Biotech, Promega, and US Biochemical).

Suitable reporter molecules or labels which can be used for ease of detection include radionuclides, enzymes, and fluorescent, chemiluminescent, or chromogenic agents, as well as substrates, cofactors, inhibitors, magnetic particles, and the like.

Expression and Purification of NIP 4 If Polypeptides Host cells transformed with nucleotide sequences encoding an NIP 45 V polypeptide can be cultured under conditions suitable for the expression and recovery of the protein from cell culture. The polypeptide produced by a transformed cell can be secreted or contained intracellularly depending on the sequence and/or the vector used. As will be understood by those of skill in the art, expression vectors containing polynucleotides which encode NIP45 V polypeptides can be designed to contain signal sequences which direct secretion of soluble NIP 45 V polypeptides through a

prokaryotic or eukaryotic cell membrane or which direct the membrane insertion of membrane-bound NIP 45 V polypeptide.

As discussed above, other constructions can be used to join a sequence encoding an NIP 45 V polypeptide to a nucleotide sequence encoding a polypeptide domain which will facilitate purification of soluble proteins. Such purification facilitating domains include, but are not limited to, metal chelating peptides such as histidine- tryptophan modules that allow purification on immobilized metals, protein A domains that allow purification on immobilized immunoglobulin, and the domain utilized in the FLAGS extension/affinity purification system (Immunex Corp., Seattle, Wash.). Inclusion of cleavable linker sequences such as those specific for Factor Xa or enterokinase (Invitrogen, San Diego, CA) between the purification domain and the NIP 45 V polypeptide also can be used to facilitate purification. One such expression vector provides for expression of a fusion protein containing an NIP 45 V polypeptide and 6 histidine residues preceding a thioredoxin or an enterokinase cleavage site. The histidine residues facilitate purification by IMAC (immobilized metal ion affinity chromatography, as described in Porath et al., Prot.

Exp. Purif 3, 263-281,1992), while the enterokinase cleavage site provides a means for purifying the NIP 45 V polypeptide from the fusion protein. Vectors which contain fusion proteins are disclosed in Kroll et al., DNA Cell Bol 12, 441-453, 1993.

Chemical Synthesis Sequences encoding an NIP 45 V polypeptide can be synthesized, in whole or in part, using chemical methods well known in the art (see Caruthers et al., Nucl. Acids Res.

Symp. Ser. 215-223,1980; Horn et al. Nucl. Acids Res. Symp. Ser. 225-232,1980).

Alternatively, an NIP 45 V polypeptide itself can be produced using chemical methods to synthesize its amino acid sequence, such as by direct peptide synthesis using solid-phase techniques (Merrifield, J. Am. Chem. Soc. 85, 2149-2154,1963; Roberge et al., Science 269, 202-204,1995). Protein synthesis can be performed

using manual techniques or by automation. Automated synthesis can be achieved, for example, using Applied Biosystems 431A Peptide Synthesizer (Perkin Elmer).

Optionally, fragments of NIP 45 V polypeptides can be separately synthesized and combined using chemical methods to produce a full-length molecule.

The newly synthesized peptide can be substantially purified by preparative high performance liquid chromatography (e. g., Creighton, PROTEINS: STRUCTURES AND MOLECULAR PRINCIPLES, WH Freeman and Co., New York, N. Y., 1983). The composition of a synthetic NIP 45 V polypeptide can be confirmed by amino acid analysis or sequencing (e. g., the Edman degradation procedure; see Creighton, supra). Additionally, any portion of the amino acid sequence of the NIP 45 V polypeptide can be altered during direct synthesis and/or combined using chemical methods with sequences from other proteins to produce a variant polypeptide or a fusion protein.

Production ofAltered NIP 45 VPolypeptides As will be understood by those of skill in the art, it may be advantageous to produce NIP 45 V polypeptide-encoding nucleotide sequences possessing non-naturally occurring codons. For example, codons preferred by a particular prokaryotic or eukaryotic host can be selected to increase the rate of protein expression or to produce an RNA transcript having desirable properties, such as a half-life which is longer than that of a transcript generated from the naturally occurring sequence.

The nucleotide sequences disclosed herein can be engineered using methods generally known in the art to alter NIP 45 V polypeptide-encoding sequences for a variety of reasons, including but not limited to, alterations which modify the cloning, processing, and/or expression of the polypeptide or mRNA product. DNA shuffling by random fragmentation and PCR reassembly of gene fragments and synthetic oligonucleotides can be used to engineer the nucleotide sequences. For example, site-directed mutagenesis can be used to insert new restriction sites, alter

glycosylation patterns, change codon preference, produce splice variants, introduce mutations, and so forth.

Antibodies Any type of antibody known in the art can be generated to bind specifically to an epitope of an NIP 45 V polypeptide."Antibody"as used herein includes intact immunoglobulin molecules, as well as fragments thereof, such as Fab, F (ab') 2, and Fv, which are capable of binding an epitope of an NIP 45 V polypeptide. Typically, at least 6,8,10, or 12 contiguous amino acids are required to form an epitope.

However, epitopes which involve non-contiguous amino acids may require more, e. g., at least 15,25, or 50 amino acids.

An antibody which specifically binds to an epitope of an NIP 45 V polypeptide can be used therapeutically, as well as in immunochemical assays, such as Western blots, ELISAs, radioimmunoassays, immunohistochemical assays, immunoprecipitations, or other immunochemical assays known in the art. Various immunoassays can be used to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays are well known in the art. Such immunoassays typically involve the measurement of complex formation between an immunogen and an antibody which specifically binds to the immunogen.

Typically, an antibody which specifically binds to an NIP 45 V polypeptide provides a detection signal at least 5-, 10-, or 20-fold higher than a detection signal provided with other proteins when used in an immunochemical assay. Preferably, antibodies which specifically bind to NIP 45 V polypeptides do not detect other proteins in immunochemical assays and can immunoprecipitate an NIP 45 V polypeptide from solution.

NIP 45 V polypeptides can be used to immunize a mammal, such as a mouse, rat, rabbit, guinea pig, monkey, or human, to produce polyclonal antibodies. If desired,

an NIP 45 V polypeptide can be conjugated to a carrier protein, such as bovine serum albumin, thyroglobulin, and keyhole limpet hemocyanin. Depending on the host species, various adjuvants can be used to increase the immunological response. Such adjuvants include, but are not limited to, Freund's adjuvant, mineral gels (e. g., aluminum hydroxide), and surface active substances (e. g., lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol). Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially useful.

Monoclonal antibodies which specifically bind to an NIP 45 V polypeptide can be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These techniques include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler et al., Nature 256, 495-497,1985; Kozbor et al., J : Immunol. Methods 81, 31-42,1985 ; Cote et al., Proc. Natl. Acad. Sci. 80, 2026- 2030,1983; Cole et al., Mol. Cell Biol. 62, 109-120,1984).

In addition, techniques developed for the production of"chimeric antibodies,"the splicing of mouse antibody genes to human antibody genes to obtain a molecule with appropriate antigen specificity and biological activity, can be used (Morrison et al., Proc. Natl. Scad. Sc. 81, 6851-6855,1984; Neuberger et al., Nature 312, 604-608, 1984; Takeda et al., Nature 314, 452-454,1985). Monoclonal and other antibodies also can be"humanized"to prevent a patient from mounting an immune response against the antibody when it is used therapeutically. Such antibodies may be sufficiently similar in sequence to human antibodies to be used directly in therapy or may require alteration of a few key residues. Sequence differences between rodent antibodies and human sequences can be minimized by replacing residues which differ from those in the human sequences by site directed mutagenesis of individual residues or by grating of entire complementarity determining regions. Alternatively, humanized antibodies can be produced using recombinant methods, as described in GB2188638B. Antibodies which specifically bind to an NIP 45 V polypeptide can

contain antigen binding sites which are either partially or fully humanized, as disclosed in U. S. 5,565,332.

Alternatively, techniques described for the production of single chain antibodies can be adapted using methods known in the art to produce single chain antibodies which specifically bind to NIP 45 V polypeptides. Antibodies with related specificity, but of distinct idiotypic composition, can be generated by chain shuffling from random combinatorial immunoglobin libraries (Burton, Proc. Natl. Acad. Sci. 88, 11120-23, 1991).

Single-chain antibodies also can be constructed using a DNA amplification method, such as PCR, using hybridoma cDNA as a template (Thirion et al., 1996, Emir. J.

Cancer Prev. 5, 507-11). Single-chain antibodies can be mono-or bispecific, and can be bivalent or tetravalent. Construction of tetravalent, bispecific single-chain antibodies is taught, for example, in Coloma & Morrison, 1997, Nat. Biotechnol. 15, 159-63. Construction of bivalent, bispecific single-chain antibodies is taught in Mallender & Voss, 1994, R Biol. Chem. 269, 199-206.

A nucleotide sequence encoding a single-chain antibody can be constructed using manual or automated nucleotide synthesis, cloned into an expression construct using standard recombinant DNA methods, and introduced into a cell to express the coding sequence, as described below. Alternatively, single-chain antibodies can be produced directly using, for example, filamentous phage technology (Verhaar et al., 1995, Int. J. Cancer 61, 497-501; Nicholls et al., 1993, J Immunol. Meth. 165, 81- 91).

Antibodies which specifically bind to NIP 45 V polypeptides also can be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi et al., Proc. Natl. Acad. Sci. 86, 3833-3837,1989; Winter et al., Nature 349, 293-299,1991).

Other types of antibodies can be constructed and used therapeutically in methods of the invention. For example, chimeric antibodies can be constructed as disclosed in WO 93/03151. Binding proteins which are derived from immunoglobulins and which are multivalent and multispecific, such as the"diabodies"described in WO 94/13804, also can be prepared.

Antibodies according to the invention can be purified by methods well known in the art. For example, antibodies can be affinity purified by passage over a column to which an NIP 45 V polypeptide is bound. The bound antibodies can then be eluted from the column using a buffer with a high salt concentration.

Antisense Oligonucleotides Antisense oligonucleotides are nucleotide sequences which are complementary to a specific DNA or RNA sequence. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form complexes and block either transcription or translation. Preferably, an antisense oligonucleotide is at least 11 nucleotides in length, but can be at least 12,15,20,25,30,35,40,45, or 50 or more nucleotides long. Longer sequences also can be used. Antisense oligonucleotide molecules can be provided in a DNA construct and introduced into a cell as described above to decrease the level of NIP 45 V gene products in the cell.

Antisense oligonucleotides can be deoxyribonucleotides, ribonucleotides, or a combination of both. Oligonucleotides can be synthesized manually or by an automated synthesizer, by covalently linking the 5'end of one nucleotide with the 3' end of another nucleotide with non-phosphodiester internucleotide linkages such alkylphosphonates, phosphorothioates, phosphorodithioates, alkylphosphonothioates, alkylphosphonates, phosphoramidates, phosphate esters, carbamates, acetamidate, carboxymethyl esters, carbonates, and phosphate triesters. See Brown, Meth. Mol.

Biol. 20,1-8,1994; Sonveaux, Meíh. MoL Biol. 26, 1-72,1994 ; Uhlmann et al., Chem. Rev. 90, 543-583,1990.

Modifications of NIP 45 V gene expression can be obtained by designing antisense oligonucleotides which will form duplexes to the control, 5', or regulatory regions of the NIP 45 V gene. Oligonucleotides derived from the transcription initiation site, e. g., between positions-10 and +10 from the start site, are preferred. Similarly, inhibition can be achieved using"triple helix"base-pairing methodology. Triple helix pairing is useful because it causes inhibition of the ability of the double helix to open sufficiently for the binding of polymerases, transcription factors, or chaperons.

Therapeutic advances using triplex DNA have been described in the literature (e. g., Gee et al., in Huber & Carr, MOLECULAR AND IMMUNOLOGIC APPROACHES, Futura Publishing Co., Mt. Kisco, N. Y., 1994). An antisense oligonucleotide also can be designed to block translation of mRNA by preventing the transcript from binding to ribosomes.

Precise complementarity is not required for successful complex formation between an antisense oligonucleotide and the complementary sequence of an NIP 45 V polynucleotide. Antisense oligonucleotides which comprise, for example, 2,3,4, or 5 or more stretches of contiguous nucleotides which are precisely complementary to an NIP 45 V polynucleotide, each separated by a stretch of contiguous nucleotides which are not complementary to adjacent NIP 45 V nucleotides, can provide sufficient targeting specificity for NIP 45 V mRNA. Preferably, each stretch of complementary contiguous nucleotides is at least 4,5,6,7, or 8 or more nucleotides in length. Non-complementary intervening sequences are preferably 1, 2,3, or 4 nucleotides in length. One skilled in the art can easily use the calculated melting point of an antisense-sense pair to determine the degree of mismatching which will be tolerated between a particular antisense oligonucleotide and a particular NIP 45 V polynucleotide sequence.

Antisense oligonucleotides can be modified without affecting their ability to hybridize to an NIP 45 V polynucleotide. These modifications can be internal or at one or both ends of the antisense molecule. For example, internucleoside phosphate linkages can be modified by adding cholesteryl or diamine moieties with varying numbers of carbon residues between the amino groups and terminal ribose. Modified bases and/or sugars, such as arabinose instead of ribose, or a 3', 5'-substituted oligonucleotide in which the 3'hydroxyl group or the 5'phosphate group are substituted, also can be employed in a modified antisense oligonucleotide. These modified oligonucleotides can be prepared by methods well known in the art. See, e. g., Agrawal et al., Trends Biotechnol. 10, 152-158,1992; Uhlmann et al., Chem.

Rev. 90, 543-584,1990; Uhlmann et al., Tetrahedron. Lett. 215, 3539-3542,1987.

Ribozymes Ribozymes are RNA molecules with catalytic activity. See, e. g., Cech, Science 236, 1532-1539; 1987; Cech, Ann. Rev. Biochem. 59, 543-568 ; 1990, Cech, Curr. Opin.

Struct. Biol. 2,605-609; 1992, Couture & Stinchcomb, Trends Genet. 12, 510-515, 1996. Ribozymes can be used to inhibit gene function by cleaving an RNA sequence, as is known in the art (e. g., Haseloff et al., U. S. Patent 5,641,673). The mechanism of ribozyme action involves sequence-specific hybridization of the ribozyme molecule to complementary target RNA, followed by endonucleolytic cleavage.

Examples include engineered hammerhead motif ribozyme molecules that can specifically and efficiently catalyze endonucleolytic cleavage of specific nucleotide sequences.

The coding sequence of an NIP45 V polynucleotide, such as the nucleotide sequence shown in SEQ ID NO. 2,3,4, or 5 can be used to generate ribozymes which will specifically bind to mRNA transcribed from the NIP 45 V polynucleotide. Methods of designing and constructing ribozymes which can cleave other RNA molecules in trans in a highly sequence specific manner have been developed and described in the art (see Haseloff et al. Nature 334, 585-591,1988). For example, the cleavage

activity of ribozymes can be targeted to specific RNAs by engineering a discrete "hybridization"region into the ribozyme. The hybridization region contains a sequence complementary to the target RNA and thus specifically hybridizes with the target (see, for example, Gerlach et al., EP 321,201).

Specific ribozyme cleavage sites within an NIP 45 V RNA target can be identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU, and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target RNA containing the cleavage site can be evaluated for secondary structural features which may render the target inoperable. Suitability of candidate NIP45 V RNA targets also can be evaluated by testing accessibility to hybridization with complementary oligonucleotides using ribonuclease protection assays. The nucleotide sequences shown in SEQ ID NO. 2,3,4, or 5 and their complements provide a source of suitable hybridization region sequences. Longer complementary sequences can be used to increase the affinity of the hybridization sequence for the target. The hybridizing and cleavage regions of the ribozyme can be integrally related such that upon hybridizing to the target RNA through the complementary regions, the catalytic region of the ribozyme can cleave the target.

Ribozymes can be introduced into cells as part of a DNA construct. Mechanical methods, such as microinjection, liposome-mediated transfection, electroporation, or calcium phosphate precipitation, can be used to introduce a ribozyme-containing DNA construct into cells in which it is desired to decrease NIP 45 V expression.

Alternatively, if it is desired that the cells stably retain the DNA construct, the construct can be supplied on a plasmid and maintained as a separate element or integrated into the genome of the cells, as is known in the art. A ribozyme-encoding DNA construct can include transcriptional regulatory elements, such as a promoter element, an enhancer or UAS element, and a transcriptional terminator signal, for controlling transcription of ribozymes in the cells.

As taught in Haseloff et al., U. S. Patent 5,641,673, ribozymes can be engineered so that ribozyme expression will occur in response to factors which induce expression of a target gene. Ribozymes also can be engineered to provide an additional level of regulation, so that destruction of mRNA occurs only when both a ribozyme and a target gene are induced in the cells.

Screening Methods The invention provides assays for screening test compounds which bind to or modulate the activity of an NIP 45 V polypeptide or an NIP 45 V polynucleotide. A test compound preferably binds to an NIP 45 V polypeptide or polynucleotide. More preferably, a test compound decreases or increases the effect of NIP45 or an NIP45 analog as mediated via human NIP 45 V by at least about 10, preferably about 50, more preferably about 75,90, or 100% relative to the absence of the test compound.

Test Compounds Test compounds can be pharmacological agents already known in the art or can be compounds previously unknown to have any pharmacological activity. The compounds can be naturally occurring or designed in the laboratory. They can be isolated from microorganisms, animals, or plants, and can be produced recombinantly, or synthesized by chemical methods known in the art. If desired, test compounds can be obtained using any of the numerous combinatorial library methods known in the art, including but not limited to, biological libraries, spatially addressable parallel solid phase or solution phase libraries, synthetic library methods requiring deconvolution, the"one-bead, one-compound"library method, and synthetic library methods using affinity chromatography selection. The biological library approach is limited to polypeptide libraries, while the other four approaches are applicable to polypeptide, non-peptide oligomer, or small molecule libraries of compounds. See Lam, Anticancer Drug Des. 12, 145,1997.

Methods for the synthesis of molecular libraries are well known in the art (see, for example, DeWitt et al., Proc. Natl. Acad. Sci. U. S. A. 90, 6909,1993; Erb et al. Proc.

Natl. Acad. Sci. U. S. A. 91, 11422,1994 ; Zuckermann et al., J. Med. Chem. 37,2678, 1994; Cho et al., Science 261, 1303,1993; Carell et al., Angew. Chem. Int. Ed. Engl.

33,2059,1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33,2061; Gallop et al., J.

Med. Chem 37,1233,1994). Libraries of compounds can be presented in solution (see, e. g., Houghten, Biotechniques 13, 412-421,1992), or on beads (Lam, Nature 354, 82-84,1991), chips (Fodor, Nature 364, 555-556,1993), bacteria or spores (Ladner, U. S. Patent 5,223,409), plasmids (Cull et al., Proc. Natl. Acad. Sci. U. S. A.

89, 1865-1869,1992), or phage (Scott & Smith, Science 249, 386-390,1990; Devlin, Science 249, 404-406,1990); Cwirla et al., Proc. Natl. Acad. Sci 97, 6378-6382, 1990; Felici, J. Mol. Biol. 222,301-310,1991; and Ladner, U. S. Patent 5,223,409).

High Throughput Screening Test compounds can be screened for the ability to bind to NIP 45 V polypeptides or polynucleotides or to affect NIP 45 V activity or NIP 45 V gene expression using high throughput screening. Using high throughput screening, many discrete compounds can be tested in parallel so that large numbers of test compounds can be quickly screened. The most widely established techniques utilize 96-well microtiter plates. The wells of the microtiter plates typically require assay volumes that range from 50 to 500 ul. In addition to the plates, many instruments, materials, pipettors, robotics, plate washers, and plate readers are commercially available to fit the 96- well format.

Alternatively,"free format assays,"or assays that have no physical barrier between samples, can be used. For example, an assay using pigment cells (melanocytes) in a simple homogeneous assay for combinatorial peptide libraries is described by Jayawickreme et al., Proc. Natl. Acad. Sci. US. A. 19, 1614-18 (1994). The cells are placed under agarose in petri dishes, then beads that carry combinatorial compounds

are placed on the surface of the agarose. The combinatorial compounds are partially released the compounds from the beads. Active compounds can be visualized as dark pigment areas because, as the compounds diffuse locally into the gel matrix, the active compounds cause the cells to change colors.

Another example of a free format assay is described by Chelsky,"Strategies for Screening Combinatorial Libraries: Novel and Traditional Approaches,"reported at the First Annual Conference of The Society for Biomolecular Screening in Philadelphia, Pa. (Nov. 7-10,1995). Chelsky placed a simple homogenous enzyme assay for carbonic anhydrase inside an agarose gel such that the enzyme in the gel would cause a color change throughout the gel. Thereafter, beads carrying combinatorial compounds via a photolinker were placed inside the gel and the compounds were partially released by UV-light. Compounds that inhibited the enzyme were observed as local zones of inhibition having less color change.

Yet another example is described by Salmon et al., Molecular Diversity 2,57-63 (1996). In this example, combinatorial libraries were screened for compounds that had cytotoxic effects on cancer cells growing in agar.

Another high throughput screening method is described in Beutel et al., U. S. Patent 5,976,813. In this method, test samples are placed in a porous matrix. One or more assay components are then placed within, on top of, or at the bottom of a matrix such as a gel, a plastic sheet, a filter, or other form of easily manipulated solid support.

When samples are introduced to the porous matrix they diffuse sufficiently slowly, such that the assays can be performed without the test samples running together.

Binding Assays For binding assays, the test compound is preferably a small molecule which binds to and occupies the active site of the NIP 45 V polypeptide, thereby making the active site inaccessible or accessible to substrate (e. g., NFATp) such that normal biological

activity is prevented. Examples of such small molecules include, but are not limited to, small peptides or peptide-like molecules.

In binding assays, either the test compound or the NIP 45 V polypeptide can comprise a detectable label, such as a fluorescent, radioisotopic, chemiluminescent, or enzymatic label, such as horseradish peroxidase, alkaline phosphatase, or luciferase. Detection of a test compound which is bound to the NIP 45 V poly- peptide can then be accomplished, for example, by direct counting of radio- emmission, by scintillation counting, or by determining conversion of an appropriate substrate to a detectable product.

Alternatively, binding of a test compound to an NIP 45 V polypeptide can be determined without labeling either of the interactants. For example, a micro- physiometer can be used to detect binding of a test compound with an NIP\ 45 V polypeptide. A microphysiometer (e. g., Cytosensor) is an analytical instrument that measures the rate at which a cell acidifies its environment using a light- addressable potentiometric sensor (LAPS). Changes in this acidification rate can be used as an indicator of the interaction between a test compound and an NIP 45 V polypeptide (McConnell et al., Science 257, 1906-1912,1992).

Determining the ability of a test compound to bind to an NIP 45 V polypeptide also can be accomplished using a technology such as real-time Bimolecular Interaction Analysis (BIA) (Sjolander & Urbaniczky, Anal. Chem. 63, 2338-2345,1991, and Szabo et al., Curr. Opin. Struct. Biol. 5, 699-705,1995). BIA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e. g., BIAcore). Changes in the optical phenomenon surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.

In yet another aspect of the invention, an NIP 45 V polypeptide can be used as a"bait protein"in a two-hybrid assay or three-hybrid assay (see, e. g., U. S. Patent 5,283,317;

Zervos et al., Cell 72,223-232,1993; Madura et al., J. Biol. Chem. 268, 12046- 12054,1993; Bartel et al., Biotechniques 14, 920-924,1993; Iwabuchi et al., Oncogene 8, 1693-1696,1993; and Brent W094/10300), to identify other proteins which bind to or interact with the NIP 45 V polypeptide and modulate its activity.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. For example, in one construct, polynucleotide encoding an NIP45 V polypeptide can be fused to a polynucleotide encoding the DNA binding domain of a known transcription factor (e. g., GAL-4). In the other construct a DNA sequence that encodes an unidentified protein ("prey"or"sample") can be fused to a polynucleotide that codes for the activation domain of the known transcription factor. If the"bait"and the"prey"proteins are able to interact in vivo to form an protein-dependent complex, the DNA-binding and activation domains, of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e. g., LacZ), which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected, and cell colonies containing the functional tran- scription factor can be isolated and used to obtain the DNA sequence encoding the protein which interacts with the NIP 45 V polypeptide.

It may be desirable to immobilize either the NIP 45 V polypeptide (or polynucleotide) or the test compound to facilitate separation of bound from unbound forms of one or both of the interactants, as well as to accommodate automation of the assay. Thus, either the NIP 45 V polypeptide (or polynucleotide) or the test com- pound can be bound to a solid support. Suitable solid supports include, but are not limited to, glass or plastic slides, tissue culture plates, microtiter wells, tubes, silicon chips, or particles such as beads (including, but not limited to, latex, polystyrene, or glass beads). Any method known in the art can be used to attach the NIP 45 V polypeptide (or polynucleotide) or test compound to a solid support, including use of covalent and non-covalent linkages, passive absorption, or pairs of binding moieties attached respectively to the polypeptide (or polynucleotide) or test compound and the

solid support. Test compounds are preferably bound to the solid support in an array, so that the location of individual test compounds can be tracked. Binding of a test compound to an NIP 45 V polypeptide (or polynucleotide) can be accomplished in any vessel suitable for containing the reactants. Examples of such vessels include microtiter plates, test tubes, and microcentrifuge tubes.

In one embodiment, the NIP 45 V polypeptide is a fusion protein comprising a domain that allows the NIP 45 V polypeptide to be bound to a solid support. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtiter plates, which are then combined with the test compound or the test compound and the non-adsorbed NIP 45 V polypeptide ; the mixture is then incubated under conditions conducive to complex formation (e. g., at physiological conditions for salt and pH). Following incubation, the beads or microtiter plate wells are washed to remove any unbound components. Binding of the interactants can be determined either directly or indirectly, as described above. Alternatively, the complexes can be dissociated from the solid support before binding is determined.

Other techniques for immobilizing proteins or polynucleotides on a solid support also can be used in the screening assays of the invention. For example, either an NIP 45 V polypeptide (or polynucleotide) or a test compound can be immobilized utilizing conjugation of biotin and streptavidin. Biotinylated NIP 45 V polypeptides (or polynucleotides) or test compounds can be prepared from biotin-NHS (N-hydroxy- succinimide) using techniques well known in the art (e. g., biotinylation kit, Pierce Chemicals, Rockford, 111.) and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical). Alternatively, antibodies which specifically bind to an NIP 45 V polypeptide, polynucleotide, or a test compound, but which do not interfere with a desired binding site, such as the active site of the NIP 45 V polypeptide, can be derivatized to the wells of the plate. Unbound target or protein can be trapped in the wells by antibody conjugation.

Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using anti- bodies which specifically bind to the NIP 45 V polypeptide or test compound, enzyme-linked assays which rely on detecting an activity of the NIP 45 V poly- peptide, and SDS gel electrophoresis under non-reducing conditions.

Screening for test compounds which bind to an NIP45 V polypeptide or polynucleotide also can be carried out in an intact cell. Any cell which comprises an NIP45 V polypeptide or polynucleotide can be used in a cell-based assay system. An NIP 45 V polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Binding of the test compound to an NIP 45 V polypeptide or polynucleotide is determined as described above.

Functional Ass Test compounds can be tested for the ability to increase or decrease a biological effect of an NIP 45 V polypeptide. Such biological effects can be determined using the functional assays described in the specific examples, below. Functional assays can be carried out after contacting either a purified NIP45 V polypeptide, a cell membrane preparation, or an intact cell with a test compound. A test compound which decreases a functional activity of an NIP 45 V by at least about 10, preferably about 50, more preferably about 75,90, or 100% is identified as a potential agent for decreasing NIP 45 V activity. A test compound which increases NIP 45 V activity by at least about 10, preferably about 50, more preferably about 75,90, or 100% is identified as a potential agent for increasing NIP 45 V activity.

One such screening procedure involves the use of B-lymphoma cells which are transfected to express an NIP 45 V polypeptide. For example, such an assay may be employed for screening for a compound which inhibits activation of the polypeptide by exposing the transfected B-lymphoma cells which comprise the polypeptide with both endogenously interacting proteins or substrates to a test compound to be

screened. Inhibition of the activity of the polypeptide indicates that a test compound is a potential antagonist for the polypeptide, i. e., inhibits the function of the protein.

The screen may be employed for identifying a test compound which activates the protein by exposing such cells to compounds to be screened and determining whether each test compound activates the protein.

Other screening techniques include the use of cells which express a human NIP 45 V polypeptide (for example, transfected T cells) in a system which measures amounts of secreted proteins generated by polypeptide activation. For example, test compounds may be added to cells that express a human NIP45 V polypeptide and the expression of a reporter gene with specific promoter sequences can be measured to determine whether the test compound activates or inhibits the protein.

Details of functional assays, such as those described above, are provided in the specific examples below.

NIP 45 V Gene Expression In another embodiment, test compounds which increase or decrease NIP 45 V gene expression are identified. An NIP 45 V polynucleotide is contacted with a test compound, and the expression of an RNA or polypeptide product of the NIP 45 V polynucleotide is determined. The level of expression of appropriate mRNA or polypeptide in the presence of the test compound is compared to the level of expression of mRNA or polypeptide in the absence of the test compound. The test compound can then be identified as a modulator of expression based on this comparison. For example, when expression of mRNA or polypeptide is greater in the presence of the test compound than in its absence, the test compound is identified as a stimulator or enhancer of the mRNA or polypeptide expression. Alternatively, when expression of the mRNA or polypeptide is less in the presence of the test compound than in its absence, the test compound is identified as an inhibitor of the mRNA or polypeptide expression.

The level of NIP 45 V mRNA or polypeptide expression in the cells can be determined by methods well known in the art for detecting mRNA or polypeptide.

Either qualitative or quantitative methods can be used. The presence of polypeptide products of an NIP 45 V polynucleotide can be determined, for example, using a variety of techniques known in the art, including immunochemical methods such as radioimmunoassay, Western blotting, and immunohistochemistry. Alternatively, polypeptide synthesis can be determined in vivo, in a cell culture, or in an in vitro translation system by detecting incorporation of labeled amino acids into an NIP 45 V polypeptide.

Such screening can be carried out either in a cell-free assay system or in an intact cell. Any cell which expresses an NIP 45 V polynucleotide can be used in a cell- based assay system. The NIP 45 V polynucleotide can be naturally occurring in the cell or can be introduced using techniques such as those described above. Either a primary culture or an established cell line, such as CHO or human embryonic kidney 293 cells, can be used.

Pharmaceutical Compositions The invention also provides pharmaceutical compositions which can be administered to a patient to achieve a therapeutic effect. Pharmaceutical compositions of the invention can comprise, for example, an NIP 45 V polypeptide, NIP 45 V polynucleotide, antibodies which specifically bind to an NIP 45 V polypeptide, or mimetics, enhancers and inhibitors, or inhibitors of an NIP45 V polypeptide activity.

The compositions can be administered alone or in combination with at least one other agent, such as stabilizing compound, which can be administered in any sterile, biocompatible pharmaceutical carrier, including, but not limited to, saline, buffered saline, dextrose, and water. The compositions can be administered to a patient alone, or in combination with other agents, drugs or hormones.

In addition to the active ingredients, these pharmaceutical compositions can contain suitable pharmaceutically-acceptable carriers comprising excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Pharmaceutical compositions of the invention can be administered by any number of routes including, but not limited to, oral, intravenous, intramuscular, intra-arterial, intramedullary, intrathecal, intraventricular, transdermal, subcutaneous, intraperitoneal, intranasal, parenteral, topical, sublingual, or rectal means. Pharmaceutical compositions for oral administration can be formulated using pharmaceutically acceptable carriers well known in the art in dosages suitable for oral administration. Such carriers enable the pharmaceutical compositions to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for ingestion by the patient.

Pharmaceutical preparations for oral use can be obtained through combination of active compounds with solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are carbohydrate or protein fillers, such as sugars, including lactose, sucrose, mannitol, or sorbitol; starch from corn, wheat, rice, potato, or other plants; cellulose, such as methyl cellulose, hydroxypropylmethyl-cellulose, or sodium carboxymethylcellulose; gums including arabic and tragacanth; and proteins such as gelatin and collagen. If desired, disintegrating or solubilizing agents can be added, such as the cross-linked polyvinyl pyrrolidone, agar, alginic acid, or a salt thereof, such as sodium alginate.

Dragee cores can be used in conjunction with suitable coatings, such as concentrated sugar solutions, which also can contain gum arabic, talc, polyvinylpyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments can be added to the tablets or dragee coatings for product identification or to characterize the quantity of active compound, i. e., dosage.

Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a coating, such as glycerol or sorbitol. Push-fit capsules can contain active ingredients mixed with a filler or binders, such as lactose or starches, lubricants, such as talc or magnesium stearate, and, optionally, stabilizers. In soft capsules, the active compounds can be dissolved or suspended in suitable liquids, such as fatty oils, liquid, or liquid polyethylene glycol with or without stabilizers.

Pharmaceutical formulations suitable for parenteral administration can be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hanks' solution, Ringer's solution, or physiologically buffered saline. Aqueous injection suspensions can contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Additionally, suspensions of the active compounds can be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes.

Non-lipid polycationic amino polymers also can be used for delivery. Optionally, the suspension also can contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions. For topical or nasal administration, penetrants appropriate to the particular barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.

The pharmaceutical compositions of the present invention can be manufactured in a manner that is known in the art, e. g., by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes. The pharmaceutical composition can be provided as a salt and can be formed with many acids, including but not limited to, hydrochloric, sulfuric, acetic, lactic, tartaric, malic, succinic, etc. Salts tend to be more soluble in aqueous or other protonic solvents than are the corresponding free base forms. In other cases, the preferred preparation can be a lyophilized powder which can contain

any or all of the following: 1-50 mM histidine, 0.1%-2% sucrose, and 2-7% mannitol, at a pH range of 4.5 to 5.5, that is combined with buffer prior to use.

Further details on techniques for formulation and administration can be found in the latest edition of REMINGTON'S PHARMACEUTICAL SCIENCES (Maack Publishing Co., Easton, Pa.). After pharmaceutical compositions have been prepared, they can be placed in an appropriate container and labeled for treatment of an indicated condition. Such labeling would include amount, frequency, and method of administration.

Therapeutic Indications and Methods NIP 45 variant of the present invention is responsible for many biological functions, including many pathologies. Accordingly, it is desirable to find compounds and drugs which stimulate NIP 45 variant on the one hand and which can inhibit the function of a NIP 45 variant on the other hand. Compounds which can modulate the function or expression of NIP 45 variant are useful in treating various allergic diseases, autoimmune diseases, inflammatory deseases, and infectious deseases including asthma, allergic rhinitis, atopic dermatitis, hives, conjunctivitis, vernal catarrh, chronic arthrorheumatism, systemic lupus erythematosus, myasthenia gravis, psoriasis, diabrotic colitis, systemic inflammatory response syndrome (SIRS), llymphofollicular thymitis, sepsis, polymyositis, dermatomyositis, polyaritis nodoa, mixed connective tissue disease (MCTD), Sjoegren's syndrome, gout, and the like.

This invention further pertains to the use of novel agents identified by the screening assays described above. Accordingly, it is within the scope of this invention to use a test compound identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e. g., a modulating agent, an antisense nucleic acid molecule, a specific antibody, ribozyme, or an NIP 45 V polypeptide binding molecule) can be used in an animal model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an

agent identified as described herein can be used in an animal model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above-described screening assays for treatments as described herein.

A reagent which affects NIP45 variant activity can be administered to a human cell, either in vitro or in vivo, to reduce NIP 45 V like activity. The reagent preferably binds to an expression product of a human NIP45 variant gene. If the expression product is a protein, the reagent is preferably an antibody. For treatment of human cells ex vivo, an antibody can be added to a preparation of stem cells which have been removed from the body. The cells can then be replaced in the same or another human body, with or without clonal propagation, as is known in the art.

In one embodiment, the reagent is delivered using a liposome. Preferably, the liposome is stable in the animal into which it has been administered for at least about 30 minutes, more preferably for at least about 1 hour, and even more preferably for at least about 24 hours. A liposome comprises a lipid composition that is capable of targeting a reagent, particularly a polynucleotide, to a particular site in an animal, such as a human. Preferably, the lipid composition of the liposome is capable of targeting to a specific organ of an animal, such as the lung, liver, spleen, heart brain, lymph nodes, and skin.

A liposome useful in the present invention comprises a lipid composition that is capable of fusing with the plasma membrane of the targeted cell to deliver its contents to the cell. Preferably, the transfection efficiency of a liposome is about 0.5 ig of DNA per 16 nmole of liposome delivered to about 106 cells, more preferably about 1.0 gag of DNA per 16 nmole of liposome delivered to about 106 cells, and even more preferably about 2.0 pg of DNA per 16 nmol of liposome delivered to about 106 cells. Preferably, a liposome is between about 100 and

500 nm, more preferably between about 150 and 450 nm, and even more preferably between about 200 and 400 nm in diameter.

Suitable liposomes for use in the present invention include those liposomes standardly used in, for example, gene delivery methods known to those of skill in the art. More preferred liposomes include liposomes having a polycationic lipid composition and/or liposomes having a cholesterol backbone conjugated to polyethylene glycol. Optionally, a liposome comprises a compound capable of targeting the liposome to a tumor cell, such as a tumor cell ligand exposed on the outer surface of the liposome.

Complexing a liposome with a reagent such as an antisense oligonucleotide or ribozyme can be achieved using methods which are standard in the art (see, for example, U. S. Patent 5,705,151). Preferably, from about 0.1 Slg to about 10 u. g of polynucleotide is combined with about 8 nmol of liposomes, more preferably from about 0.5 ug to about 5 ug of polynucleotides are combined with about 8 nmol liposomes, and even more preferably about 1. zug of polynucleotides is combined with about 8 nmol liposomes.

In another embodiment, antibodies can be delivered to specific tissues in vivo using protein-mediated targeted delivery. Protein-mediated DNA delivery techniques are taught in, for example, Findeis et al. Trends in Biotechnol. 11, 202-OS (1993); Chiou et al., GENE THERAPEUTICS: METHODS AND APPLICATIONS OF DIRECT GENE TRANSFER (J. A. Wolff, ed.) (1994); Wu & Wu, J. Biol. Chem. 263, 621-24 (1988) ; Wu et al., J. Biol. Chem. 269, 542-46 (1994); Zenke et al., Proc. Natl. Acad. Sci.

U. S. A. 87, 3655-59 (1990); Wu et al., J. Biol. Chem. 266, 338-42 (1991).

Determination of a Therapeutically Effective Dose

The determination of a therapeutically effective dose is well within the capability of those skilled in the art. A therapeutically effective dose refers to that amount of active ingredient which increases or decreases NIP 45 V activity relative to the NIP 45 V activity that occurs in the absence of the therapeutically effective dose.

For any compound, the therapeutically effective dose can be estimated initially either in cell culture assays or in animal models, usually mice, rabbits, dogs, or pigs. The animal model also can be used to determine the appropriate concentration range and route of administration. Such information can then be used to determine useful doses and routes for administration in humans.

Therapeutic efficacy and toxicity, e. g., EDO (the dose therapeutically effective in 50% of the population) and LD50 (the dose lethal to 50% of the population), can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. The dose ratio of toxic to therapeutic effects is the therapeutic index, and it can be expressed as the ratio, LDo/ED.

Pharmaceutical compositions which exhibit large therapeutic indices are preferred.

The data obtained from cell culture assays and animal studies is used in formulating a range of dosage for human use. The dosage contained in such compositions is preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage varies within this range depending upon the dosage form employed, sensitivity of the patient, and the route of administration.

The exact dosage will be determined by the practitioner, in light of factors related to the subject that requires treatment. Dosage and administration are adjusted to provide sufficient levels of the active ingredient or to maintain the desired effect.

Factors which can be taken into account include the severity of the disease state, general health of the subject, age, weight, and gender of the subject, diet, time and frequency of administration, drug combination (s), reaction sensitivities, and tolerance/response to therapy. Long-acting pharmaceutical compositions can be

administered every 3 to 4 days, every week, or once every two weeks depending on the half-life and clearance rate of the particular formulation.

Normal dosage amounts can vary from 0.1 to 100,000 micrograms, up to a total dose of about 1 g, depending upon the route of administration. Guidance as to particular dosages and methods of delivery is provided in the literature and generally available to practitioners in the art. Those skilled in the art will employ different formulations for nucleotides than for proteins or their inhibitors. Similarly, delivery of poly- nucleotides or polypeptides will be specific to particular cells, conditions, locations, etc.

If the reagent is a single-chain antibody, polynucleotides encoding the antibody can be constructed and introduced into a cell either ex vivo or in vivo using well- established techniques including, but not limited to, transferrin-polycation-mediated DNA transfer, transfection with naked or encapsulated nucleic acids, liposome- mediated cellular fusion, intracellular transportation of DNA-coated latex beads, protoplast fusion, viral infection, electroporation,"gene gun,"and DEAE-or calcium phosphate-mediated transfection.

Effective in vivo dosages of an antibody are in the range of about 5 gag to about 50 ug/kg, about 50 llg to about 5 mg/kg, about 100 u. g to about 500, ug/kg of patient body weight, and about 200 to about 250 ug/kg of patient body weight. For administration of polynucleotides encoding single-chain antibodies, effective in vivo dosages are in the range of about 100 ng to about 200 ng, 500 ng to about 50 mg, about 1 ug to about 2 mg, about 5 u. g to about 500 u. g, and about 20 ug to about 100 pg of DNA.

If the expression product is mRNA, the reagent is preferably an antisense oligonucleotide or a ribozyme. Polynucleotides which express antisense oligo-

nucleotides or ribozymes can be introduced into cells by a variety of methods, as described above.

Preferably, a reagent reduces expression of an NIP 45 V gene or the activity of an NIP 45 V polypeptide by at least about 10, preferably about 50, more preferably about 75,90, or 100% relative to the absence of the reagent. The effectiveness of the mechanism chosen to decrease the level of expression of an NIP 45 V gene or the activity of an NIP 45 V polypeptide can be assessed using methods well known in the art, such as hybridization of nucleotide probes to NIP 45 V-specific mRNA, quantitative RT-PCR, immunologic detection of an NIP 45 V polypeptide, or measurement of NIP 45 V activity.

In any of the embodiments described above, any of the pharmaceutical compositions of the invention can be administered in combination with other appropriate therapeutic agents. Selection of the appropriate agents for use in combination therapy can be made by one of ordinary skill in the art, according to conventional pharmaceutical principles. The combination of therapeutic agents can act synergisti- cally to effect the treatment or prevention of the various disorders described above.

Using this approach, one may be able to achieve therapeutic efficacy with lower dosages of each agent, thus reducing the potential for adverse side effects.

Any of the therapeutic methods described above can be applied to any subject in need of such therapy, including, for example, mammals such as dogs, cats, cows, horses, rabbits, monkeys, and most preferably, humans.

Diagnostic Methods NIP 45 variant also can be used in diagnostic assays for detecting diseases and abnormalities or susceptibility to diseases and abnormalities related to the presence of mutations in the nucleic acid sequences which encode a NIP 45 variant. Such diseases, by way of example, are related to various allergic diseases, autoimmune

diseases, inflammatory deseases, and infectious deseases including asthma, allergic rhinitis, atopic dermatitis, hives, conjunctivitis, vernal catarrh, chronic arthro- rheumatism, systemic lupus erythematosus, myasthenia gravis, psoriasis, diabrotic colitis, systemic inflammatory response syndrome (SIRS), llymphofollicular thymitis, sepsis, polymyositis, dermatomyositis, polyaritis nodoa, mixed connective tissue disease (MCTD), Sjoegren's syndrome, gout, and the like.

Differences can be determined between the cDNA or genomic sequence encoding a NIP 45 variant in individuals afflicted with a disease and in normal individuals. If a mutation is observed in some or all of the afflicted individuals but not in normal individuals, then the mutation is like ly to be the causative agent of the disease.

Sequence differences between a reference gene and a gene having mutations can be revealed by the direct DNA sequencing method. In addition, cloned DNA segments can be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer can be used with a double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures using radiolabeled nucleotides or by automatic sequencing procedures using fluorescent tags.

Genetic testing based on DNA sequence differences can be carried out by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized, for example, by high resolution gel electrophoresis. DNA fragments of different sequences can be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e. g., Myers et al., Science 230, 1242,1985). Sequence changes at specific locations can also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (e. g., Cotton et al., Proc. Natl. Acad. Sci. USA 85, 4397-

4401,1985). Thus, the detection of a specific DNA sequence can be performed by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes and Southern blotting of genomic DNA.

In addition to direct methods such as gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.

Altered levels of a NIP 45 variant also can be detected in various tissues. Assays used to detect levels of the protein polypeptides in a body sample, such as blood or a tissue biopsy, derived from a host are well known to those of skill in the art and include radioimmunoassays, competitive binding assays, Western blot analysis, and ELISA assays.

All patents and patent applications cited in this disclosure are expressly incorporated herein by reference. The above disclosure generally describes the present invention.

A more complete understanding can be obtained by reference to the following specific examples which are provided for purposes of illustration only and are not intended to limit the scope of the invention.

EXAMPLE 1 The murine NIP45 mRNA sequence (GenBank accession number U76759) was used to search the EST subset of the DNA DataBank of Japan (DDBJ) for homologous sequences using the computer program BLAST 2.0 (National Center for Biotechnology Information). Five sequences were found that had over 75% nucleo- tide sequence identity with the murine NIP45 mRNA sequence and these were selected as potential fragments of the human NIP45 mRNA sequence. The five sequences were GenBank accession numbers AI954626, AA919081, AA063239, AA351060, and AA352196. To gather further sequence information on the potential human NIP45 mRNA sequence, the five sequences were themselves used to search the DDBJ for homologous sequences. As a result of the second search, an additional EST, GenBank accession number T56384, was identified. A third search with the

T56384 EST was then performed and identified one additional EST, GenBank accession number W31117.

Clones containing four of the ESTs were purchased from Genome Systems (St.

Louis, MO, USA) for further sequence evaluation. The full inserts of EST clones AA919081, AA063239, T56384, and W31117 were sequenced on a ABI Prism 377 DNA sequencer (PE Biosystems) according to the manufacturer's standard sequencing protocol using primers complemetary to the T3 and T7 promoter regions flanking the insert on each vector. After full sequences were obtained, the sequences of all seven ESTs were aligned using the computer program Sequencher (GeneCodes Corporation, Ann Arbor, MI, USA), forming a contiguous sequence of DNA. The consensus sequence of this contig was considered to represent the human NIP45 mRNA sequence. Nucleotide sequences of human NIP 45 is depicted in SEQ ID NO. 6. The open reading frame of the native human homologue of NIP 45 is composed of 1260 nucleotides (SEQ ID NO. 7).

EXAMPLE 2 Identification of the alternative splice variants of NIP45 To test for expression of NIP45 in various tissue types, PCR amplification of a 368 base pair region of the human NIP45 cDNA was carried out using the oligonucleo- tide primers NIP-11 (cccgactcttcccactcaaaatcc, corresponding to 797-820 position of the sequence depicted in SEQ ID NO. 6) and NIP12 (cagtcccatggcctcctcatagtg, corresponding to 1141-1164 position of the sequence depicted in SEQ ID NO. 6) and the Human Immune System Multiple Tissue cDNA Panel (Clontech Laboratories, Inc, Palo Alto, CA, USA) as template. Amplification was performed with AmpliTaq Gold DNA polymerase (Perkin-Elmer) under the following PCR cycling conditions: Denaturation of template DNA for 9 minutes at 96°C followed by a cycling between 96°C for 15 seconds and 66°C for 30 seconds repeated 55 times. As shown in Fig. 13, PCR amplification of NIP45 cDNA derived from bone marrow, fetal liver, and

peripheral blood leukocytes gave the expected 368 base pair product, whereas PCR amplification of NIP45 cDNA derived from lymph node and thymus gave a much shorter product and PCR amplification of NIP45 cDNA derived from spleen gave both the 368 base pair product and the shorter product.

Direct sequencing of the shorter PCR product were carried out on a ABI Prism 377 DNA sequencer (PE Biosystems) as described in Example 1 except using primers NIP-11 and NIP12. The shorter length of the product was due to the absence of a stretch of 255 base pairs compared to the NIP45 DNA sequence. Alignment of the shorter PCR product with the NIP45 DNA sequence and a genomic sequence fragment derived from the NIP45 gene indicated that the boundaries of the 255 bp of deleted sequence correspond exactly with the boundaries of two exons contained within the genomic sequence fragment. This splice variant was designated NIP45vl.

Nucleotide sequences of cDNA prepared from mRNAs of human NIP 45V1 is depicted in SEQ ID NO. 1.

Subsequent PCR amplification of the full coding region of NIP45 using spleen cDNA from the above panel as template and oligonucleotide primers NIP-L4 (aaagtgtgccatggcggagcctgt, corresponding to position 3-26 of the sequence depicted in SEQ ID NO. 6) and NIP-R4 (gggtgtcagccccagacctcaat, corresponding to position 1255-1277 of SEQ ID NO. 6) produced several differently sized amplimers. The amplimers were cloned into the cloning vector pCRII-TOPO (Invitrogen Corp., Carlsbad, CA, USA) and sequenced on an ABI Prism 377 DNA sequencer (Applied Biosystems, Foster City, CA, USA). Analysis of the sequences obtained revealed three additional alternative splice variants, designated NIP45v2, NIP45v3, and NIP45v4, respectively.

Properties of the NIP45vl cDNA nucleotide sequence (SEQ ID NO. 1 and 2) 1. Deletion of 255 base pairs corresponding to bases 847 through 1101 of the coding sequence of the full NIP45 transcript.

2. Deleted region corresponds precisely to two exons when compared with a partial genomic sequence of the NIP45 gene (clone RPCI-11-449D23, genomic survey sequence, Accession number AQ584348), indicating that the deletion is due to an alternative splicing event.

Properties of the NIP45vl amino acid sequence (SEQ ID NO. 8) 1. Conceptual translation gives a protein of 334 amino acids in length, 85 amino acid residues shorter than the full length NIP45 protein of 419 amino acids.

2. Amino acid residues missing in the conceptual translation of NIP45vl correspond to amino acid residues 283 through 367 of the full-length NIP45 protein.

Properties of the NIP45v2 cDNA nucleotide sequence (SEQ ID NO. 3) 1. Deletion of 145 base pairs corresponding to bases 847 through 991 of the coding sequence of the full NIP45 transcript.

2. Deleted region corresponds precisely to one exon when compared with a partial genomic sequence of the NIP45 gene (clone RPCI-11-449D23, genomic survey sequence, Accession number AQ584348), indicating that the deletion is due to an alternative splicing event.

Properties of the NIP45v2 amino acid sequence (SEQ ID NO-9) 1. Conceptual translation gives a protein of 287 amino acids in length, 132 amino acid residues shorter than the full length NIP45 protein of 419 amino acids due to both the deletion and a consequent frameshift that introduces an earlier occurring stop codon.

2. Amino acid residues missing in the conceptual translation of NIP45v2 correspond to amino acid residues 283 through to the end of the full-length NIP45 protein.

Properties of the NIP45v3 cDNA nucleotide sequence (SEQ ID NO. 4) 1. Deletion of 347 base pairs corresponding to bases 41 through 387 of the coding sequence of the full NIP45 transcript. This introduces a frame shift which necessitates the use of an different start codon from the original NIP45 transcript.

2. The 3'end of the deleted region corresponds precisely to an intron-exon boundary when compared with partial genomic sequences of the NIP45 gene (genomic survey sequence, Accession number AQ321005; genomic survey sequence, Accession number AQ709994), indicating that the deletion is due to an alternative splicing event.

Properties of the NIP45v3 amino acid sequence (SEQ ID NO. 10) 1. Conceptual translation gives a protein of 304 amino acids in length, 115 amino acid residues shorter than the full length NIP45 protein of 419 amino acids ; however the start codon has not yet been identified and exists an unknown number of basepairs 5'of the position of the original NIP45 start

codon. The protein produced by this transcript will therefore be longer than 304 amino acid residues in length.

2. Amino acid residues missing in the conceptual translation of NIP45v3 correspond to the first 129 amino acid residues of the full-length NIP45 protein.

Properties of the NIP45v4 cDNA nucleotide sequence (SEQ ID NO. 5) 1. Deletion of 988 base pairs corresponding to bases 41 through 387 and 461 through 1101 of the coding sequence of the full NIP45 transcript. The deletion introduces a frameshift that changes the start codon to one located at position 452 of the coding sequence of the full NIP45 transcript.

2. The 3'end of the first deleted region and the 5'end of the second deleted region correspond precisely to intron-exons boundary when compared with partial genomic sequences of the NIP45 gene (genomic survey sequence, Accession number AQ321005 ; genomic survey sequence, Accession number AQ709994), indicating that the deletions are due to an alternative splicing event.

Properties of the NIP45v4 amino acid sequence (SEQ ID NO. 11) 1. Conceptual translation gives a protein of 55 amino acids in length, 364 amino acid residues shorter than the full length NIP45 protein of 419 amino acids.

2. Amino acid residues missing in the conceptual translation of NIP45v4 correspond to amino acid residues 1 through 367 of the full-length NIP45 protein.

Properties of the spliced-out regions The NIP45 protein sequence has significant homology to UBL1 and SMT3H2, ubiquitin-like proteins also known as Sentrin and Sentrin2. This Sentrin-homologous domain of NIP45 extends from amino acid residues 342 to 418 and contains 44 of 77 residues (56%) that are similar to the SMT3H2 sequence, among which 28 of 77 residues (36%) are identical to the SMT3H2 sequence as identified by the BLAST sequence similarity searching software (National Center for Biotechnology Information). NIP45 also has a region of homology with Ubiquitin from amino residues 274 to 334, showing an 84. 7% alignment against a position specifc scoring matrix for Ubiquitin homologs in the Conserved Domain Database of the National Center for Biotechnology Information. The Sentrin-homologous domain is partially deleted in NIP45vl and NIP45v4, and entirely deleted in NIP45v2. The Ubiquitin- homologous domain is 85% deleted in NIP45vl and NIP45v2, and entirely deleted in NIP45v4.

Tissue distribution of NIP45vl The NIP45vl splice variant of NIP45 has only been found to be expressed in thymus, spleen, and lymph node, whereas NIP45 expression has been found in all immune related tissues tested to date, including bone marrow, fetal liver, lymph node, peripheral blood leukocytes, spleen, thymus, and tonsil.

EXAMPLE 3 Functional Characterization The functions of NIP 45 variants are assessed by their ability of specifically interacting with NF-ATp in mammalian cells. Each of the NIP 45 V cDNA inserts (VI-V4) obtained in Example 2 is subcloned into a mammalian expression vector which fuses the coding region to an epitope tag from a influenza hemagglutinin (HA) peptide, vector pCEP4-HA (Herrscher, R. F. et al. (1995) Genes Dev. 9: 3067-3082), to create the expression vector.

The vector is then cotransfected with an NF-ATp expression plasmid into HepG2 cells expressing low levels of NF-ATp. As controls, HepG2 cells also are cotransfected with NIP45-HA along with the expression vector without the NF-ATp insert or with the NF-ATp expression vector along with an out of frame fusion of NIP45 with the epitope tag. Lysates are prepared from the transfected cells and immunoprecipitated with anti-NF-ATp antibody. Western blot analysis are then performed on the immunprecipitated material using either anti-NF-ATp or anti-HA antibodies and it is seen that NF-AT and NIP 45 variant physically associate in vivo in mammalian cells.

EXAMPLE 4 Tissue Expression of NIP 45 V2-V4 mRNA Quantitative reverse transcription-polymerase chain reaction (RT-PCR) analysis of RNA from different human tissues is performed to investigate the tissue expression of NIP 45 V2-4 mRNA. 100. mu. g of total RNA from various tissues (Human Total RNA Panel I-V, Clontech Laboratories, Palo Alto, CA, USA) is used as a template to synthsize first-strand cDNA using the SUPERSCRIPTTM First-Strand Syntheswas System for RT-PCR (Life Technologies, Rockville, MD, USA). 10 ng of the first-

strand cDNA is then used as template in a polymerase chain reaction to test for the presence of the NIP 45 V mRNA transcript. The polymerase chain reaction is performed in a LightCycler (Roche Molecular Biochemicals, Indianapolis, IN, USA), in the presence of the DNA-binding fluorescent dye SYBR Green I which binds to the minor groove of the DNA double helix, produced only when double-stranded DNA is successfully synthesized in the reaction, and upon binding, emits light that can be quantitatively measured by the LightCycler machine. The polymerase chain reaction is carried out using oligonucleotide primers designed to span the junction of spliced exons flanking deleted regions and measurements of the intensity of emitted light are taken following each cycle of the reaction when the reaction reach a temperature of 86 degrees C. Intensities of emitted light are converted into copy numbers of the gene transcript per nanogram of template cDNA by comparison with simultaneously reacted standards of known concentration.

To correct for differences in mRNA transcription levels per cell in the various tissue types, a normalization procedure is performed using calculated expression levels in the various tissues of five different housekeeping genes: glyceraldehyde-3- phosphatase (G3PHD), hypoxanthine guanine phophoribosyl transferase (HPRT), beta-actin, porphobilinogen deaminase (PBGD), and beta-2-microglobulin. Except for the use of a slightly different set of housekeeping genes, the normalization procedures is essentially the same as that described in the RNA Master Blot User Manual, Apendix C (Clontech Laboratories, Palo Alto, CA, USA).

EXAMPLE 5 Functional Activity of NIP45 variants in Regulating Gene Expression To test for a functional role of NIP45 variants in NF-AT-driven transcription, each of the NIP45 Vs is expressed at high levels in HepG2 cells. HepG2 cells express low levels of endogenous NF-AT, and ectopic expression of NF-AT family member proteins has been shown to transactivate NF-AT-driven transcription in this cell line

in the absence of exogenous stimulation (Hoey, T. et al. (1995) Immunity 2: 461- 472). HepG2 cells are transfected with a 3X NF-AT-CAT reporter gene (Venkata- raman, L. et al. (1994) Immunity 1: 189-196) and either control or expression plasmids for NIP45 variants and NF-AT family members (NF-ATp, NF-ATc, NF- AT3, NF-AT4). This reporter gene contains three tandem copies of the NF-AT binding site derived from the IL-2 gene. Alternatively, Hep G2 cells are transfected with an IL-4-CAT reporter construct (extending to-732 bp of the IL-4 promoter and containing a native NF-AT-dependent promoter) and expression vectors or controls for NIP45 variants, NF-ATp, and c-maf. HepG2 cells are transfected by the DEAE- Dextran method as described in Hoey, T. et al. (1995) supra, and CAT assays are performed according to standard methodologies.

EXAMPLE 6 Endogenous IL-4 Production Expression of endogenous IL-4 by cells that do not normally produce IL-4 is examined to see if the combination of any of the NIP45 variants, NF-ATp and c-Maf is sufficient to induce the expression. M12 B lymphoma cells are transiently cotransfected with expression plasmids for NF-ATp and c-Maf together with NIP45 or pCI vector control. M12 cells are transiently transfected by electroporation as previously described (Ho, I. C. et al. (1996) Cell 85: 973-983). Levels of IL-4 in the supernatants harvested 72 hours later are measured by a commercially available IL-4 ELISA (Pharmingen), performed according to the manufacturer's instructions except with modification as described (Ho, 1. C. et al. (1996) supra).

EXAMPLE 7 Identification of a test compound which binds to a NIP 45 variant

Each of the purified NIP 45 V polypeptide comprising a glutathione-S-transferase protein and absorbed onto glutathione-derivatized wells of 96-well microtiter plates are contacted with test compounds from a small molecule library at pH 7.0 in a physiological buffer solution. NIP 45 V polypeptides comprise any of the amino acid sequence shown in SEQ ID NO. 8 to NO11. The test compounds comprise a fluorescent tag. The samples are incubated for 5 minutes to one hour. Control samples are incubated in the absence of a test compound.

The buffer solution containing the test compounds is washed from the wells.

Binding of a test compound to an NIP 45 V polypeptide is detected by fluorescence measurements of the contents of the wells. A test compound which increases the fluorescence in a well by at least 15% relative to fluorescence of a well in which a test compound is not incubated is identified as a compound which binds to an NIP 45 V polypeptide.

EXAMPLE 8 Identification of a test compound which modulates (increases or decreases) NIP 45 V gene expression A test compound is administered to a culture of human lymph node cells and incubated at 37°C for 10 to 45 minutes. A culture of the same type of cells incubated for the same time without the test compound provides a negative control.

RNA is isolated from the two cultures as described in Chirgwin et al., Biochem. 18, 5294-99,1979). Northern blots are prepared using 20 to 30 llg total RNA and hybridized with a 32P-labeled NIP 45 V-specific probe at 65°C in Express-hyb (CLONTECH). The probe comprises at least 11 contiguous nucleotides selected from the complement of SEQ ID NO. 1,2,3,4 or 5. A test compound which

modulates the NIP 45 V-specific signal relative to the signal obtained in the absence of the test compound is identified as an modulator of NIP 45 V gene expression.

EXAMPLE 9 Screening for a compound which modulates the interaction between NIP 45 variant and NF-AT can be done with the use of yeast two-hybrid system (s).

EXAMPLE 10 Treatment of immunologically related diseases by modulating the function of a human NIP 45 variant.

A polynucleotide which expresses a human NIP 45 variant or a compound, which modulate the function of NIP 45 variant is administered to a patient. The severity of the patient's inflammation is lessened.

EQUIVALENTS Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.