TMPRSS2 INHIBITORS AND METHODS OF USE CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The application claims the benefit of, and priority to, U.S.S.N. 63/284,728, filed December 1, 2021; and U.S.S.N. 63/412,769, filed October 3, 2022; the contents of each of which are incorporated herein by reference.

BACKGROUND

[0002] In the past two decades, severe acute respiratory syndrome coronavirus (SARS- CoV) and Middle East respiratory syndrome coronavirus (MERS-CoV) were transmitted from animals to humans, causing severe respiratory diseases SARS and MERS in endemic areas. In 2019, another coronavirus was discovered in patients with infectious respiratory disease to have the ability for human-to-human transmission. The disease, now termed coronavirus disease 2019 (COVID-19), has spread rapidly all over the world, resulting in a pandemic. COVID- 19 is induced by the pathogenic SARS-coronavirus 2 (SARS-CoV-2).

[0003] The serine protease, transmembrane serine protease 2 (TMPRSS2), a member of the type II transmembrane serine proteases (TTSPs), has been reported to be a host cell factor that is critical for the spread of several clinically relevant viruses, including coronaviruses and influenza A viruses. TMPRSS2 has been reported to cleave the surface glycoprotein haemagglutinin (HA) of influenza viruses with a monobasic cleavage site which is a prerequisite for virus fusion and propagation. It has been reported that host cell entry of coronaviruses depends upon binding of the viral spike (S) proteins to cellular receptors, and on S protein priming by host cell proteases: SARS-CoV-2 has been shown to use the SARS-CoV receptor angiotensin converting enzyme II (ACE2) for entry and can be blocked by an inhibitor of TMPRSS2 which is employed by SARS-CoV-2 for S protein priming, and entry. TMPRSS2 has also been reported to be dispensable for development and homeostasis and thus constitutes an attractive drug target. Therefore, inhibition of TMPRSS2 would promote a blockade of the viral entry, thereby rendering TMPRSS2 inhibitors as promising candidates for the treatment of SARS-CoV-2 infection.

[0004] Considering the high mortality rate of COVID-19, other corona- viral and other serious viral infections, the development of effective therapeutics is an urgent issue and requires the identification of quality targets. TMPRSS2s are one of the key initiating factors of the SARS-CoV-2 infection. Thus, inhibitors of TMPRSS2 exhibit a differentiated mechanism of action for antiviral intervention of the SARS-CoV-2, and TMPRSS2 inhibitors provide a novel treatment for COVID-19 patients.

SUMMARY

[0005] The disclosure is directed to, in part, inhibitors of transmembrane serine protease 2. Also provided are pharmaceutical compositions comprising at least one disclosed compound and a pharmaceutically acceptable carrier.

[0006] Provided herein, in part, are compounds represented by Formula I: wherein: A is selected from the group consisting of C _1-6 alkyl, C _3-6 cycloalkyl, phenyl, naphthyl, 5-6 membered heteroaryl, 9-10 membered bicyclic heterocyclyl and 9-10 membered bicyclic heteroaryl, wherein A is substituted by R ^g ; and A may be optionally substituted by an additional one, two, or three substituents each independently selected from R ^gg ; R ¹ is selected from hydrogen and C _1-6 alkyl; R ^g is selected from the group consisting of oxo, -N(R ⁱ R ^j ), -(C _1-6 alkyl)- N(R ⁱ R ^j ) and -C(O)-N(R ⁱ R ^j ); R ^gg for each occurrence, is selected from the group consisting of halogen, hydroxyl, oxo, C _1-3 alkyl (optionally substituted by one two or three halogens), - N(R ⁱ R ^j ), -(C _1-6 alkyl- N(R ⁱ R ^j ) and -C(O)-N(R ⁱ R ^j ) are each independently selected from the group consisting of hydrogen, C _1-6 alkyl, -C _1-6 alkyl-O-C _1-6 alkyl, -C(O)-C _1-6 alkyl, -

C(O)-C _1-6 alkyl-O-C _1-6 alkyl, -C(O)- C _3-6 cycloalkyl, -C _1-6 alkyl-(4-10 membered heterocyclyl), - C(O)-C _1-6 alkyl-(4-10 membered heterocyclyl), -C(O)-(4-10 membered heterocyclyl), -C(O)- phenyl, -C(O)-(5-6 membered heteroaryl optionally substituted with C _1-6 alkyl or C _2-6 alkene), Ci- ealkoxy, phenyl, 4-7 membered monocyclic heterocyclic ring and 8-10 membered bicyclic heterocyclic ring, wherein the phenyl may be optionally substituted by a monocyclic 4-7 membered heterocyclic ring optionally substituted by oxo; and wherein the phenyl, cycloalkyl, alkoxy, heterocyclic ring and C _1-6 alkyl for each occurrence is optionally substituted by one or more substituents each independently selected from halogen, hydroxyl, cyano, N(R ^m R ⁿ ), oxo, - S(O) _W C _1-3 alkyl (where w is 0, 1, or 2), C _1-3 alkoxy, and C _1-6 alkyl substituted by hydroxyl; or R ¹ and R ¹ taken together with the nitrogen to which they are attached to form a 4-7 membered monocyclic heterocyclic ring, which may have an additional heteroatom selected from O, S, and N, and wherein the 4-7 membered monocyclic heterocyclic ring may optionally be substituted on carbon by one or more substituents each independently selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl, C _1-3 alkyl-O-C _1-3 alkyl and C _1-6 alkoxy; R ^m and R ⁿ are each independently selected from hydrogen, C _1-6 alkyl, and S(O) _W C _1-3 alkyl (where w is 0, 1, or 2); or R ^m and R ⁿ taken together with the nitrogen to which they are attached to form a 4-7 membered monocyclic heterocyclic ring, which may have an additional heteroatom selected from O, S, and N, wherein the 4-7 membered monocyclic heterocyclic ring may optionally be substituted on carbon by one or more substituents each independently selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl and C _1-6 alkoxy; B is selected from the group consisting of 5-6 membered monocyclic heteroaryl, 8-10 membered bicyclic heteroaryl, and 8-10 membered bicyclic heterocyclyl, wherein ring B contains at least one nitrogen and is optionally substituted on one, two, or three carbons by a substituent each independently selected from R ^B ; R ^B for each occurrence, is selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl and Ci- ealkoxy; W is selected from phenyl and heteroaryl, wherein W is substituted on a carbon by a warhead moiety R ^w , wherein R ^w is selected from the group consisting of amidine, amidoxime, guanidine, and N-hydroxyguanidine and oxadiazole; and pharmaceutically acceptable salts, stereoisomers, esters or prodrugs thereof.

[0007] Also provided herein, in part, are compounds represented by Formula III:

(Formula III), wherein: R ¹ is selected from hydrogen and C _1-6 alkyl; R ³⁰ is selected from hydrogen and -OR ³¹ ; R ³¹ is selected from C _1-6 alkyl and 4-6 membered heterocyclic ring, wherein the C _1-6 alkyl is optionally substituted by one or more substituents each independently selected from hydroxyl, - NH ₂ , -OCH ₃ , -C(O)-NH ₂ , -NH-C(O)-NH(CH ₃ ), -NH-C(O)-CH ₃ , imidazolyl and pyrrolidinyl, R ^g is selected from the group consisting of -Co-ialkyl-DD, wherein DD is selected from the group consisting of phenyl, 5-6 membered heteroaryl, 4-8 membered heterocyclic, 8-10 membered bicyclic heteroaryl, and 4-7 membered carbocylic, wherein DD is optionally substituted by one, two, three or more substituents each independently selected from the group consisting of Ci- 4alkyl (optionally substituted by hydroxyl, cyano or halogen), hydroxyl, oxo, cyano, NR’R’ ’ (where R’ and R” are each independently H or methyl), halogen, and C _1-6 alkoxy (optionally substituted by hydroxyl, cyano or halogen); R ^H is hydrogen or hydroxyl, and pharmaceutically acceptable salts, stereoisomers, esters or prodrugs thereof.

[0008] Also provided herein, in part, are methods of treating a viral infection in a patient in need thereof, comprising administering to the patient an effective amount of a compound described herein. For example, provided herein is a method of treating a viral infection in a patient in need thereof, comprising inhibiting TMPRSS2 by administering a compound described herein.

DETAILED DESCRIPTION

[0009] The features and other details of the disclosure will now be more particularly described. Before further description of the present disclosure, certain terms employed in the specification, examples and appended claims are collected here. These definitions should be read in light of the remainder of the disclosure and as understood by a person of skill in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art.

Definitions

[00010] “Treating” includes any effect, e.g., lessening, reducing, modulating, or eliminating, that results in the improvement of the condition, disease, disorder and the like.

[00011] The term “alkenyl” as used herein refers to an unsaturated straight or branched hydrocarbon having at least one carbon-carbon double bond. Exemplary alkenyl groups include, but are not limited to, a straight or branched group of 2-6 or 3-4 carbon atoms, referred to herein as C _2-6 alkenyl, and C _1-4 alkenyl, respectively. Exemplary alkenyl groups include, but are not limited to, vinyl, allyl, butenyl, pentenyl, etc.

[00012] The term “alkoxy” as used herein refers to a straight or branched alkyl group attached to oxygen (alkyl-O-). Exemplary alkoxy groups include, but are not limited to, alkoxy groups of 1-6 or 2-6 carbon atoms, referred to herein as C _1-6 alkoxy, and C _2-6 alkoxy, respectively. Exemplary alkoxy groups include, but are not limited to methoxy, ethoxy, isopropoxy, etc.

[00013] The term “alkyl” as used herein refers to a saturated straight or branched hydrocarbon. Exemplary alkyl groups include, but are not limited to, straight or branched hydrocarbons of 1-6, 1-4, or 1-3 carbon atoms, referred to herein as C _1-6 alkyl, C _1-4 alkyl, and C _{1- 3} alkyl, respectively. Exemplary alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, 2-methyl-1-butyl, 3-methyl-2-butyl, 2-methyl-1-pentyl, 3 -methyl-1-pentyl, 4-methyl- 1-pentyl, 2-methyl-2-pentyl, 3-methyl-2-pentyl, 4-methyl-2-pentyl, 2,2-dimethyl-1-butyl, 3,3- dimethyl-1 -butyl, 2-ethyl-1-butyl, butyl, isobutyl, t- butyl, pentyl, isopentyl, neopentyl, hexyl, etc.

[00014] The term “alkylcarbonyl” as used herein refers to a straight or branched alkyl group attached to a carbonyl group (alkyl-C(O)-). Exemplary alkylcarbonyl groups include, but are not limited to, alkylcarbonyl groups of 1-6 atoms, referred to herein as C _1-6 alkylcarbonyl groups. Exemplary alkylcarbonyl groups include, but are not limited to, acetyl, propanoyl, isopropanoyl, butanoyl, etc.

[00015] The term “alkynyl” as used herein refers to an unsaturated straight or branched hydrocarbon having at least one carbon-carbon triple bond. Exemplary alkynyl groups include, but are not limited to, straight or branched groups of 2-6, or 3-6 carbon atoms, referred to herein as C _2-6 alkynyl, and C _3-6 alkynyl, respectively. Exemplary alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, hexynyl, methylpropynyl, etc.

[00016] The term “carbonyl” as used herein refers to the radical -C(O)-.

[00017] The term “cyano” as used herein refers to the radical -CN.

[00018] The term “cycloalkoxy” as used herein refers to a cycloalkyl group attached to oxygen (cycloalkyl-O-). Exemplary cycloalkoxy groups include, but are not limited to, cycloalkoxy groups of 3-6 carbon atoms, referred to herein as C _1-6 cycloalkoxy groups.

Exemplary cycloalkoxy groups include, but are not limited to, cyclopropoxy, cyclobutoxy, cyclohexyloxy, etc.

[00019] The terms “cycloalkyl” or a “carbocyclic group” as used herein refers to a saturated or partially unsaturated hydrocarbon group of, for example, 3-6, or 4-6 carbons, referred to herein as C _1-6 cycloalkyl or C _4-6 cycloalkyl, respectively. Exemplary cycloalkyl groups include, but are not limited to, cyclohexyl, cyclopentyl, cyclopentenyl, cyclobutyl or cyclopropyl.

[00020] The terms “halo” or “halogen” as used herein refer to F, Cl, Br, or I.

[00021] The term “haloalkyl” as used herein refers to an alkyl radical in which the alkyl group is substituted with one or more halogens. Typical haloalkyl groups include, but are not limited to, trifluoromethyl (i.e. CF3), difluoromethyl, fluoromethyl, chloromethyl, dichloromethyl, dibromoethyl, tribromomethyl, tetrafluoroethyl, and the like. Exemplary haloalkyl groups include, but are not limited to, straight or branched hydrocarbons of 1-6, 1-4, or 1-3 carbon atoms substituted with a halogen (i.e. Cl, F, Br and I), referred to herein as C _{1- 6} haloalkyl, C _1-4 haloalkyl, and C _1-3 haloalkyl, respectively.

[00022] The terms “heteroaryl” or “heteroaromatic group” as used herein refers to a monocyclic aromatic 5-6 membered ring system or 8-10 membered bicyclic ring system containing one or more heteroatoms, for example one to three heteroatoms, such as nitrogen, oxygen, and sulfur. Where possible, said heteroaryl ring may be linked to the adjacent radical though carbon or nitrogen. Examples of heteroaryl rings include but are not limited to furan, thiophene, pyrrole, thiazole, oxazole, isothiazole, isoxazole, imidazole, pyrazole, triazole, pyridine or pyrimidine etc.

[00023] The terms “heterocyclyl,” “heterocycle,” or “heterocyclic group” are art- recognized and refer to saturated or partially unsaturated, monocyclic or bicyclic 4-10 membered ring structures, including bridged or fused rings, and whose ring structures include one to three heteroatoms, such as nitrogen, oxygen, and sulfur. Where possible, heterocyclyl rings may be linked to the adjacent radical through carbon or nitrogen. Examples of heterocyclyl groups include, but are not limited to, pyrrolidine, piperidine, morpholine, thiomorpholine, piperazine, oxetane, azetidine, tetrahydrofuran or dihydrofuran etc. In some embodiments, the term “heterocyclyl,” “heterocycle,” or “heterocyclic group” refers to a spirocyclic heterocyclyl. In some embodiments, the term “heterocyclyl,” “heterocycle,” or “heterocyclic group” refers to a bridged heterocyclyl.

[00024] The term “heterocyclyloxy” as used herein refers to a heterocyclyl group attached to oxygen (heterocyclyl-O-).

[00025] The term “heteroaryloxy” as used herein refers to a heteroaryl group attached to oxygen (heteroaryl-O-).

[00026] The terms “hydroxy” and “hydroxyl” as used herein refers to the radical -OH.

[00027] The term “oxo” as used herein refers to the radical =O.

[00028] “Pharmaceutically or pharmacologically acceptable” include molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate. For human administration, preparations should meet sterility, pyrogenicity, and general safety and purity standards as required by FDA Office of Biologies standards.

[00029] The term “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” as used herein refers to any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The compositions may also contain other active compounds providing supplemental, additional, or enhanced therapeutic functions.

[00030] The term “pharmaceutical composition” as used herein refers to a composition comprising at least one compound as disclosed herein formulated together with one or more pharmaceutically acceptable carriers.

[00031] ‘Individual,” “patient,” or “subject” are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or primates, and most preferably humans. The compounds of the invention can be administered to a mammal, such as a human, but can also be administered to other mammals such as an animal in need of veterinary treatment, e.g., domestic animals (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, and the like). The mammal treated in the methods of the invention is desirably a mammal in which treatment of obesity or weight loss is desired. “Modulation” includes antagonism (e.g., inhibition), agonism, partial antagonism and/or partial agonism.

[00032] In the present specification, the term “therapeutically effective amount” means the amount of the subject compound that will elicit the biological or medical response of a tissue, system or animal, (e.g. mammal or human) that is being sought by the researcher, veterinarian, medical doctor or other clinician. The compounds of the invention are administered in therapeutically effective amounts to treat a disease. Alternatively, a therapeutically effective amount of a compound is the quantity required to achieve a desired therapeutic and/or prophylactic effect, such as an amount which results in weight loss.

[00033] The term "pharmaceutically acceptable salt(s)" as used herein refers to salts of acidic or basic groups that may be present in compounds used in the compositions. Compounds included in the present compositions that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids. The acids that may be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including, but not limited to, malate, oxalate, chloride, bromide, iodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucaronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, /?-toluenesulfonate and pamoate (i.e., l,l'-methylene-bis-(2-hydroxy-3- naphthoate)) salts. Compounds included in the present compositions that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts, particularly calcium, magnesium, sodium, lithium, zinc, potassium, and iron salts. Compounds included in the present compositions that include a basic or acidic moiety may also form pharmaceutically acceptable salts with various amino acids. The compounds of the disclosure may contain both acidic and basic groups; for example, one amino and one carboxylic acid group. In such a case, the compound can exist as an acid addition salt, a zwitterion, or a base salt.

[00034] The compounds of the disclosure may contain one or more chiral centers and, therefore, exist as stereoisomers. The term “stereoisomers” when used herein consist of all enantiomers or diastereomers. These compounds may be designated by the symbols “(+),” “R” or “S,” depending on the configuration of substituents around the stereogenic carbon atom, but the skilled artisan will recognize that a structure may denote a chiral center implicitly. The present invention encompasses various stereoisomers of these compounds and mixtures thereof. Mixtures of enantiomers or diastereomers may be designated “(±)” in nomenclature, but the skilled artisan will recognize that a structure may denote a chiral center implicitly. In some embodiments, certain stereoisomers (e.g., the /^-enantiomer, or the second eluting isomer) may retain significantly more activity e.g., against TMPRSS2.

[00035] The compounds of the disclosure may contain one or more double bonds and, therefore, exist as geometric isomers resulting from the arrangement of substituents around a carbon-carbon double bond. The symbol denotes a bond that may be a single, double or triple bond as described herein. Substituents around a carbon-carbon double bond are designated as being in the “Z” or configuration wherein the terms “Z” and are used in accordance with IUPAC standards. Unless otherwise specified, structures depicting double bonds encompass both the and “Z” isomers. Substituents around a carbon-carbon double bond alternatively can be referred to as “cis” or “trans,” where “cis” represents substituents on the same side of the double bond and “trans” represents substituents on opposite sides of the double bond.

[00036] Compounds of the disclosure may contain a carbocyclic or heterocyclic ring and therefore, exist as geometric isomers resulting from the arrangement of substituents around the ring. The arrangement of substituents around a carbocyclic or heterocyclic ring are designated as being in the “Z” or “E” configuration wherein the terms “Z” and “E” are used in accordance with IUPAC standards. Unless otherwise specified, structures depicting carbocyclic or heterocyclic rings encompass both “Z” and “E” isomers. Substituents around a carbocyclic or heterocyclic rings may also be referred to as “cis” or “trans”, where the term “cis” represents substituents on the same side of the plane of the ring and the term “trans” represents substituents on opposite sides of the plane of the ring. Mixtures of compounds wherein the substituents are disposed on both the same and opposite sides of plane of the ring are designated “cis/trans.”

[00037] Individual enantiomers and diastereomers of compounds of the present invention can be prepared synthetically from commercially available starting materials that contain asymmetric or stereogenic centers, or by preparation of racemic mixtures followed by resolution methods well known to those of ordinary skill in the art. These methods of resolution are exemplified by (1) attachment of a mixture of enantiomers to a chiral auxiliary, separation of the resulting mixture of diastereomers by recrystallization or chromatography and liberation of the optically pure product from the auxiliary, (2) salt formation employing an optically active resolving agent, (3) direct separation of the mixture of optical enantiomers on chiral liquid chromatographic columns or (4) kinetic resolution using stereoselective chemical or enzymatic reagents. Racemic mixtures can also be resolved into their component enantiomers by well- known methods, such as chiral-phase liquid chromatography or crystallizing the compound in a chiral solvent. Stereoselective syntheses, a chemical or enzymatic reaction in which a single reactant forms an unequal mixture of stereoisomers during the creation of a new stereocenter or during the transformation of a pre-existing one, are well known in the art. Stereoselective syntheses encompass both enantio- and diastereoselective transformations, and may involve the use of chiral auxiliaries. For examples, see Carreira and Kvaerno, Classics in Stereoselective Synthesis, Wiley-VCH: Weinheim, 2009.

[00038] The compounds disclosed herein can exist in solvated as well as unsolvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms. In one embodiment, the compound is amorphous. In one embodiment, the compound is a single polymorph. In another embodiment, the compound is a mixture of polymorphs. In another embodiment, the compound is in a crystalline form.

[00039] The invention also embraces isotopically labeled compounds of the invention which are identical to those recited herein, except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number usually found in nature. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine and chlorine, such as ² H, ³ H, ¹³ C, ¹⁴ C, ¹⁵ N, ¹⁸ O, ¹⁷ 0, ³¹ P, ³² P, ³⁵ S, ¹⁸ F, and ³⁶ C1, respectively. For example, a compound of the invention may have one or more H atom replaced with deuterium.

[00040] Certain isotopically-labeled disclosed compounds (e.g., those labeled with ³ H and ¹⁴ C) are useful in compound and/or substrate tissue distribution assays. Tritiated (i.e., ³ H) and carbon- 14 (i.e., ¹⁴ C) isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with heavier isotopes such as deuterium (i.e., ² H) may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and hence may be preferred in some circumstances. Isotopically labeled compounds of the invention can generally be prepared by following procedures analogous to those disclosed in the examples herein by substituting an isotopically labeled reagent for a non-isotopically labeled reagent.

[00041] The term “prodrug” refers to compounds that are transformed in vivo to yield a disclosed compound or a pharmaceutically acceptable salt, hydrate or solvate of the compound. The transformation may occur by various mechanisms (such as by esterase, amidase, phosphatase, oxidative and or reductive metabolism) in various locations (such as in the intestinal lumen or upon transit of the intestine, blood or liver). Prodrugs are well known in the art (for example, see Rautio, Kumpulainen, et al, Nature Reviews Drug Discovery 2008, 7, 255). For example, if a compound of the invention or a pharmaceutically acceptable salt, hydrate or solvate of the compound contains a carboxylic acid functional group, a prodrug can comprise an ester formed by the replacement of the hydrogen atom of the acid group with a group such as (C _1-8 )alkyl, (C _2-12 )alkylcarbonyloxymethyl, l-(alkylcarbonyloxy)ethyl having from 4 to 9 carbon atoms, 1 -methyl-1-(alky lcarbonyloxy)-ethyl having from 5 to 10 carbon atoms, alkoxy carbonyloxymethyl having from 3 to 6 carbon atoms, 1 -(alkoxy carbonyloxy)ethyl having from 4 to 7 carbon atoms, 1 -methyl-1-(alkoxy carbonyloxy)ethyl having from 5 to 8 carbon atoms, N-(alkoxycarbonyl)aminomethyl having from 3 to 9 carbon atoms, l-(N-(alkoxycarbonyl)amino)ethyl having from 4 to 10 carbon atoms, 3 -phthalidyl, 4-crotonolactonyl, gamma-butyrolacton-4-yl, di-N,N-(C _1-2 )alkylamino(C _2-3 )alkyl (such as 0- dimethylaminoethyl), carbamoyl-(C _1-2 )alkyl, N,N-di(C _1-2 )alkylcarbamoyl-(C _1-2 )alkyl and piperidino-, pyrrolidine- or morpholino(C _2-3 )alkyl.

[00042] Similarly, if a compound of the invention contains an alcohol functional group, a prodrug can be formed by the replacement of the hydrogen atom of the alcohol group with a group such as (C _1-6 )alkylcarbonyloxymethyl, l-((C _1-6 )alkylcarbonyloxy)ethyl, 1 -methyl-1-((C _{1- 6} )alkylcarbonyloxy)ethyl (C _1-6 )alkoxy carbonyloxymethyl, N-(C _1-6 )alkoxycarbonylaminomethyl, succinoyl, (C _1-6 )alkylcarbonyl, a-amino(C _1-4 )alkylcarbonyl, arylalkylcarbonyl and a- aminoalkylcarbonyl, or a-aminoalkylcarbonyl-a-aminoalkylcarbonyl, where each a- aminoalkylcarbonyl group is independently selected from the naturally occurring L-amino acids, P(O)(OH)2, -P(O)(O(C _1-6 )alkyl)2 or glycosyl (the radical resulting from the removal of a hydroxyl group of the hemiacetal form of a carbohydrate).

[00043] If a compound of the invention incorporates an amine functional group, a prodrug can be formed, for example, by creation of an amide or carbamate, an N- alkylcarbonyloxyalkyl derivative, an (oxodioxolenyl)methyl derivative, an N-Mannich base, imine or enamine. In addition, a secondary amine can be metabolically cleaved to generate a bioactive primary amine, or a tertiary amine can metabolically cleaved to generate a bioactive primary or secondary amine. For examples, see Simplicio, etal., Molecules 2008, 13, 519 and references therein.

I. Compounds

[00044] The disclosure also provides, in part, compounds represented by Formula I: (Formula I), wherein: A is selected from the group consisting of C _1-6 alkyl, C _3-6 cycloalkyl, phenyl, naphthyl, 5-6 membered heteroaryl, 9-10 membered bicyclic heterocyclyl and 9-10 membered bicyclic heteroaryl, wherein A is substituted by R ^g ; and A may be optionally substituted by an additional one, two, or three substituents each independently selected from R ^gg ; R ¹ is selected from hydrogen and C _1-6 alkyl; R ^g is selected from the group consisting of oxo, -N(R ⁱ R ^j ), -(C _1-6 alkyl)- N(R ⁱ R ^j ) and -C(O)-N(R ⁱ R ^j ); R ^gg for each occurrence, is selected from the group consisting of halogen, hydroxyl, oxo, C _1-3 alkyl (optionally substituted by one two or three halogens), - R ¹ and R ¹ are each independently selected from the group consisting of hydrogen, C _1-6 alkyl, -C _1-6 alkyl-O-C _1-6 alkyl, -C(O)-C _1-6 alkyl, - C(O)-C _1-6 alkyl-O-C _1-6 alkyl, -C(O)-C _3-6 cycloalkyl, -C _1-6 alkyl-(4-10 membered heterocyclyl), - C(O)-C _1-6 alkyl-(4-10 membered heterocyclyl), -C(O)-(4-10 membered heterocyclyl), -C(O)- phenyl, -C(O)-(5-6 membered heteroaryl optionally substituted with C _1-6 alkyl or C _2-6 alkene), Ci- ealkoxy, phenyl, 4-7 membered monocyclic heterocyclic ring and 8-10 membered bicyclic heterocyclic ring, wherein the phenyl may be optionally substituted by a monocyclic 4-7 membered heterocyclic ring optionally substituted by oxo; and wherein the phenyl, cycloalkyl, alkoxy, heterocyclic ring and C _1-6 alkyl for each occurrence is optionally substituted by one or more substituents each independently selected from halogen, hydroxyl, cyano, N(R ^m R ⁿ ), oxo, - S(O) _W C _1-3 alkyl (where w is 0, 1, or 2), C _1-3 alkoxy, and C _1-6 alkyl substituted by hydroxyl; or R ¹ and R ¹ taken together with the nitrogen to which they are attached to form a 4-7 membered monocyclic heterocyclic ring, which may have an additional heteroatom selected from O, S, and N, and wherein the 4-7 membered monocyclic heterocyclic ring may optionally be substituted on carbon by one or more substituents each independently selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl, C _1-3 alkyl-O-C _1-3 alkyl and C _1-6 alkoxy; R ^m and R ⁿ are each independently selected from hydrogen, C _1-6 alkyl, and S(O) _W C _1-3 alkyl (where w is 0, 1, or 2); or R ^m and R ⁿ taken together with the nitrogen to which they are attached to form a 4-7 membered monocyclic heterocyclic ring, which may have an additional heteroatom selected from O, S, and N, wherein the 4-7 membered monocyclic heterocyclic ring may optionally be substituted on carbon by one or more substituents each independently selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl and C _1-6 alkoxy; B is selected from the group consisting of 5-6 membered monocyclic heteroaryl, 8-10 membered bicyclic heteroaryl, and 8-10 membered bicyclic heterocyclyl, wherein ring B contains at least one nitrogen and is optionally substituted on one, two, or three carbons by a substituent each independently selected from R ^B ; R ^B for each occurrence, is selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl and Ci- ealkoxy; W is selected from phenyl and heteroaryl, wherein W is substituted on a carbon by a warhead moiety R ^w , wherein R ^w is selected from the group consisting of amidine, amidoxime, guanidine, and N-hydroxyguanidine and oxadiazole; and pharmaceutically acceptable salts, stereoisomers, esters or prodrugs thereof.

[00045] The disclosure also provides, in part, compounds represented by Formula I: (Formula I), wherein: A is selected from the group consisting of C _1-6 alkyl, C _3-6 cycloalkyl, phenyl, naphthyl, and 5-6 membered heteroaryl, wherein A is substituted by R ^g ; and A may be optionally substituted by an additional one, two, or three substituents each independently selected from R ^gg ; or A is selected from 9-10 membered bicyclic heterocyclyl and 9-10 membered bicyclic heteroaryl, wherein when A is bicyclic heterocyclyl or bicyclic heteroaryl, A may be optionally substituted by one oxo; R ¹ is selected from hydrogen and C _1-6 alkyl; R ^g is selected from the group consisting of oxo, -N(R ⁱ R ^j ), -( C _1-6 alkyl )- N(R ⁱ R ^j ) and -C(O)-N(R ⁱ R ^j ); R ^gg for each occurrence, is selected from the group consisting of halogen, hydroxyl, oxo, C _1-3 alkyl (optionally substituted by one two or three halogens), -N(R ⁱ R ^j ), -(C _1-6 alkyl- N(R ⁱ R ^j ) and -C(O)-N(R ⁱ R ^j ); R ¹ and R ^j are each independently selected from the group consisting of hydrogen, C _1-6 alkyl, -C _1-6 alkyl-O-Ci- ealkyl, -C(O)- C _1-6 alkyl, -C(O)- C _1-6 alkyl-O-C _1-6 alkyl, -C(O)-C _3-6 cycloalkyl, -C _1-6 alkyl-(4-10 membered heterocyclyl), -C(O)-C _1-6 alkyl-(4-10 membered heterocyclyl), -C(O)-(4-10 membered heterocyclyl), -C(O)-phenyl, -C(O)-(5-6 membered heteroaryl optionally substituted with C _1-6 alkyl), C _1-6 alkoxy, phenyl, 4-7 membered monocyclic heterocyclic ring and 8-10 membered bicyclic heterocyclic ring, wherein the phenyl is optionally substituted by a monocyclic 4-7 membered heterocyclic ring optionally substituted by oxo; and wherein the phenyl, cycloalkyl, alkoxy, heterocyclic ring and alkyl for each occurrence is optionally substituted by one or more substituents each independently selected from halogen, hydroxyl, cyano, N(R ^m R ⁿ ), -S(0) _w C _1-3 alkyl (where w is 0, 1, or 2), Ci-ialkoxy, and C _1-6 alkyl substituted by hydroxyl; or R ¹ and R ^j taken together with the nitrogen to which they are attached to form a 4-7 membered monocyclic heterocyclic ring, which may have an additional heteroatom selected from O, S, and N, and wherein the 4-7 membered monocyclic heterocyclic ring may optionally be substituted on carbon by one or more substituents each independently selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl, C _1-3 alkyl-O-C _1-3 alkyl and C _1-6 alkoxy; R ^m and R ⁿ are each independently selected from hydrogen, C _1-6 alkyl, and S(O) _W C _1-3 alkyl (where w is 0, 1, or 2); or R ^m and R ⁿ taken together with the nitrogen to which they are attached to form a 4-7 membered monocyclic heterocyclic ring, which may have an additional heteroatom selected from O, S, and N, wherein the 4-7 membered monocyclic heterocyclic ring may optionally be substituted on carbon by one or more substituents each independently selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl and C _1-6 alkoxy; B is selected from the group consisting of 5-6 membered monocyclic heteroaryl, 8-10 membered bicyclic heteroaryl, and 8-10 membered bicyclic heterocyclyl, wherein ring B contains at least one nitrogen and is optionally substituted on one, two, or three carbons by a substituent each independently selected from R ^B ; R ^B for each occurrence, is selected from the group consisting of halogen, -OH, -CN, oxo, Ci- ealkyl and C _1-6 alkoxy; W is selected from phenyl and heteroaryl, wherein W is substituted on a carbon by a warhead moiety R ^w , wherein R ^w is selected from the group consisting of amidine, amidoxime, guanidine, and N-hydroxyguanidine and oxadiazole; and pharmaceutically acceptable salts, stereoisomers, esters or prodrugs thereof.

[00046] Also provided herein, in part, are compounds represented by Formula 1-1: (Formula 1-1), wherein: A is selected from the group consisting of C _1-6 alkyl, C _3-6 cycloalkyl, phenyl, naphthyl, and 5-6 membered heteroaryl, wherein A is substituted by R ^g ; and A may be optionally substituted by an additional one, two, or three substituents each independently selected from R ^gg ; or A is selected from 9-10 membered bicyclic heterocyclyl and 9-10 membered bicyclic heteroaryl, wherein when A is bicyclic heterocyclyl or bicyclic heteroaryl, A may be optionally substituted by one oxo; R ¹ is selected from hydrogen and C _1-6 alkyl; R ^g is selected from the group consisting of oxo, - N(R ⁱ R ^j ), -(C _1-6 alkyl - N(R ⁱ R ^j ) and -C(O)-N(R ⁱ R ^j ); R ^gg for each occurrence, is selected from the group consisting of halogen, hydroxyl, oxo, C _1-3 alkyl (optionally substituted by one two or three halogens), -N(R ⁱ R ^j ), -(C _1-6 alkyl - N(R ⁱ R ^j ) and -C(O)- N(R ⁱ R ^j ); R ¹ and R ¹ are each independently selected from the group consisting of hydrogen, C _1-6 alkyl, -C _1-6 alkyl-O-Ci- ealkyl, -C(O)-C _1-6 alkyl, -C(O)-C _1-6 alkyl-O-C _1-6 alkyl, -C(O)-C _3-6 cycloalkyl, -C _1-6 alkyl-(4-10 membered heterocyclyl), -C(O)-(4-10 membered heterocyclyl), -C(O)-(5-6 membered heteroaryl), C _1-6 alkoxy, phenyl, 4-7 membered monocyclic heterocyclic ring and 8-10 membered bicyclic heterocyclic ring, wherein the phenyl is optionally substituted by a monocyclic 4-7 membered heterocyclic ring optionally substituted by oxo; and wherein the phenyl, cycloalkyl, alkoxy, heterocyclic ring and alkyl for each occurrence is optionally substituted by one or more substituents each independently selected from halogen, hydroxyl, cyano, N(R ^m R ⁿ ), -S(O) _w C _{1- 3} alkyl (where w is 0, 1, or 2), C _1-3 alkoxy, and C _1-6 alkyl substituted by hydroxyl; or R ¹ and R) taken together with the nitrogen to which they are attached to form a 4-7 membered monocyclic heterocyclic ring, which may have an additional heteroatom selected from O, S, and N, and wherein the 4-7 membered monocyclic heterocyclic ring may optionally be substituted on carbon by one or more substituents each independently selected from the group consisting of halogen, - OH, -CN, oxo, C _1-6 alkyl, C _1-3 alkyl-O-C _1-3 alkyl and C _1-6 alkoxy; R ^m and R ⁿ are each independently selected from hydrogen, C _1-6 alkyl, and S(O) _w C _1-3 alkyl (where w is 0, 1, or 2); or R ^m and R ⁿ taken together with the nitrogen to which they are attached to form a 4-7 membered monocyclic heterocyclic ring, which may have an additional heteroatom selected from O, S, and N, wherein the 4-7 membered monocyclic heterocyclic ring may optionally be substituted on carbon by one or more substituents each independently selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl and C _1-6 alkoxy; B is selected from the group consisting of 5-6 membered monocyclic heteroaryl, 8-10 membered bicyclic heteroaryl, and 8-10 membered bicyclic heterocyclyl, wherein ring B contains at least one nitrogen and is optionally substituted on one, two, or three carbons by a substituent each independently selected from R ^B ; R ^B for each occurrence, is selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl and Ci- ealkoxy; W is selected from phenyl and heteroaryl, wherein W is substituted on a carbon by a warhead moiety R ^w , wherein R ^w is selected from the group consisting of amidine, amidoxime, guanidine, and N-hydroxyguanidine and oxadiazole; and pharmaceutically acceptable salts, stereoisomers, esters or prodrugs thereof.

[00047] In certain embodiments, Formula I or 1-1 is represented by: (Formula I), wherein: A is selected from the group consisting of C _1-6 alkyl, C _1-6 cycloalkyl, phenyl, naphthyl, and 5-6 membered heteroaryl, wherein A is substituted by one substituent selected from R ^g ; and optionally substituted by one, two, or three substituents each independently selected from R ^gg ; R ¹ is selected from hydrogen and C _1-6 alkyl; R ^g is selected from the group consisting of -N(R ¹ R ⁱ ), -(C _1-6 alkyl)-N(R ⁱ R ^j ) and -C(O)- N(R ⁱ R ^j ); R ^gg is selected from the group consisting of halogen, hydroxyl, oxo, Ci-ialkyl (optionally substituted by one two or three halogens), - N(R ⁱ R ^j ), -(Ci- 6alkyl)-N(R ⁱ R ^j ) and -C(O)-N(R ⁱ R ^j ); R ¹ and R1 are each independently selected from the group consisting of hydrogen, C _1-6 alkyl, -C _1-6 alkyl-O-C _1-6 alkyl, -C(O)-C _1-6 alkyl, -C(O)-C _1-6 alkyl-O- C _1-6 alkyl, -C(O)-(4-10 membered heterocyclyl), phenyl, and 4-7 membered monocyclic heterocyclic ring or 8- 10 membered bicyclic heterocyclic ring, wherein the phenyl is optionally substituted by a monocyclic 4-7 membered heterocyclic ring optionally substituted by oxo; and wherein the phenyl, heterocyclic ring and C _1-6 alkyl for each occurrence is optionally substituted by one or more substituents each independently selected from halogen, hydroxyl, cyano, and N(R ^m R ⁿ ); or R ¹ and R1 taken together with the nitrogen to which they are attached to form a 4-7 membered monocyclic heterocyclic ring, which may have an additional heteroatom selected from O, S, and N, and wherein the 4-7 membered monocyclic heterocyclic ring may optionally be substituted on carbon by one or more substituents each independently selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl and C _1-6 alkoxy; R ^m and R ⁿ are each independently selected from hydrogen and C _1-6 alkyl; or R ^m and R ⁿ taken together with the nitrogen to which they are attached to form a 4-7 membered monocyclic heterocyclic ring, which may have an additional heteroatom selected from O, S, and N, wherein the 4-7 membered monocyclic heterocyclic ring may optionally be substituted on carbon by one or more substituents each independently selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl and C _1-6 alkoxy; B is selected from the group consisting of 5-6 membered monocyclic heteroaryl, 8-10 membered bicyclic heteroaryl, and 8-10 membered bicyclic heterocyclyl, wherein B contains at least one nitrogen and B is optionally substituted on one, two, or three carbons by a substituent each independently selected from the group consisting of halogen, -OH, -CN, oxo, C _1-6 alkyl and C _1-6 alkoxy; W is selected from phenyl and heteroaryl, wherein W is substituted on a carbon by a warhead moiety R ^w , wherein R ^w is selected from the group consisting of amidine, amidoxime, guanidine, and N-hydroxyguanidine; and pharmaceutically acceptable salts, stereoisomers, esters or prodrugs thereof.

[00048] In some embodiments, A is, in Formula I or 1-1, selected from the group consisting of phenyl, naphthyl, and 5-6 membered heteroaryl (e.g., a 5-6 membered heteroaryl containing one or more heteroatoms selected from the group consisting of N, O and S).

[00049] In certain embodiments, A is, in Formula I or I- 1, a phenyl substituted by one R ^g . In certain embodiments, A is, in Formula I or I- 1, a phenyl optionally substituted by an additional R ^gg .

[00050] In some embodiments, R ¹ is hydrogen. In some embodiments, R ¹ is C _1-6 alkyl

(e g., CH ₃ , CH ₂ CH ₃ ).

[00051] In some embodiments, A is, in Formula I or I- 1, a 9-10 membered bicyclic heterocyclyl or 9-10 membered bicyclic heteroaryl optionally substituted by one oxo.

[00052] In some embodiments, A is, in Formula I or 1-1, selected from

[00053] In some embodiments, R ^g is -N(R ⁱ R ^j ). In some embodiments, R ^g is -NH(R ^j ). In some embodiments, R ^g is -N( C _1-6 alkyl)R ^j (e.g., -N(CH ₃ )R ^j ).

[00054] In some embodiments, R ^g is -(C _1-6 alkyl)-N(R ¹ R ^J ). In some embodiments, R ^g is - (C _1-6 alkyl)-NH(Rj). In some embodiments, R ^g is -(C _1-6 alky l)-N(Ci -6 alky 1)R ^j _

[00055] In some embodiments, R ^g is -C(O)-N(R ¹ R ^J ). In some embodiments, R ^g is - C(O)-NH(R ^j ). In some embodiments, R ^g is -C(O)-N(C _1-6 alkyl)R ^j .

[00056] In some embodiments, R ^g is -N(R ¹ R ^J ), wherein R ¹ and R ^J taken together with the nitrogen to which they are attached to form a substituted 4-7 membered monocyclic heterocyclic ring (e.g., piperazinyl, methylpiperazinyl, morpholinyl, and piperidinyl).

[00057] In some embodiments, R ^j is -C(O)-C _1-6 alkyl, wherein the alkyl is optionally substituted by one or more substituents selected from halogen, hydroxyl, cyano, N(R ^m R ⁿ ) (e.g., NHz, NH(CH ₃ ), and N(CH ₃ ) ₂ ), oxo, -S(O) _w C _1-3 alkyl (where w is 0, 1, or 2), C _1-3 alkoxy (e.g., - OCH ₃ ), and C _1-6 alkyl substituted by hydroxyl.

[00058] In some embodiments, R ^J is -C(O)-(5-6 membered heteroaryl optionally substituted with C _1-6 alkyl). Examples of 5-6 membered heteroaryl include, but not limited to, pyrrolyl, pyrazolyl, triazolyl, oxazolyl, thiadiazolyl, oxadiazolyl, pyridinyl, and pyrimidinyl.

[00061] In certain embodiments, R ^g is selected from the group consisting of

[00062] In some embodiments, B is, in Formula I or 1-1, a 5-6 membered monocyclic heteroaryl or 8-10 membered bicyclic heteroaryl. n some embodiments, B is, in Formula I or 1-1, wherein R ³⁰ is selected from hydrogen and -OR ³¹ ; R ³¹ is selected from Ci- ealkyl and 4-6 membered heterocyclic ring, wherein the C _1-6 alkyl for each occurrence is optionally substituted by one or more substituents each independently selected from hydroxyl, - NH ₂ , -OCH ₃ , -C(O)-NH ₂ , -NH-C(O)-NH(CH ₃ ), -NH-C(O)-CH ₃ , imidazolyl and pyrrolidinyl.

[00064] In some embodiments, B is, in Formula I or 1-1, wherein R ³⁰ is selected from hydrogen and -OR ³¹ ; R ³¹ is selected from C _1-6 alkyl and 4-6 membered heterocyclic ring, wherein the C _1-6 alkyl for each occurrence is optionally substituted by one or more substituents each independently selected from hydroxyl, -NH ₂ , -OCH ₃ , -C(O)-NH ₂ , -NH-C(O)- NH(CH ₃ ), -NH-C(O)-CH ₃ , imidazolyl and pyrrolidinyl.

[00065] In some embodiments, B is, in Formula I or 1-1,

[00066] In certain embodiments, B is, in Formula I or 1-1, selected from the group consisting

[00067] In some embodiments, W is a phenyl.

[00068] In some embodiments, R ^w is amidine. In some embodiments, amidoxime.

[00069] In some embodiments, R ¹ is H.

[00070] In some embodiments, R> is selected from the group consisting of hydrogen, C _1-

₆ alkyl, -C _1-6 alkyl-O-C _1-6 alkyl, -C(O)-C _1-6 alkyl, -C(O)-C _1-6 alkyl-O-C _1-6 alkyl, -C(O)-C ₃ . ecycloalkyl, -C _1-6 alkyl-(4-10 membered heterocyclyl), -C(O)-(4-10 membered heterocyclyl), - C(O)-(5-6 membered heteroaryl), C _1-6 alkoxy, phenyl, and 4-7 membered monocyclic heterocyclic ring or 8- 10 membered bicyclic heterocyclic ring, wherein the phenyl is optionally substituted by a monocyclic 4-7 membered heterocyclic ring optionally substituted by oxo; and wherein the phenyl, cycloalkyl, alkoxy, heterocyclic ring and alkyl for each occurrence is optionally substituted by one or more substituents each independently selected from halogen, hydroxyl, cyano, N(R ^m R ⁿ ), for example NH ₂ , NH(CH ₃ ), oxo, -S(O) _w C _1-3 alkyl (where w is 0, 1, or 2), for example SCH ₃ , S(O)CH ₃ , S(O)2CH ₃ , C _1-3 alkoxy, for example -OCH ₃ , -OCH ₂ CH ₃ , - OCH ₂ CH ₂ CH ₃ , and C _1-6 alkyl substituted by hydroxyl, for example -CH ₂ OH, -CH ₂ CH ₂ OH, - (CH ₂ ) ₃ OH.

[00071] In some embodiments, the compound is represented by Formula I-A: (Formula I-A), wherein R ^B is as defined in claim 1.

[00072] In some embodiments, the compound is represented by Formula I-B:

(Formula I-B), wherein R ^B is as defined in claim 1.

[00073] In some embodiments, R ^B is selected from the group consisting of hydrogen, - OCH ₃ , and -OCH ₂ CH ₃ . In some embodiments, R ^B is selected from the group consisting of hydrogen, -OCH ₃ , -OCH ₂ CH ₃ , and-OCH ₂ CH ₂ CH ₃ .

,

[00076] Also provided herein, in part, are compounds represented by Formula III: wherein: R ¹ is selected from hydrogen and C _1-6 alkyl; R ³⁰ is selected from hydrogen and -OR ³¹ ; R ³¹ is selected from C _1-6 alkyl and 4-6 membered heterocyclic ring, wherein the C _1-6 alkyl is optionally substituted by one or more substituents each independently selected from hydroxyl, - NH ₂ , -OCH ₃ , -C(O)-NH ₂ , -NH-C(O)-NH(CH ₃ ), -NH-C(O)-CH ₃ , imidazolyl and pyrrolidinyl, R ^g is selected from the group consisting of -Co-ialkyl-DD, wherein DD is selected from the group consisting of phenyl, 5-6 membered heteroaryl, 4-8 membered heterocyclic, 8-10 membered bicyclic heteroaryl, and 4-7 membered carbocylic, wherein DD is optionally substituted by one, two, three or more substituents each independently selected from the group consisting of Ci- 4alkyl (optionally substituted by hydroxyl, cyano or halogen), hydroxyl, oxo, cyano, NR’R’ ’ (where R’ and R” are each independently H or methyl), halogen, and C _1-6 alkoxy (optionally substituted by hydroxyl, cyano or halogen); R ^H is hydrogen or hydroxyl, and pharmaceutically acceptable salts, stereoisomers, esters or prodrugs thereof.

[00077] In some embodiments, R ¹ is H. In some embodiments, R ¹ is CH ₃ .

[00078] In some embodiments, DD is selected from the group consisting of

[00079] In some embodiments, in Formula III, R ^g is selected from the group consisting of:

[00080] Also provided herein, in part, are compounds represented by Formula II- 1: (Formula II- 1), wherein: A is selected from the group consisting of hydrogen; R ³⁰ is selected from hydrogen and -OR ³¹ ; R ³¹ is selected from C _1-6 alkyl and 4-6 membered heterocyclic ring, wherein the C _1-6 alkyl for each occurrence is optionally substituted by one or more substituents each independently selected from hydroxyl, -NH ₂ , -OCH ₃ , -C(O)- NH ₂ , -NH-C(O)-NH(CH ₃ ), -NH-C(O)-CH ₃ , imidazolyl and pyrrolidinyl, and wherein m is 0, 1 or 2; R ^H is hydrogen or hydroxyl, and pharmaceutically acceptable salts, stereoisomers, esters or prodrugs thereof.

[00081] Also provided herein, in part, are compounds represented by Formula II:

(Formula II), wherein: A is selected from the group consisting of hydrogen; B is , wherein R ³⁰ is selected from hydrogen and -OR ³¹ ; R ³¹ is selected from C _1-6 alkyl and 4-6 membered heterocyclic ring, wherein the C _1-6 alkyl for each occurrence is optionally substituted by one or more substituents each independently selected from hydroxyl, - NH ₂ , -OCH ₃ , -C(O)-NH ₂ , -NH-C(O)-NH(CH ₃ ), -NH-C(O)-CH ₃ , imidazolyl and pyrrolidinyl, and wherein m is 0, 1 or 2; R ^H is hydrogen or hydroxyl, and pharmaceutically acceptable salts, stereoisomers, esters or prodrugs thereof.

[00082] In some embodiments, B is, in Formula II, selected from the group consisting of

[00083] In some embodiments, R ^H is hydrogen.

[00084] In some embodiments, m is 2. In some embodiments, m is 1. In some embodiments, m is 0.

[00085] In some embodiments, R ³⁰ is hydrogen. In some embodiments, R ³⁰ is selected from the group consisting of -OCH ₃ , -OCH ₂ CH ₃ , and-OCH ₂ CH ₂ CH ₃ . In some embodiments, R ³⁰ is selected from the group consisting of

[00086] In various embodiments, the compound of Formula I, Formula 1-1, Formula II or Formula III (or subgenera thereof) is the /^-stereoisomer.

[00087] In some embodiments, the compound is selected from the group consisting of the compounds identified in Table 1 and Table 2 below:

Table 1. Exemplary compounds

[00088] In some embodiments, the compound is selected from the group consisting of:

Table 2. Exemplary compounds

[00089] In some embodiments, the compound is selected from the group consisting of:

II. Methods

[00090] Another aspect of the disclosure provides methods of treating patients suffering from a viral infection, e.g., a coronaviral infection. In particular, in certain embodiments, the disclosure provides a method of treating the below medical indications comprising administering to a subject in need thereof a therapeutically effective amount of a compound described herein, such as a compound of Formula 1, 1-1, 1-A, I-B, II, or III. In one aspect, the compounds described herein are contemplated as a TMPRSS2 inhibitor. In certain embodiments, the disclosure provides a method of treating a viral infection in a patient in need thereof, comprising inhibiting TMPRSS2 by administering a compound of Formula 1, 1-1, LA, I-B, II, or III.

[00091] In some embodiments, the disease or disorder is caused by a virus. In certain embodiments, the virus is selected from the group consisting of a retrovirus (e.g., human immunodeficiency virus (HIV), simian immunodeficiency virus (SIV), human T-cell lymphotropic virus (HTLV)-l, HTLV-2, HTLV-3, HTLV-4), Ebola virus, hepatitis A virus, hepatitis B virus, hepatitis C virus, a herpes simplex virus (HSV) (e.g., HSV-1, HSV-2, varicella zoster virus, cytomegalovirus), an adenovirus, an orthomyxovirus (e.g., influenza virus A, influenza virus B, influenza virus C, influenza virus D, thogotovirus), a flavivirus (e.g., dengue virus, Zika virus), West Nile virus, Rift Valley fever virus, an arenavirus, Crimean-Congo hemorrhagic fever virus, an echovirus, a rhinovirus, coxsackie virus, a coronavirus (e.g., Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)), a respiratory syncytial virus, a mumps virus, a rotavirus, measles virus, rubella virus, a parvovirus (e.g., an adeno-associated virus), a vaccinia virus, a variola virus, a molluscum virus, bovine leukemia virus, a poliovirus, a rabies virus, a polyomavirus (e.g., JC virus, BK virus), an alphavirus, and a rubivirus (e.g., rubella virus).

[00092] In certain embodiments, a PEGylated-arginase of the described herein is used for treating a disease or disorder caused by a viral infection, e.g., a disease or disorder selected from the group consisting of acquired immune deficiency syndrome (AIDS), HTLV-1 associated myelopathy/tropical spastic paraparesis, Ebola virus disease, hepatitis A, hepatitis B, hepatitis C, herpes, herpes zoster, acute varicella, mononucleosis, respiratory infections, pneumonia, influenza, dengue fever, encephalitis (e.g., Japanese encephalitis), West Nile fever, Rift Valley fever, Crimean-Congo hemorrhagic fever, Kyasanur Forest disease, Yellow fever, Zika fever, aseptic meningitis, myocarditis, common cold, lung infections, molloscum contagiosum, enzootic bovine leucosis, coronavirus disease 2019 (CO VID-19), mumps, gastroenteritis, measles, rubella, slapped-cheek disease, smallpox, warts (e.g., genital warts), molluscum contagiosum, polio, rabies, and pityriasis rosea.

[00093] In some embodiments, the viral disease or disorder is caused by a human immunodeficiency virus (HIV). HIV refers to two species of retrovirus (HIV-1, HIV-2) that infect cells of the immune system, e.g., CD4+ T cells, macrophages, and microglial cells. HIV can progress to acquired immunodeficiency syndrome (AIDS). In some embodiments, the viral disease or disorder is caused by a human papillomavirus (HPV). HPV is a sexually transmitted infection that may result in warts, e.g., genital warts. In some embodiments, the viral disease or disorder is caused by a herpesvirus, e.g., hepatitis C virus (HCV), or cytomegalovirus (CMV). Hepatitis C primarily affects the liver and often leads to liver disease and/or cirrhosis. Cytomegalovirus (CMV), e.g., human cytomegalovirus, is associated with pneumonia and mononucleosis. In some embodiments, the viral disease or disorder is caused by a flavivirus, e.g.,

Ebola virus, Zika virus, or West Nile virus. Ebola virus causes Ebola virus disease (EVD), a viral hemorrhagic fever.

[00094] In some embodiments, the virus is an RNA virus (having a genome that is composed of RNA). RNA viruses may be single-stranded RNA (ssRNA) or double-stranded RNA (dsRNA). RNA viruses have high mutation rates compared to DNA viruses, as RNA polymerase lacks proofreading capability (see Steinhauer DA, Holland JJ (1987). "Rapid evolution of RNA viruses". Annu. Rev. Microbiol. 41: 409-33). Exemplary RNA viruses include, without limitation, bunyaviruses (e.g., hantavirus), coronaviruses (e.g., MERS-CoV, SARS-CoV, SARS-CoV-2), flaviviruses (e.g., yellow fever virus, west nile virus, dengue virus), hepatitis viruses (e.g., hepatitis A virus, hepatitis C virus, hepatitis E virus), influenza viruses (e.g., influenza virus type A, influenza virus type B, influenza virus type C), measles virus, mumps virus, noroviruses (e.g., Norwalk virus), poliovirus, respiratory syncytial virus (RSV), retroviruses (e.g., human immunodeficiency virus-1 (HIV-1)) and toroviruses. In some embodiments, the RNA virus is an influenza virus, e.g., influenza A. In some embodiments, the RNA virus is RSV. In some embodiments, the RNA virus is MERS-CoV. In some embodiments, the RNA virus is SARS-CoV2. In some embodiments, the RNA virus is ZIKA.

[00095] RNA viruses are classified by the type of genome (double-stranded, negative (-), or positive (+) single-stranded). Double-stranded RNA viruses contain a number of different RNA molecules, each coding for one or more viral proteins. Positive-sense ssRNA viruses utilize their genome directly as mRNA; ribosomes within the host cell translate mRNA into a single protein that is then modified to form the various proteins needed for viral replication. One such protein is RNA-dependent RNA polymerase (RNA replicase), which copies the viral RNA in order to form a double-stranded, replicative form. Negative-sense ssRNA viruses have their genome copied by an RNA replicase enzyme to produce positive-sense RNA for replication. Therefore, the virus comprises an RNA replicase enzyme. The resultant positive-sense RNA then acts as viral mRNA and is translated by the host ribosomes. In some embodiments, the virus is a dsRNA virus. In some embodiments, the virus is a negative ssRNA virus. In some embodiments, the virus is a positive ssRNA virus. In some embodiments, the positive ssRNA virus is a coronavirus.

[00096] SARS-CoV2, also sometimes referred to as the novel coronavirus of 2019 or 2019-nCoV, is a positive-sense single-stranded RNA virus. SARS-CoV2 has four structural proteins, known as the S (spike), E (envelope), M (membrane), and N (nucleocapsid) proteins. The N protein holds the RNA genome; together, the S, E, and M proteins form the viral envelope. Spike allows the virus to attach to the membrane of a host cell, such as the ACE2 receptor in human cells (Kruse R.L. (2020), Therapeutic strategies in an outbreak scenario to treat the novel coronavirus originating in Wuhan, China (version 2). F1000Research, 9:72). SARS-CoV2 is the highly contagious, causative viral agent of coronavirus disease 2019 (COVID19), a global pandemic.

[00097] In some embodiments, the virus is a DNA virus (having a genome that is composed of DNA). Exemplary DNA viruses include, without limitation, parvoviruses (e.g., adeno-associated viruses), adenoviruses, asfarviruses, herpesviruses (e.g., herpes simplex virus 1 and 2 (HSV-1 and HSV-2), epstein-barr virus (EBV), cytomegalovirus (CMV)), papillomoviruses (e.g., HPV), polyomaviruses (e.g., simian vacuolating virus 40 (SV40)), and poxviruses (e.g., vaccinia virus, cowpox virus, smallpox virus, fowlpox virus, sheeppox virus, myxoma virus). In certain embodiments, the DNA virus is an adenovirus, e.g., AdV5. In certain embodiments, the DNA virus is an enterovirus, e.g., EV71. In certain embodiments, the DNA virus is a herpesvirus, e.g., HSV-1.

[00098] In some embodiments, the infection is localized, e.g., to an organ or, e.g., to a tissue. In some embodiments, infection is localized to an organ including but not limited to the eye, the ear, the inner ear, the lungs, trachea, bronchus, bronchioli, the liver, the gall bladder, the bile duct, the kidney, the bladder, the testis, the cervix, the ovary, the uterus, the skin, or the brain. In certain embodiments, the infection is a viral infection (e.g., an HSV-1, an HSV-2, a VZV, a CMV) and is localized to the eye. In certain embodiments, the infection is an adenoviral infection and is localized to the eye. In certain embodiments, the infection is a bacterial infection (e.g., Chlamydia) and is localized to the eye.

[00099] In some embodiments, the infection is chronic. As used herein, “chronic” refers to an infection that persists for an extended period of time, or recurs. In some embodiments, the infection is acute. As used herein, “acute” refers to an infection that is of short duration.

[000100] Methods to quantify viral replication are known in the art. In some embodiments, viral count is determined using a plaque assay. In some embodiments, viral count is determined using a focus forming assay (FFA). In some embodiments, viral count is determined using an endpoint dilution assay. In some embodiments, viral count is determined using an enzyme-linked immunosorbent assay (ELISA). In some embodiments, viral count is determined using Tunable resistive pulse sensing (TRPS) to detect individual virus particles. In some embodiments, viral replication is determined by quantifying the amount or percentage of host cell death, e.g., in vitro, for example, using propidium iodide (PI) to identify dead cells, quantifying the amount of morphologically rounded cells, or by immunofluorescence microscopy for apoptotic markers. In some embodiments, viral count is determined by measuring viral titer or multiplicity of infection (MOI) or by performing a plaque assay, a focus forming assay, and endpoint dilution assay, a viral protein quantification assay (for example, a hemagglutination assay, a bicinchoninic acid assay (BCA), or a single radial immunodiffusion assay (SRID) assay), transmission electron microscopy analysis, a tunable resistive pulse sensing (TRPS) assay, a flow cytometry assay, a quantitative PCR (qPCR) assay, or an Enzyme-linked immunosorbent assay (ELISA). In some embodiments, viral replication is determined by quantification of viral nucleic acid (for example, viral DNA or viral RNA) content.

[000101] Methods to quantify viral transmission are known in the art. In some embodiments, viral transmission is quantified using epidemiological modeling (see, e.g., Graw F. et al., (2016) Modeling Viral Spread. Annu Rev Virol, 3(1)). In some embodiments, viral transmission is assessed in vitro, e.g., in cell culture, e.g., using microscopy, e.g., using transmission electron microscopy (TEM).

[000102] Methods to quantify viral assembly are known in the art. In some embodiments, viral assembly is determined using statistical modeling (see, e.g., Clement N et al., (2018) Viral Capsid Assembly: A Quantified Uncertainty Approach. J Comp Biol, 25(1)). In some embodiments, viral assembly is determined using biochemical techniques to determine capsid complex formation, e.g., co-immunoprecipitation, e.g, western blotting. In some embodiments, viral assembly is determined by flow cytometry for detection of colocalized viral protein (see, e.g., Stoffel, C.L. et al. (2005). "Rapid Determination of Baculovirus Titer by a Dual Channel Virus Counter" American Biotechnology Laboratory. 37 (22): 24-25).

[000103] Viral genes encode elements necessary for the process of viral infection, a multi- step process, including, for example, attachment to the host cell, penetration, de-envelopment, viral gene transcription cascade, viral protein expression, viral genome replication, viral packaging and assembly, envelopment, transport and maturation, release and egress, and host cell-to-cell transmission. 0 genes are those genes corresponding to early steps of viral infection, e.g., viral genome replication, y genes are those genes corresponding to late steps of viral infection, e.g., egress. Methods to quantify viral gene expression are known in the art. In some embodiments, viral gene expression is determined using reverse transcriptase and quantitative polymerase chain reaction (RT-qPCR). In some embodiments, RNA sequencing (RNA-Seq) is used to determine viral gene expression. In some embodiments, viral DNA is quantified using a Southern blot. In some embodiments, 0 gene expression is quantified. In some embodiments, y gene expression is quantified. In some embodiments, 0 gene expression and y gene expression are quantified. In some embodiments, expression of the entire viral genome is quantified.

[000104] Methods to quantify virus release are known in the art. In some embodiments, viral release is determined by biochemical assay, e.g., western blotting, e.g., metabolic labeling (see, e.g., Yadav et al., (2012). “A facile quantitative assay for viral particle genesis reveals cooperativity in virion assembly and saturation of an antiviral protein.” Virology. 429(2): 155- 162). In some embodiments, viral release is determined by ELISA. In some embodiments, viral release is determined using electron microscopy, e.g., transmission electron microscopy (TEM). In some embodiments, viral release is determined by infectivity measurements for the detection of virions in a sample, e.g., serum. In some embodiments, viral release is determined by quantification of viral DNA or viral RNA in serum in vivo or culture supernatant in vitro.

[000105] Methods of treatment of the present invention can be used as a monotherapy or in combination with one or more other therapies (for example, anti-infective agents) that can be used to treat a disease or disorder, for example, an infection. The term “combination,” as used herein, is understood to mean that two or more different treatments are delivered to the subject during the course of the subject’s affliction with the disorder, such that the effects of the treatments on the patient overlap at a point in time. In certain embodiments, the delivery of one treatment is still occurring when the delivery of the second begins, so that there is overlap in terms of administration. This is sometimes referred to herein as “simultaneous” or “concurrent delivery.” In other embodiments, the delivery of one treatment ends before the delivery of the other treatment begins. In certain embodiments of either case, the treatment is more effective because of combined administration. For example, the second treatment is more effective, e.g., an equivalent effect is seen with less of the second treatment, or the second treatment reduces symptoms to a greater extent, than would be seen if the second treatment were administered in the absence of the first treatment, or the analogous situation is seen with the first treatment. In certain embodiments, delivery is such that the reduction in a symptom, or other parameter related to the disorder is greater than what would be observed with one treatment delivered in the absence of the other. The effect of the two treatments can be partially additive, wholly additive, or greater than additive. The delivery can be such that an effect of the first treatment delivered is still detectable when the second is delivered.

[000106] Accordingly, in certain embodiments, the subject has received, is receiving, or is scheduled to receive one or more other therapies suitable for use in treating the disease or disorder. In certain embodiments, the method of treatment of the present invention further comprises administering to the subject one or more other therapies suitable for use in treating a disease or disorder, for example, an infection. In certain embodiments, the one or more other therapies comprise an agent that ameliorates one or more symptoms of infection with an intracellular pathogen. In certain embodiments, the one or more other therapies comprise surgical removal of an infected tissue.

[000107] Accordingly, in certain embodiments, the subject has received, is receiving, or is scheduled to receive one or more other therapies suitable for use in treating the disease or disorder. In certain embodiments, the method of treatment of the present invention further comprises administering to the subject one or more other therapies suitable for use in treating a disease or disorder, for example, an infection. In certain embodiments, the one or more other therapies comprise an agent that ameliorates one or more symptoms of infection with an intracellular pathogen. In certain embodiments, the one or more other therapies comprise surgical removal of an infected tissue.

[000108] It is understood that a method of use disclosed herein can be used in combination with an agent, for example, an anti- infective agent that ameliorates one or more symptoms of a disease or disorder associated with an intracellular pathogen. For example, a method of use disclosed herein can be used in combination with another antiviral agent.

[000109] In some embodiments, methods described herein further comprise administering an additional anti-viral agent. In some embodiments, the anti-viral agent is selected from the group consisting of ribavirin, favipiravir, ST-193, oseltamivir, zanamivir, peramivir, danoprevir, ritonavir, and remdesivir. In some embodiments, the another agent is selected from the group consisting of protease inhibitors (e.g., nafamostat, camostat, gabexate, epsilon-aminocapronic acid and aprotinin), fusion inhibitors (e.g., BMY-27709, CL 61917, and CL 62554), M2 proton channel blockers (e.g., amantadine and rimantadine), polymerase inhibitors (e.g., 2-deoxy- 2'fluoroguanosides (2'-fluoroGuo), 6- endonuclease inhibitors (e.g., L-735,822 and flutamide) neuraminidase inhibitors (e.g., zanamivir (Relenza), oseltamivir, peramivir and ABT-675 (A- 315675), reverse transcriptase inhibitor (e.g., abacavir, adefovir, delavirdine, didanosine, efavirenz, emtricitabine, lamivudine, nevirapine, stavudine, tenofovir, tenofovir disoproxil, and zalcitabine), acyclovir, acyclovir, protease inhibitors (e.g., amprenavir, indinavir, nelfinavir, ritonavir, and saquinavir), arbidol, atazanavir, atripla, boceprevir, cidofovir, combivir, darunavir, docosanol, edoxudine, entry inhibitors (e.g., enfuvirtide and maraviroc), entecavir, famciclovir, fomivirsen, fosamprenavir, foscarnet, fosfonet, ganciclovir, ibacitabine, immunovir, idoxuridine, imiquimod, inosine, integrase inhibitor (e.g., raltegravir), interferons (e.g., types I, II, and III), lopinavir, loviride, moroxydine, nexavir, nucleoside analogues (e.g., aciclovir), penciclovir, pleconaril, podophyllotoxin, ribavirin, tipranavir, trifluridine, trizivir, tromantadine, truvada, valaciclovir, valganciclovir, vicriviroc, vidarabine, viramidine, and zodovudine. In some embodiments, the additional anti-viral agent is selected from the group consisting of lamivudine, an interferon alpha, a VAP anti-idiotypic antibody, enfuvirtide, amantadine, rimantadine, pleconaril, aciclovir, zidovudine, fomivirsen, a morpholino, a protease inhibitor, double-stranded RNA activated caspase oligomerizer (DRACO), rifampicin, zanamivir, oseltamivir, danoprevir, ritonavir, and remdesivir. In some embodiments, the another agent is selected from the group consisting of quinine (optionally in combination with clindamycin), chloroquine, amodiaquine, artemisinin and its derivatives (e.g., artemether, artesunate, dihydroartemisinin, arteether), doxycycline, pyrimethamine, mefloquine, halofantrine, hydroxychloroquine, eflornithine, nitazoxanide, ornidazole, paromomycin, pentamidine, primaquine, pyrimethamine, proguanil (optionally in combination with atovaquone), a sulfonamide (e.g., sulfadoxine, sulfamethoxypy ridazine), tafenoquine, tinidazole and a PPT1 inhibitor (including Lys05 and DC661). In some embodiments, the another agent is an antibiotic. In some embodiments, the antibiotic is a penicillin antibiotic, a quinolone antibiotic, a tetracycline antibiotic, a macrolide antibiotic, a lincosamide antibiotic, a cephalosporin antibiotic, or an RNA synthetase inhibitor. In some embodiments, the antibiotic is selected from the group consisting of azithromycin, vancomycin, metronidazole, gentamicin, colistin, fidaxomicin, telavancin, oritavancin, dalbavancin, daptomycin, cephalexin, cefuroxime, cefadroxil, cefazolin, cephalothin, cefaclor, cefamandole, cefoxitin, cefprozil, ceftobiprole, cipro, Levaquin, floxin, tequin, avelox, norflox, tetracycline, minocycline, oxytetracycline, doxycycline, amoxicillin, ampicillin, penicillin V, di cl oxacillin, carbenicillin, methicillin, ertapenem, doripenem, imipenem/cilastatin, meropenem, amikacin, kanamycin, neomycin, netilmicin, tobramycin, paromomycin, cefixime, cefdinir, cefditoren, cefoperazone, cefotaxime, ceftazidime, ceftibuten, ceftizoxime, ceftriaxone, cefoxotin, and streptomycin. In some embodiments, the antibiotic is azithromycin.

[000110] In some embodiments, the additional therapeutic agents can be kinase inhibitors including but not limited to erlotinib, gefitinib, neratinib, afatinib, osimertinib, lapatanib, crizotinib, brigatinib, ceritinib, alectinib, lorlatinib, everolimus, temsirolimus, abemaciclib,

LEE011, palbociclib, cabozantinib, sunitinib, pazopanib, sorafenib, regorafenib, sunitinib, axitinib, dasatinib, imatinib, nilotinib, ponatinib, idelalisib, ibrutinib, Loxo 292, larotrectinib, and quizartinib.

[000111] In some embodiments, the additional therapeutic agents can be therapeutic anti- viral vaccines.

[000112] In some embodiments, the additional therapeutic agents can be immunomodulatory agents including but not limited to anti-PD-lor anti-PDL-1 therapeutics including pembrolizumab, nivolumab, atezolizumab, durvalumab, BMS-936559, or avelumab, anti-TIM3 (anti-HAVcr2) therapeutics including but not limited to TSR-022 or MBG453, anti- LAG3 therapeutics including but not limited to relatlimab, LAG525, or TSR-033, anti-4- IBB (anti-CD37, anti-TNFRSF9), CD40 agonist therapeutics including but not limited to SGN-40, CP-870,893 or R07009789, anti-CD47 therapeutics including but not limited to Hu5F9-G4, anti- CD20 therapeutics, anti-CD38 therapeutics, STING agonists including but not limited to ADU- S100, MK-1454, ASA404, or amidobenzimidazoles, anthracy clines including but not limited to doxorubicin or mitoxanthrone, hypomethylating agents including but not limited to azacytidine or decitabine, other immunomodulatory therapeutics including but not limited to epidermal growth factor inhibitors, statins, metformin, angiotensin receptor blockers, thalidomide, lenalidomide, pomalidomide, prednisone, or dexamethasone.

[000113] Another aspect of the disclosure provides methods of treating patients suffering from a disorder such as a tumor, e.g., a solid tumor, and cancer. In particular, in certain embodiments, the disclosure provides a method of treating a tumor or cancer comprising administering to a subject in need thereof a therapeutically effective amount of a compound described herein, such as a compound of Formula 1, 1-1 I- A, I-B, II, or III. Exemplary disorders include, but not limited to, gastrointestinal stromal tumors, esophageal cancer, gastric cancer, melanomas, gliomas, glioblastomas, ovarian cancer, bladder cancer, pancreatic cancer, prostate cancer, lung cancers, breast cancers, renal cancers, hepatic cancers, osteosarcomas, multiple myelomas, cervical carcinomas, cancers that are metastatic to bone, papillary thyroid carcinoma, non-small cell lung cancer, colorectal cancers, cancer of the thyroid, endocrine system, brain, breast, cervix, colon, head & neck, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus, Medulloblastoma, colorectal cancer, pancreatic cancer. Additional examples may include, Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, neoplasms of the endocrine or exocrine pancreas, medullary thyroid cancer, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid cancer, hepatocellular carcinoma, or prostate cancer. A cancer treated by the methods described herein may be a metastatic cancer. In preferable embodiments, the cancer is a prostate cancer. In embodiments, the prostate cancer is a metastatic prostate cancer.

[000114] Yet in another aspect of the disclosure provides methods of treating patients suffering from a disorder such as a blood disorder (e.g., blood clots, blood coagulation disorders, bleeding disorders, hemophilia), cardiovascular disease (e.g., ischaemic heart disease (HID), angina pectoris, coronary heart disease, stroke, transient ischaemic attacks, cerebrovascular disease, hypertensive disease, aortic aneurysm, peripheral arterial disease, retinal arterial disease), inflammatory disease (e.g., rheumatoid or rheumatic inflammatory disease, especially arthritis (including rheumatoid arthritis), or other chronic inflammatory disorders, such as chronic asthma, arterial or post-transplantational atherosclerosis, endometriosis) and chronic obstructive pulmonary disease.

[000115] As described herein, the compound of the disclosure (e.g., a compound of Formula I, 1-1, LA, LB, II, or III) are contemplated as a protease inhibitor, wherein the protease is TMPRSS2, ACE2, Cathepsin B, Cathepsin L, Elastase, FVIIa, Fxa, FXIa, Furin, Kallikrein 1, Kallikrein 5, Kallikrein 7, Kallikrein 12, Kallikrein 13, Kallikrein 14, Matriptase 2, MMP 1, MMP 2, MMP 7, MMP 10, MMP 13, MMP 14, Mpro, Plasma Kallikrein, Plasmin, Plpro, TACE, Thrombin a, Trypsin, Tryptase b2, Tryptase gl, or Urokinase. The disclosure provides methods of treating patients suffering from a disorder comprising inhibiting a protease by administering a compound of Formula 1, 1-1, 1- A, I-B, II, or III. In various embodiments, the protease is selected from the group consisting of ACE2, Cathepsin B, Cathepsin L, Elastase, FVIIa, Fxa, FXIa, Furin, Kallikrein 1, Kallikrein 5, Kallikrein 7, Kallikrein 12, Kallikrein 13, Kallikrein 14, Matriptase 2, MMP 1, MMP 2, MMP 7, MMP 10, MMP 13, MMP 14, Mpro, Plasma Kallikrein, Plasmin, Plpro, TACE, Thrombin a, Trypsin, Tryptase b2, Tryptase gl, and Urokinase. In some embodiments, the protease is selected from the group consisting of Kallikrein 1, Matriptase 2 and Urokinase. In some embodiments, the protease is selected from the group consisting of Kallikrein 1 and Urokinase. In some embodiments, the protease is selected from the group consisting of FXa, Kallikrein 1, MMP 1, MMP 2, MMP 10, MMP 14, Mpro, Plasma Kallikrein, Thrombin a, Trypsin, Tryptase b2, Tryptase gl, and Urokinase. In embodiments, the disorder is a viral infection (e.g., a coronaviral infection). In embodiments, the disorder is a cancer (e.g., prostate cancer, metastatic prostate cancer). In some embodiments, the disorder is a blood disorder or a cardiovascular disease.

III. Pharmaceutical Compositions and Kits

[000116] Another aspect of the disclosure provides pharmaceutical compositions comprising compounds as disclosed herein formulated together with a pharmaceutically acceptable carrier. In particular, the present disclosure provides pharmaceutical compositions comprising compounds as disclosed herein formulated together with one or more pharmaceutically acceptable carriers. These formulations include those suitable for oral, rectal, topical, buccal, parenteral (e.g., subcutaneous, intramuscular, intradermal, or intravenous) rectal, vaginal, or aerosol administration, although the most suitable form of administration in any given case will depend on the degree and severity of the condition being treated and on the nature of the particular compound being used. For example, disclosed compositions may be formulated as a unit dose, and/or may be formulated for oral or subcutaneous administration.

[000117] Exemplary pharmaceutical compositions of this disclosure may be used in the form of a pharmaceutical preparation, for example, in solid, semisolid or liquid form, which contains one or more of the compound of the disclosure, as an active ingredient, in admixture with an organic or inorganic carrier or excipient suitable for external, enteral or parenteral applications. The active ingredient may be compounded, for example, with the usual non-toxic, pharmaceutically acceptable carriers for tablets, pellets, capsules, suppositories, solutions, emulsions, suspensions, and any other form suitable for use. The active object compound is included in the pharmaceutical composition in an amount sufficient to produce the desired effect upon the process or condition of the disease.

[000118] For preparing solid compositions such as tablets, the principal active ingredient may be mixed with a pharmaceutical carrier, e.g., conventional tableting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate or gums, and other pharmaceutical diluents, e.g., water, to form a solid preformulation composition containing a homogeneous mixture of a compound of the disclosure, or a non-toxic pharmaceutically acceptable salt thereof. When referring to these preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective unit dosage forms such as tablets, pills and capsules.

[000119] In solid dosage forms for oral administration (capsules, tablets, pills, dragees, powders, granules and the like), the subject composition is mixed with one or more pharmaceutically acceptable carriers, such as sodium citrate or dicalcium phosphate, and/or any of the following: (1) fillers or extenders, such as starches, lactose, sucrose, glucose, mannitol, and/or silicic acid; (2) binders, such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinyl pyrrolidone, sucrose and/or acacia; (3) humectants, such as glycerol; (4) disintegrating agents, such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate; (5) solution retarding agents, such as paraffin; (6) absorption accelerators, such as quaternary ammonium compounds; (7) wetting agents, such as, for example, acetyl alcohol and glycerol monostearate; (8) absorbents, such as kaolin and bentonite clay; (9) lubricants, such a talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof; and (10) coloring agents. In the case of capsules, tablets and pills, the compositions may also comprise buffering agents. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugars, as well as high molecular weight polyethylene glycols and the like.

[000120] A tablet may be made by compression or molding, optionally with one or more accessory ingredients. Compressed tablets may be prepared using binder (for example, gelatin or hydroxypropylmethyl cellulose), lubricant, inert diluent, preservative, disintegrant (for example, sodium starch glycolate or cross-linked sodium carboxymethyl cellulose), surface-active or dispersing agent. Molded tablets may be made by molding in a suitable machine a mixture of the subject composition moistened with an inert liquid diluent. Tablets, and other solid dosage forms, such as dragees, capsules, pills and granules, may optionally be scored or prepared with coatings and shells, such as enteric coatings and other coatings well-known in the pharmaceutical-formulating art.

[000121] Compositions for inhalation or insufflation include solutions and suspensions in pharmaceutically acceptable, aqueous or organic solvents, or mixtures thereof, and powders. Liquid dosage forms for oral administration include pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups and elixirs. In addition to the subject composition, the liquid dosage forms may contain inert diluents commonly used in the art, such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor and sesame oils), glycerol, tetrahydrofuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, cyclodextrins and mixtures thereof.

[000122] Suspensions, in addition to the subject composition, may contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar and tragacanth, and mixtures thereof.

[000123] Formulations for rectal or vaginal administration may be presented as a suppository, which may be prepared by mixing a subject composition with one or more suitable non- irritating excipients or carriers comprising, for example, cocoa butter, polyethylene glycol, a suppository wax or a salicylate, and which is solid at room temperature, but liquid at body temperature and, therefore, will melt in the body cavity and release the active agent.

[000124] Dosage forms for transdermal administration of a subject composition include powders, sprays, ointments, pastes, creams, lotions, gels, solutions, patches and inhalants. The active component may be mixed under sterile conditions with a pharmaceutically acceptable carrier, and with any preservatives, buffers, or propellants which may be required.

[000125] The ointments, pastes, creams and gels may contain, in addition to a subject composition, excipients, such as animal and vegetable fats, oils, waxes, paraffins, starch, tragacanth, cellulose derivatives, polyethylene glycols, silicones, bentonites, silicic acid, talc and zinc oxide, or mixtures thereof.

[000126] Powders and sprays may contain, in addition to a subject composition, excipients such as lactose, talc, silicic acid, aluminum hydroxide, calcium silicates and polyamide powder, or mixtures of these substances. Sprays may additionally contain customary propellants, such as chlorofluorohydrocarbons and volatile unsubstituted hydrocarbons, such as butane and propane.

[000127] Compositions and compounds of the present disclosure may alternatively be administered by aerosol. This is accomplished by preparing an aqueous aerosol, liposomal preparation or solid particles containing the compound. A non-aqueous (e.g., fluorocarbon propellant) suspension could be used. Sonic nebulizers may be used because they minimize exposing the agent to shear, which may result in degradation of the compounds contained in the subject compositions. Ordinarily, an aqueous aerosol is made by formulating an aqueous solution or suspension of a subject composition together with conventional pharmaceutically acceptable carriers and stabilizers. The carriers and stabilizers vary with the requirements of the particular subject composition, but typically include non-ionic surfactants (Tweens, Pluronics, or polyethylene glycol), innocuous proteins like serum albumin, sorbitan esters, oleic acid, lecithin, amino acids such as glycine, buffers, salts, sugars or sugar alcohols. Aerosols generally are prepared from isotonic solutions.

[000128] Pharmaceutical compositions of this disclosure suitable for parenteral administration comprise a subject composition in combination with one or more pharmaceutically-acceptable sterile isotonic aqueous or non-aqueous solutions, dispersions, suspensions or emulsions, or sterile powders which may be reconstituted into sterile injectable solutions or dispersions just prior to use, which may contain antioxidants, buffers, bacteriostats, solutes which render the formulation isotonic with the blood of the intended recipient or suspending or thickening agents.

[000129] Examples of suitable aqueous and non-aqueous carriers which may be employed in the pharmaceutical compositions of the disclosure include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate and cyclodextrins. Proper fluidity may be maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants

[000130] In another aspect, the disclosure provides enteral pharmaceutical formulations including a disclosed compound and an enteric material; and a pharmaceutically acceptable carrier or excipient thereof. Enteric materials refer to polymers that are substantially insoluble in the acidic environment of the stomach, and that are predominantly soluble in intestinal fluids at specific pHs. The small intestine is the part of the gastrointestinal tract (gut) between the stomach and the large intestine, and includes the duodenum, jejunum, and ileum. The pH of the duodenum is about 5.5, the pH of the jejunum is about 6.5 and the pH of the distal ileum is about 7.5. Accordingly, enteric materials are not soluble, for example, until a pH of about 5.0, of about 5.2, of about 5.4, of about 5.6, of about 5.8, of about 6.0, of about 6.2, of about 6.4, of about 6.6, of about 6.8, of about 7.0, of about 7.2, of about 7.4, of about 7.6, of about 7.8, of about 8.0, of about 8.2, of about 8.4, of about 8.6, of about 8.8, of about 9.0, of about 9.2, of about 9.4, of about 9.6, of about 9.8, or of about 10.0. Exemplary enteric materials include cellulose acetate phthalate (CAP), hydroxypropyl methylcellulose phthalate (HPMCP), polyvinyl acetate phthalate (PVAP), hydroxypropyl methylcellulose acetate succinate (HPMCAS), cellulose acetate trimellitate, hydroxypropyl methylcellulose succinate, cellulose acetate succinate, cellulose acetate hexahydrophthalate, cellulose propionate phthalate, cellulose acetate maleate, cellulose acetate butyrate, cellulose acetate propionate, copolymer of methylmethacrylic acid and methyl methacrylate, copolymer of methyl acrylate, methylmethacrylate and methacrylic acid, copolymer of methylvinyl ether and maleic anhydride (Gantrez ES series), ethyl methyacrylate- methylmethacry late- chlorotrimethylammonium ethyl acrylate copolymer, natural resins such as zein, shellac and copal collophorium, and several commercially available enteric dispersion systems (e. g. , Eudragit L30D55, Eudragit FS30D, Eudragit L100, Eudragit S100, Kollicoat EMM30D, Estacryl 30D, Coateric, and Aquateric). The solubility of each of the above materials is either known or is readily determinable in vitro. The foregoing is a list of possible materials, but one of skill in the art with the benefit of the disclosure would recognize that it is not comprehensive and that there are other enteric materials that would meet the objectives of the present disclosure.

[000131] Advantageously, the disclosure also provides kits for use by a e.g. a consumer in need of 3 CL inhibitor. Such kits include a suitable dosage form such as those described above and instructions describing the method of using such dosage form to mediate, reduce or prevent inflammation. The instructions would direct the consumer or medical personnel to administer the dosage form according to administration modes known to those skilled in the art. Such kits could advantageously be packaged and sold in single or multiple kit units. An example of such a kit is a so-called blister pack. Blister packs are well-known in the packaging industry and are being widely used for the packaging of pharmaceutical unit dosage forms (tablets, capsules, and the like). Blister packs generally consist of a sheet of relatively stiff material covered with a foil of a preferably transparent plastic material. During the packaging process recesses are formed in the plastic foil. The recesses have the size and shape of the tablets or capsules to be packed. Next, the tablets or capsules are placed in the recesses and the sheet of relatively stiff material is sealed against the plastic foil at the face of the foil which is opposite from the direction in which the recesses were formed. As a result, the tablets or capsules are sealed in the recesses between the plastic foil and the sheet. Preferably the strength of the sheet is such that the tablets or capsules can be removed from the blister pack by manually applying pressure on the recesses whereby an opening is formed in the sheet at the place of the recess. The tablet or capsule can then be removed via said opening.

[000132] It may be desirable to provide a memory aid on the kit, e.g., in the form of numbers next to the tablets or capsules whereby the numbers correspond with the days of the regimen which the tablets or capsules so specified should be ingested. Another example of such a memory aid is a calendar printed on the card, e.g., as follows “First Week, Monday, Tuesday, . . . etc. . . . Second Week, Monday, Tuesday, . . . “ etc. Other variations of memory aids will be readily apparent. A “daily dose” can be a single tablet or capsule or several pills or capsules to be taken on a given day. Also, a daily dose of a first compound can consist of one tablet or capsule while a daily dose of the second compound can consist of several tablets or capsules and vice versa. The memory aid should reflect this.

[000133] Also contemplated herein are methods and compositions that include a second active agent or administering a second active agent. For example, in addition to having a viral infection, a subject or patient can further have viral infection- or virus-related co-morbidities, i.e., diseases and other adverse health conditions associated with, exacerbated by, or precipitated by being infected by a virus. Contemplated herein are disclosed compounds in combination with at least one other agent that has previously been shown to treat these virus-related conditions.

EXAMPLES

[000134] The compounds described herein can be prepared in a number of ways based on the teachings contained herein and synthetic procedures known in the art. In the description of the synthetic methods described below, it is to be understood that all proposed reaction conditions, including choice of solvent, reaction atmosphere, reaction temperature, duration of the experiment and workup procedures, can be chosen to be the conditions standard for that reaction, unless otherwise indicated. It is understood by one skilled in the art of organic synthesis that the functionality present on various portions of the molecule should be compatible with the reagents and reactions proposed. Substituents not compatible with the reaction conditions will be apparent to one skilled in the art, and alternate methods are therefore indicated. The starting materials for the examples are either commercially available or are readily prepared by standard methods from known materials.

[000135] At least some of the compounds identified as “Intermediates” herein are contemplated as compounds of the disclosure.

[000136] spectra are recorded at ambient temperature using e.g., a Varian Unity

Inova (400MHz) spectrometer with a triple resonance 5mm probe for Example compounds, and either a Bruker Avance DRX (400MHz) spectrometer or a Bruker Avance DPX (300MHz) spectrometer for Intermediate compounds. Chemical shifts are expressed in ppm relative to tetramethylsilane. The following abbreviations have been used: br = broad signal, s = singlet, d = doublet, dd = double doublet, dt = double triplet, ddd = double doublet, t = triplet, td = triple doublet, tdd = triple double doublet, q = quartet, m = multiplet.

[000137] The following abbreviations are used in this disclosure and have the following definitions: “AcOH” is acetic acid, “BOP” is (benzotriazol- 1- yloxytris(dimethylamino)phosphonium hexafluorophosphate), “DCM” is dichloromethane, “DIPEA” is N,N-diisopropylethylamine, “DMSO” is dimethyl sulfoxide, “EtOH” is ethanol, “EtOAc” is ethyl acetate, “MeOH” is methanol, “MeCN” is acetonitrile, “MTBE” is methyl tert- butyl ether, “RT” is room temperature, “T3P” is propanephosphonic acid anhydride, “Pd(PPh3)4” is tetrakis(triphenylphosphine)palladium(0), “UPLC” is ultra performance liquid chromatography, “HPLC” is high-performance liquid chromatography, “NELiOAc” is ammonium acetate, “TEA” is triethylamine, and “TFA” is trifluoroacetic acid.

General Chemistry

[000138] Exemplary compounds described herein are available by the general synthetic methods illustrated in the Schemes below, Intermediate preparations, and the accompanying Examples.

Scheme 1

[000139] Scheme 1 illustrates an exemplary preparation of amidine E-I. Treatment of A-I with a sulfonyl chloride, which can be aryl sulfonyl chloride or heteroaryl sulfonyl chloride, in the presence of base (e.g. triethylamine) affords compound B-I. Further treatment of B-I with hydrogen sulfide affords compound C-I. After methylating intermediate C-I to afford D-I in the presence of methyl iodide, intermediate D-I is converted to amidine E-I with using ammonium acetate.

[000140] In Scheme 1, examples of X ¹ include optionally substituted aryl, optionally substituted heteroaryl, and optionally substituted heterocyclyl, and examples of Y ¹ include optionally substituted aryl, optionally substituted heteroaryl, and optionally substituted heterocyclyl. The optional substituents of X ¹ and Y ¹ are exemplified by the tables of intermediates disclosed herein.

Scheme 2

[000141] Scheme 2 illustrates an exemplary preparation for amidine E-2I. Reacting the nitrile A-2I with a sulfonyl chloride (e.g., aryl sulfonyl chloride, heteroaryl sulfonyl chloride) in the presence of a base (e.g., Na ₂ CO ₃ ) affords B-2I. Treating B-2I with 2-aminobenzenethiol in the presence of a base (e.g., N,N-diisopropylethylamine) affords benzothiazole C-2I. Upon reacting C-2I with hydroxylamine hydrochloride affords hydroxybenzimidamide D-2I, which can further be treated with ammonium acetate to afford amidine E-2I. Examples of variable Y ¹¹ include, but not limited to, optionally substituted phenyl or naphthyl, optionally substituted heteroaryl, optionally substituted cycloalkyl, and optionally substituted heterocyclyl, and Y ¹² include, but not limited to, hydrogen, halogen, cyano, hydroxyl, alkyl, cycloalkyl, and heteroalkyl.

[000142] The compounds disclosed herein can be prepared by methods known from the literature, purified at the end by preparative HPLC and are present at TFA salts (Stiirzebecher et al., Bioorg. Med Chem. Lett., 9, 3147-3152 (1999); Steinmetzer et al., J. Med. Chem. 49, 4116- 4126, (2006); Steinmetzer et al., Bioorg. Med. Chem. Lett. 67-73, (2009); Schweinitz et al., Bioorg. Med. Chem. Lett 19, 1960-1965, (2009); Stuirzebecher et al., J. Med. Chem., 40, 3091- 3099, (1997); Hammami et al MedChemComm 3, 807-813 (2012); Steinmetzer et al., PCT Int.

App. (2013) W02013014074 Al)). Compounds with a 3-amidinoazaphenylalanine as a central building block are also synthesized by literature methods (Zega et al., Bioorg Med Chem 14 (2004) 1563-1567, Zega et al Bioorg Med Chem 9 (2001) 2745 -2756).

Example 1: Exemplary synthesis of Compound 101

[000143] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e)

[000144] To a magnetically stirred solution of 2-{[(tert-butoxy)carbonyl]amino}-3-(3- cyanophenyl)propanoic acid (2.00 g, 6.89 mmol, 1.0 eq.) in toluene (40.0 mL) were added DIPEA (1.8 mL, 10.3 mmol, 1.5 eq.) and 2-aminothiophenol (0.79 mL, 7.58 mmol, 1.1 eq.). The mixture was cooled in an ice/water bath and placed under a nitrogen atmosphere before adding T3P (50% w/w in EtOAc) (1.8 mL, 10.3 mmol, 1.2 eq.) dropwise over 10 minutes. The reaction mixture was allowed to warm to RT for 20 mins and then stirred under reflux for 0.5 h. The reaction mixture was cooled to RT and then diluted with EtOAc (50 mL). The mixture was washed with aq. saturated Na ₂ CO ₃ solution and the organic layer dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, isohexane to afford product as a pale yellow solid (1.77 g, 4.66 mmol, 68% yield).

[000145] ¹ H NMR (DMSO-d6) 5: 8.10 (d, J = 7.7 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.92 (d, J = 8.9 Hz, 1H), 7.82 (s, 1H), 7.72 (d, J = 7.9 Hz, 2H), 7.53 (td, J = 8.1, 3.6 Hz, 2H), 7.45 (t, J = 7.6 Hz, 1H), 5.24 - 5.05 (m, 1H), 3.56 (dd, J = 13.5, 4.8 Hz, 1H), 3.22 - 3.06 (m, 1H), 1.31 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 380.0 for [M+H] ⁺

[000146] Step 2: l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethan-l-aminium trifluoroacetate

[000147] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl) ethylcarbamate (1.77 g, 4.66 mmol, 1.0 eq,) in DCM (20.0 mL) was added trifluoroacetic acid (10.0 mL, 131 mmol, 28.0 eq,) and the reaction mixture was stirred at RT for Ih. The reaction mixture was concentrated to dryness to afford product as a gummy solid (1.90 g, 4.66 mmol, 100% yield) which was used in the next step without further purification.

[000148] ¹ H NMR (DMSO-d6) 5: 8.89 (s, 3H), 8.17 (d, J = 7.9 Hz, IH), 8.08 (d, J = 8.1 Hz, IH), 7.82 (s, IH), 7.76 (d, J = 7.6 Hz, IH), 7.59 (d, J = 7.3 Hz, 2H), 7.52 (t, J = 7.7 Hz, 2H), 5.36 (s, IH), 3.41 (qd, J = 13.9, 7.3 Hz, 2H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 279.9 for [M-H] ⁺

[000149] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro benzene-l- sulfonamide

[000150] To a magnetically stirred solution of l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethan-l-aminium trifluoroacetate (1.84 g, 4.66 mmol, 1.0 eq,) in DMF (18.0 mL) was added tri ethylamine (3.9 mL, 28.0 mmol, 6.0 eq,) and the reaction mixture was cooled to 0°C. 3 -nitrobenzene-1-sulfonyl chloride (1.24 g, 5.60 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 18 h. The reaction mixture was concentrated to dryness and the residue purified by Normal Phase Column Chromatography with a 0-50% EtOAc, hexane eluent to afford product as a pale yellow solid (1.30 g, 2.80 mmol, 60% yield).

[000151] ¹ H NMR (DMSO-d6) 5: 9.36 (d, J = 6.1 Hz, 1H), 8.20 (d, J = 8.3 Hz, 1H), 8.14 - 8.05 (m, 2H), 7.95 - 7.84 (m, 2H), 7.70 - 7.21 (m, 7H), 5.21 - 5.19 (m, 1H), 3.42 (dd, J = 13.8, 4.2 Hz, 1H), 3.11 - 3.00 (m, 1H). UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 464.9 for [M+H] ⁺

[000152] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[000153] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] -3 -nitrobenzene-1-sulfonamide (1.03 g, 2.21 mmol, 1.0 eq.) in ethanol (8.2 mb) and water (4.1 mL) were added iron (1.23 g, 22.1 mmol, 10.0 eq.) and ammonium chloride (0.590 g, 11.0 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3.5 hrs. The reaction mixture was then cooled to RT and stirred for 18 h. The reaction mixture was filtered through a plug of celite and washed with EtOH. The filtrate was concentrated to dryness and the residue taken up in EtOAc (30 mL). The organic layer was washed with aq. saturated NaHCO3 solution (30 mL) and brine (40 mL). The organic layer was dried over sodium sulfate and concentrated to dryness to afford product as a light brown solid (0.477 g, 1.10 mmol, 47% yield) which was used in the next step without further purification.

[000154] ¹ H NMR (DMSO-d6): 5 8.71 (s, 1H), 8.08 (d, J = 7.9 Hz, 1H), 7.94 (d, J = 8.1 Hz, 1H), 7.57 (s, 1H), 7.53 (t, J = 7.6 Hz, 2H), 7.43 (t, J = 7.6 Hz, 1H), 7.33 (t, J = 7.8 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (s, 1H), 6.58 (d, J = 7.8 Hz, 2H), 5.39 (d, J = 7.0 Hz, 2H), 4.89 (d, J = 9.4 Hz, 1H), 3.36 (dd, J = 13.7, 4.8 Hz, 1H), 2.98 (dd, J = 13.9, 9.9 Hz, 1H), 1.36 (d, J = 9.5 Hz, 1H), 1.24 (s, 1H). UPLC-MS (basic 2 mm) Rt = 1.06 mm. m/z = 435.0 for [M+H] ⁺

[000155] Step 5: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carbamate

[000156] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] benzenesulfonamide (0.210 g, 0.481 mmol, 1.0 eq.) in DMF (2 mL) were added N-Boc-beta-alanine (0.110 g, 0.577 mmol, 1.2 eq.), DIPEA (0.25 mL, 1.44 mmol, 3.0 eq.) and HATU (0.28 g, 0.721 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 21 h. The reaction mixture was concentrated to dryness to afford product as a light brown solid (0.291 g, 0.481 mmol, 100% yield) which was used in the next step without further purification. UPLC- MS (basic 2 min) Rt = 1.15 min. m/z = 606.0 for [M+H] ⁺

[000157] Step 6: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl] sulfamoyl]anilino]-3-oxo-propyl]carbamate

[000158] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carba mate (0.480 g, 0.787 mmol, 1.0 eq.) in EtOH (8.0 mL) were added hydroxylamine hydrochloride (0.110 g, 1.57 mmol, 2.0 eq.) and DIPEA (0.41 mL, 2.36 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown oil (0.503 g, 0.787 mmol, 100% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 639.1 for [M+H] ⁺

[000159] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[3-(tert-butoxyc arbonylamino) propanoylamino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate

[000160] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2- [3 -(N'-hydroxycarbamimidoyl)pheny 1] ethyl] sulfamoyl]anilino] -3 -oxo-propyl] carbamate (0.730 g, 1.14 mmol, 1.0 eq) in acetic acid (7.0 mL) was added acetic anhydride (0.32 mL, 3.42 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 22 mins. The reaction mixture was concentrated to dryness and the residue was purified by Normal Phase column chromatography eluting with a 100% EtOAc eluent to afford product as a colourless oil (0.220 g, 0.317 mmol, 22% yield).

[000161] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 9.97 (s, 1H), 8.04 (d, J = 8.0 Hz, 1H), 7.94 - 7.86 (m, 2H), 7.57 (s, 1H), 7.53 - 7.37 (m, 4H), 7.25 - 7.07 (m, 4H), 6.86 (s, 1H), 6.70 (s, 2H), 4.91 (s, 1H), 3.25 - 3.18 (m, 2H), 3.06 - 2.96 (m, 1H), 2.13 (d, J = 15.0 Hz, 4H), 1.82 (s, 1H), 1.39 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 681.3 for [M] ⁺

[000162] Step 8: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl] sulfamoy l]anilino] -3 -oxo-propyl] carbamate

[000163] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[3- (tert- butoxycarbonylamino)propanoylamino]phenyl]sulfonylamino]ethy l]phenyl]methylene]amino] acetate (0.220 g, 0.317 mmol, 1.0 eq) in acetic acid (5.0 mL) was added zinc (0.210 g, 3.17 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 18h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5- 95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.037 g, 0.059 mmol, 19% yield). UPLC-MS (basic 4 min): Rt = 2.73 min; m/z = 623.1 for [M] ⁺ , 98% purity

[000164] Step 9: 3-amino-N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylp henyl) ethyl]sulfamoyl]phenyl]propanamide;dihydrochloride

[000165] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-carbamimidoyl phenyl)ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate (0.037 g, 0.059 mmol, 1.00 eq.) in DCM (2 mL) was added 4N HC1 in 1,4-Dioxane solution (2.0 mL, 8.00 mmol, 135 eq.) and the reaction mixture was stirred at RT for 0.5 h. The reaction mixture was concentrated to dryness and the residue dried in the vacuum oven for 18 h to afford product as a white solid. (0.031 g, 0.051 mmol, 85% yield)

[000166] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 10.28 (s, 1H), 9.20 (s, 2H), 8.98 (s, 2H), 8.91 (d, J = 8.1 Hz, 1H), 8.09 - 8.03 (m, 1H), 7.91 (dd, J = 4.9, 2.9 Hz, 2H), 7.82 (s, 3H), 7.72 (s, 1H), 7.59 - 7.38 (m, 5H), 7.27 (t, J = 7.8 Hz, 1H), 7.19 - 7.07 (m, 2H), 5.06 - 4.96 (m, 1H), 3.38 (dd, J = 14.0, 5.1 Hz, 1H), 3.12 - 3.00 (m, 3H), 2.72 (t, J = 6.8 Hz, 2H). UPLC-MS (basic 6 mm): Rt = 1.93 min; m/z = 523.0 for [M] ⁺ , 97% purity.

Example 2: Exemplary synthesis of Compound 101

[000167] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e)

[000168] To a magnetically stirred solution of 2-{[(tert-butoxy)carbonyl]amino}-3-(3- cyanophenyl)propanoic acid (2.00 g, 6.89 mmol, 1.0 eq.) in toluene (40.0 mL) were added DIPEA (1.8 mL, 10.3 mmol, 1.5 eq.) and 2-aminothiophenol (0.79 mL, 7.58 mmol, 1.1 eq.). The mixture was cooled in an ice/water bath and placed under a nitrogen atmosphere before adding T3P (50% w/w in EtOAc) (1.8 mL, 10.3 mmol, 1.2 eq.) dropwise over 10 minutes. The reaction mixture was allowed to warm to RT for 20 mins and then stirred under reflux for 0.5 h. The reaction mixture was cooled to RT and then diluted with EtOAc (50 mL). The mixture was washed with aq. saturated Na ₂ CO ₃ solution and the organic layer dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, isohexane to afford product as a pale yellow solid (1.77 g, 4.66 mmol, 68% yield).

[000169] ¹ H NMR (DMSO-d6) 5: 8.10 (d, J = 7.7 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.92 (d, J = 8.9 Hz, 1H), 7.82 (s, 1H), 7.72 (d, J = 7.9 Hz, 2H), 7.53 (td, J = 8.1, 3.6 Hz, 2H), 7.45 (t, J = 7.6 Hz, 1H), 5.24 - 5.05 (m, 1H), 3.56 (dd, J = 13.5, 4.8 Hz, 1H), 3.22 - 3.06 (m, 1H), 1.31 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 380.0 for [M+H] ⁺

[000170] Step 2: l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethan-l-aminium trifluoroacetate

[000171] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl) ethylcarbamate (1.77 g, 4.66 mmol, 1.0 eq,) in DCM (20.0 mL) was added trifluoroacetic acid (10.0 mL, 131 mmol, 28.0 eq,) and the reaction mixture was stirred at RT for Ih. The reaction mixture was concentrated to dryness to afford product as a gummy solid (1.90 g, 4.66 mmol, 100% yield) which was used in the next step without further purification.

[000172] ¹ H NMR (DMSO-d6) 5: 8.89 (s, 3H), 8.17 (d, J = 7.9 Hz, IH), 8.08 (d, J = 8.1 Hz, IH), 7.82 (s, IH), 7.76 (d, J = 7.6 Hz, IH), 7.59 (d, J = 7.3 Hz, 2H), 7.52 (t, J = 7.7 Hz, 2H), 5.36 (s, IH), 3.41 (qd, J = 13.9, 7.3 Hz, 2H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 279.9 for [M-H] ⁺

[000173] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro benzene-l- sulfonamide

[000174] To a magnetically stirred solution of l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethan-l-aminium trifluoroacetate (1.84 g, 4.66 mmol, 1.0 eq,) in DMF (18.0 mL) was added tri ethylamine (3.9 mL, 28.0 mmol, 6.0 eq,) and the reaction mixture was cooled to 0°C. 3 -nitrobenzene-1-sulfonyl chloride (1.24 g, 5.60 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 18 h. The reaction mixture was concentrated to dryness and the residue purified by Normal Phase Column Chromatography with a 0-50% EtOAc, hexane eluent to afford product as a pale yellow solid (1.30 g, 2.80 mmol, 60% yield).

[000175] ¹ H NMR (DMSO-d6) 5: 9.36 (d, J = 6.1 Hz, 1H), 8.20 (d, J = 8.3 Hz, 1H), 8.14 - 8.05 (m, 2H), 7.95 - 7.84 (m, 2H), 7.70 - 7.21 (m, 7H), 5.21 - 5.19 (m, 1H), 3.42 (dd, J = 13.8, 4.2 Hz, 1H), 3.11 - 3.00 (m, 1H). UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 464.9 for [M+H] ⁺

[000176] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[000177] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] -3 -nitrobenzene-1-sulfonamide (1.03 g, 2.21 mmol, 1.0 eq.) in ethanol (8.2 mb) and water (4.1 mL) were added iron (1.23 g, 22.1 mmol, 10.0 eq.) and ammonium chloride (0.590 g, 11.0 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3.5 hrs. The reaction mixture was then cooled to RT and stirred for 18 h. The reaction mixture was filtered through a plug of celite and washed with EtOH. The filtrate was concentrated to dryness and the residue taken up in EtOAc (30 mL). The organic layer was washed with aq. saturated NaHCO3 solution (30 mL) and brine (40 mL). The organic layer was dried over sodium sulfate and concentrated to dryness to afford product as a light brown solid (0.477 g, 1.10 mmol, 47% yield) which was used in the next step without further purification.

[000178] ¹ H NMR (DMSO-d6): 5 8.71 (s, 1H), 8.08 (d, J = 7.9 Hz, 1H), 7.94 (d, J = 8.1 Hz, 1H), 7.57 (s, 1H), 7.53 (t, J = 7.6 Hz, 2H), 7.43 (t, J = 7.6 Hz, 1H), 7.33 (t, J = 7.8 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (s, 1H), 6.58 (d, J = 7.8 Hz, 2H), 5.39 (d, J = 7.0 Hz, 2H), 4.89 (d, J = 9.4 Hz, 1H), 3.36 (dd, J = 13.7, 4.8 Hz, 1H), 2.98 (dd, J = 13.9, 9.9 Hz, 1H), 1.36 (d, J = 9.5 Hz, 1H), 1.24 (s, 1H). UPLC-MS (basic 2 mm) Rt = 1.06 mm. m/z = 435.0 for [M+H] ⁺

[000179] Step 5: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carbamate

[000180] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] benzenesulfonamide (0.210 g, 0.481 mmol, 1.0 eq.) in DMF (2 mL) were added N-Boc-beta-alanine (0.110 g, 0.577 mmol, 1.2 eq.), DIPEA (0.25 mL, 1.44 mmol, 3.0 eq.) and HATU (0.28 g, 0.721 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 21 h. The reaction mixture was concentrated to dryness to afford product as a light brown solid (0.291 g, 0.481 mmol, 100% yield) which was used in the next step without further purification. UPLC- MS (basic 2 min) Rt = 1.15 min. m/z = 606.0 for [M+H] ⁺

[000181] Step 6: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl] sulfamoyl]anilino]-3-oxo-propyl]carbamate

[000182] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carba mate (0.480 g, 0.787 mmol, 1.0 eq.) in EtOH (8.0 mL) were added hydroxylamine hydrochloride (0.110 g, 1.57 mmol, 2.0 eq.) and DIPEA (0.41 mL, 2.36 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown oil (0.503 g, 0.787 mmol, 100% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 639.1 for [M+H] ⁺

[000183] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[3-(tert-butoxyc arbonylamino) propanoylamino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate

[000184] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2- [3 -(N'-hydroxycarbamimidoyl)pheny 1] ethyl] sulfamoyl]anilino] -3 -oxo-propyl] carbamate (0.730 g, 1.14 mmol, 1.0 eq) in acetic acid (7.0 mL) was added acetic anhydride (0.32 mL, 3.42 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 22 mins. The reaction mixture was concentrated to dryness and the residue was purified by Normal Phase column chromatography eluting with a 100% EtOAc eluent to afford product as a colourless oil (0.220 g, 0.317 mmol, 22% yield).

[000185] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 9.97 (s, 1H), 8.04 (d, J = 8.0 Hz, 1H), 7.94 - 7.86 (m, 2H), 7.57 (s, 1H), 7.53 - 7.37 (m, 4H), 7.25 - 7.07 (m, 4H), 6.86 (s, 1H), 6.70 (s, 2H), 4.91 (s, 1H), 3.25 - 3.18 (m, 2H), 3.06 - 2.96 (m, 1H), 2.13 (d, J = 15.0 Hz, 4H), 1.82 (s, 1H), 1.39 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 681.3 for [M] ⁺

[000186] Step 8: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl] sulfamoy l]anilino] -3 -oxo-propyl] carbamate

[000187] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[3- (tert- butoxycarbonylamino)propanoylamino]phenyl]sulfonylamino]ethy l]phenyl]methylene]amino] acetate (0.220 g, 0.317 mmol, 1.0 eq) in acetic acid (5.0 mL) was added zinc (0.210 g, 3.17 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 18h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5- 95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.037 g, 0.059 mmol, 19% yield). UPLC-MS (basic 4 min): Rt = 2.73 min; m/z = 623.1 for [M] ⁺ , 98% purity

[000188] Step 9: 3-amino-N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylp henyl) ethyl]sulfamoyl]phenyl] propanamide

[000189] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-carbamimidoyl phenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carbamate (0.037 g, 0.059 mmol, 1.00 eq.) in DCM (2 mL) was added 4N HC1 in 1,4-Dioxane solution (2.0 mL, 8.00 mmol, 135 eq.) and the reaction mixture was stirred at RT for 0.5 h. The reaction mixture was concentrated to dryness and the residue dried in the vacuum oven for 18 h to afford product as a white solid. (0.031 g, 0.051 mmol, 85% yield)

[000190] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 10.28 (s, 1H), 9.20 (s, 2H), 8.98 (s, 2H), 8.91 (d, J = 8.1 Hz, 1H), 8.09 - 8.03 (m, 1H), 7.91 (dd, J = 4.9, 2.9 Hz, 2H), 7.82 (s, 3H), 7.72 (s, 1H), 7.59 - 7.38 (m, 5H), 7.27 (t, J = 7.8 Hz, 1H), 7.19 - 7.07 (m, 2H), 5.06 - 4.96 (m, 1H), 3.38 (dd, J = 14.0, 5.1 Hz, 1H), 3.12 - 3.00 (m, 3H), 2.72 (t, J = 6.8 Hz, 2H). UPLC-MS (basic 6 mm): Rt = 1.93 min; m/z = 523.0 for [M] ⁺ , 97% purity

[000191] Chiral analysis performed by Reach Separations showed 50.1% chiral purity.

[000192] Product purified by SFC using Chiralpak IG (230mm x 250mm, 5um) with a 40:60 MeOH:CO2 (0.2% v/v NH3) eluent to afford product as a white solid (0.001 g). UPLC-MS (acidic 4 min): Rt = 0.86 min; m/z = 523.2 for [M+H]+, 89% purity. Chiral analysis performed by Reach Separations showed 98.1% chiral purity. Rt = 4.34 min.

Example 3: Exemplary synthesis of Compound 101

[000193] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e)

[000194] To a magnetically stirred solution of 2-{[(tert-butoxy)carbonyl]amino}-3-(3- cyanophenyl)propanoic acid (2.00 g, 6.89 mmol, 1.0 eq.) in toluene (40.0 mL) were added DIPEA (1.8 mL, 10.3 mmol, 1.5 eq.) and 2-aminothiophenol (0.79 mL, 7.58 mmol, 1.1 eq.). The mixture was cooled in an ice/water bath and placed under a nitrogen atmosphere before adding T3P (50% w/w in EtOAc) (1.8 mL, 10.3 mmol, 1.2 eq.) dropwise over 10 minutes. The reaction mixture was allowed to warm to RT for 20 mins and then stirred under reflux for 0.5 h. The reaction mixture was cooled to RT and then diluted with EtOAc (50 mL). The mixture was washed with aq. saturated Na ₂ CO ₃ solution and the organic layer dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, isohexane to afford product as a pale yellow solid (1.77 g, 4.66 mmol, 68% yield).

[000195] ¹ H NMR (DMSO-d6) 5: 8.10 (d, J = 7.7 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.92 (d, J = 8.9 Hz, 1H), 7.82 (s, 1H), 7.72 (d, J = 7.9 Hz, 2H), 7.53 (td, J = 8.1, 3.6 Hz, 2H), 7.45 (t, J = 7.6 Hz, 1H), 5.24 - 5.05 (m, 1H), 3.56 (dd, J = 13.5, 4.8 Hz, 1H), 3.22 - 3.06 (m, 1H), 1.31 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.22 mm. m/z = 380.0 for [M+H] ⁺

[000196] Step 2: l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethan-l-aminium trifluoroacetate

[000197] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl) ethylcarbamate (1.77 g, 4.66 mmol, 1.0 eq,) in DCM (20.0 mL) was added trifluoroacetic acid (10.0 mL, 131 mmol, 28.0 eq,) and the reaction mixture was stirred at RT for Ih. The reaction mixture was concentrated to dryness to afford product as a gummy solid (1.90 g, 4.66 mmol, 100% yield) which was used in the next step without further purification.

[000198] ¹ H NMR (DMSO-d6) 5: 8.89 (s, 3H), 8.17 (d, J = 7.9 Hz, IH), 8.08 (d, J = 8.1 Hz, IH), 7.82 (s, IH), 7.76 (d, J = 7.6 Hz, IH), 7.59 (d, J = 7.3 Hz, 2H), 7.52 (t, J = 7.7 Hz, 2H), 5.36 (s, IH), 3.41 (qd, J = 13.9, 7.3 Hz, 2H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 279.9 for [M-H] ⁺

[000199] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro benzene-l- sulfonamide

[000200] To a magnetically stirred solution of l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethan-l-aminium trifluoroacetate (1.84 g, 4.66 mmol, 1.0 eq,) in DMF (18.0 mL) was added tri ethylamine (3.9 mL, 28.0 mmol, 6.0 eq,) and the reaction mixture was cooled to 0°C. 3 -nitrobenzene-1-sulfonyl chloride (1.24 g, 5.60 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 18 h. The reaction mixture was concentrated to dryness and the residue purified by Normal Phase Column Chromatography with a 0-50% EtOAc, hexane eluent to afford product as a pale yellow solid (1.30 g, 2.80 mmol, 60% yield).

[000201] ¹ H NMR (DMSO-d6) 5: 9.36 (d, J = 6.1 Hz, 1H), 8.20 (d, J = 8.3 Hz, 1H), 8.14 - 8.05 (m, 2H), 7.95 - 7.84 (m, 2H), 7.70 - 7.21 (m, 7H), 5.21 - 5.19 (m, 1H), 3.42 (dd, J = 13.8, 4.2 Hz, 1H), 3.11 - 3.00 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.14 mm. m/z = 464.9 for [M+H] ⁺

[000202] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[000203] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] -3 -nitrobenzene-1-sulfonamide (1.03 g, 2.21 mmol, 1.0 eq.) in ethanol (8.2 mb) and water (4.1 mL) were added iron (1.23 g, 22.1 mmol, 10.0 eq.) and ammonium chloride (0.590 g, 11.0 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3.5 hrs. The reaction mixture was then cooled to RT and stirred for 18 h. The reaction mixture was filtered through a plug of celite and washed with EtOH. The filtrate was concentrated to dryness and the residue taken up in EtOAc (30 mL). The organic layer was washed with aq. saturated NaHCO3 solution (30 mL) and brine (40 mL). The organic layer was dried over sodium sulfate and concentrated to dryness to afford product as a light brown solid (0.477 g, 1.10 mmol, 47% yield) which was used in the next step without further purification.

[000204] ¹ H NMR (DMSO-d6): 5 8.71 (s, 1H), 8.08 (d, J = 7.9 Hz, 1H), 7.94 (d, J = 8.1 Hz, 1H), 7.57 (s, 1H), 7.53 (t, J = 7.6 Hz, 2H), 7.43 (t, J = 7.6 Hz, 1H), 7.33 (t, J = 7.8 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (s, 1H), 6.58 (d, J = 7.8 Hz, 2H), 5.39 (d, J = 7.0 Hz, 2H), 4.89 (d, J = 9.4 Hz, 1H), 3.36 (dd, J = 13.7, 4.8 Hz, 1H), 2.98 (dd, J = 13.9, 9.9 Hz, 1H), 1.36 (d, J = 9.5 Hz, 1H), 1.24 (s, 1H). UPLC-MS (basic 2 mm) Rt = 1.06 mm. m/z = 435.0 for [M+H] ⁺

[000205] Step 5: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carbamate

[000206] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] benzenesulfonamide (0.210 g, 0.481 mmol, 1.0 eq.) in DMF (2 mL) were added N-Boc-beta-alanine (0.110 g, 0.577 mmol, 1.2 eq.), DIPEA (0.25 mL, 1.44 mmol, 3.0 eq.) and HATU (0.28 g, 0.721 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 21 h. The reaction mixture was concentrated to dryness to afford product as a light brown solid (0.291 g, 0.481 mmol, 100% yield) which was used in the next step without further purification. UPLC- MS (basic 2 min) Rt = 1.15 min. m/z = 606.0 for [M+H] ⁺

[000207] Step 6: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl] sulfamoyl]anilino]-3-oxo-propyl]carbamate

[000208] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carba mate (0.480 g, 0.787 mmol, 1.0 eq.) in EtOH (8.0 mL) were added hydroxylamine hydrochloride (0.110 g, 1.57 mmol, 2.0 eq.) and DIPEA (0.41 mL, 2.36 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown oil (0.503 g, 0.787 mmol, 100% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 639.1 for [M+H] ⁺

[000209] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[3-(tert-butoxyc arbonylamino) propanoylamino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate

[000210] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2- [3 -(N'-hydroxycarbamimidoyl)pheny 1] ethyl] sulfamoyl]anilino] -3 -oxo-propyl] carbamate (0.730 g, 1.14 mmol, 1.0 eq) in acetic acid (7.0 mL) was added acetic anhydride (0.32 mL, 3.42 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 22 mins. The reaction mixture was concentrated to dryness and the residue was purified by Normal Phase column chromatography eluting with a 100% EtOAc eluent to afford product as a colourless oil (0.220 g, 0.317 mmol, 22% yield).

[000211] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 9.97 (s, 1H), 8.04 (d, J = 8.0 Hz, 1H), 7.94 - 7.86 (m, 2H), 7.57 (s, 1H), 7.53 - 7.37 (m, 4H), 7.25 - 7.07 (m, 4H), 6.86 (s, 1H), 6.70 (s, 2H), 4.91 (s, 1H), 3.25 - 3.18 (m, 2H), 3.06 - 2.96 (m, 1H), 2.13 (d, J = 15.0 Hz, 4H), 1.82 (s, 1H), 1.39 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 681.3 for [M] ⁺

[000212] Step 8: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl] sulfamoy l]anilino] -3 -oxo-propyl] carbamate

[000213] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[3- (tert- butoxycarbonylamino)propanoylamino]phenyl]sulfonylamino]ethy l]phenyl]methylene]amino] acetate (0.220 g, 0.317 mmol, 1.0 eq) in acetic acid (5.0 mL) was added zinc (0.210 g, 3.17 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 18h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5- 95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.037 g, 0.059 mmol, 19% yield). UPLC-MS (basic 4 min): Rt = 2.73 min; m/z = 623.1 for [M] ⁺ , 98% purity

[000214] Step 9: 3-amino-N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylp henyl) ethyl]sulfamoyl]phenyl] propanamide

[000215] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-carbamimidoyl phenyl)ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate (0.037 g, 0.059 mmol, 1.00 eq.) in DCM (2 mL) was added 4N HC1 in 1,4-Dioxane solution (2.0 mL, 8.00 mmol, 135 eq.) and the reaction mixture was stirred at RT for 0.5 h. The reaction mixture was concentrated to dryness and the residue dried in the vacuum oven for 18 h to afford product as a white solid. (0.031 g, 0.051 mmol, 85% yield)

[000216] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 10.28 (s, 1H), 9.20 (s, 2H), 8.98 (s, 2H), 8.91 (d, J = 8.1 Hz, 1H), 8.09 - 8.03 (m, 1H), 7.91 (dd, J = 4.9, 2.9 Hz, 2H), 7.82 (s, 3H), 7.72 (s, 1H), 7.59 - 7.38 (m, 5H), 7.27 (t, J = 7.8 Hz, 1H), 7.19 - 7.07 (m, 2H), 5.06 - 4.96 (m, 1H), 3.38 (dd,

J = 14.0, 5.1 Hz, 1H), 3.12 - 3.00 (m, 3H), 2.72 (t, J = 6.8 Hz, 2H).UPLC-MS (basic 6 mm): Rt

= 1.93 min; m/z = 523.0 for [M] ⁺ , 97% purity

[000217] Chiral analysis performed by Reach Separations showed 50.1% chiral purity.

Product purified by SFC using Chiralpak IG (230mm x 250mm, 5um) with a 40:60 MeOH:CO2 (0.2% v/v NH3) eluent to afford product as a white solid (0.001 g). UPLC-MS (acidic 4 min): Rt = 0.86 min; m/z = 523.2 for [M+H]+, 95% purity Chiral analysis performed by Reach Separations showed 98.7% chiral purity. Rt = 4.81 min.

Example 4: Exemplary synthesis of Compound 102

[000218] Step 1 : 3-(3-cyanophenyl)-2-(3-nitrobenzenesulfonamido)propanoic acid

[000219] To a magnetically stirred solution of sodium bicarbonate (1.34 g, 12.6 mmol, 1.2 eq.) in water (12 mL) was added 2-amino-3-(3-cyanophenyl)propanoic acid (2.00 g, 10.5 mmol, 1.0 eq.) and the resulting solution was cooled to -5 °C. 3 -nitrobenzene-1-sulfonyl chloride (2.33 g, 10.5 mmol, 1.0 eq.) was added in 4 portions over a period of 20 mins. The resulting slurry was allowed to warm to RT and stirred for 2 h. The reaction mixture was acidified with 50% HC1 and then filtered under vacuum. The solid was washed with water (2 x 50 mL) and then dried to afford product as a white solid (2.50 g, 6.66 mmol, 63% yield).

[000220] ¹ H NMR (DMSO-d6) 5: 13.01 (s, 1H), 8.74 (d, J = 9.5 Hz, 1H), 8.37 (d, J = 8.2 Hz, 1H), 8.21 (t, J = 2.1 Hz, 1H), 7.94 (d, J = 7.9 Hz, 1H), 7.73 (t, J = 7.9 Hz, 1H), 7.55 - 7.47 (m, 2H), 7.31 (t, J = 8.0 Hz, 1H), 4.10 (td, J = 10.1, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 4.5 Hz, 1H), 2.76 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 0.73 min. m/z = 374.0 for [M+H] ⁺

[000221] Step 2: 3-(3-cyanophenyl)-2-(3-nitrobenzenesulfonamido)propanamide)

[000222] To a magnetically stirred solution of 3-(3-cyanophenyl)-2-(3- nitrobenzenesulfonamido)propanoic acid (2.50 g, 6.66 mmol, 1.0 eq.) in DCM (66 mL) were added DIPEA (3.5 mL, 20.0 mmol, 3.0 eq.) and BOP (3.54 g, 7.99 mmol, 1.2 eq.). The mixture was stirred at RT for 15 minutes before adding cone, ammonia (2.3 mL, 33.3 mmol, 5.0 eq.). The reaction mixture was stirred at RT for 24 h before concentrating to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a white solid (2.50 g, 4.27 mmol, 64% yield).

[000223] ¹ H NMR (DMSO-d6) 5: 8.59 (s, 1H), 8.37 (dd, J = 7.9, 2.4 Hz, 1H), 8.21 (d, J = 2.1 Hz, 1H), 7.95 (d, J = 8.7 Hz, 1H), 7.73 (t, J = 8.0 Hz, 1H), 7.55 - 7.45 (m, 4H), 7.36 - 7.28 (m, 1H), 7.10 (s, 1H), 4.02 (s, 1H), 2.97 - 2.91 (m, 1H), 2.74 - 2.67 (m, 1H). UPLC-MS (acidic 2 min) Rt = 0.80 min. m/z = 373.0 for [M-H] ⁺

[000224] Step 3: 3-(3-cyanophenyl)-2-(3-nitrobenzenesulfonamido)propanethioam ide)

[000225] To a magnetically stirred solution of 3-(3-cyanophenyl)-2-(3- nitrobenzenesulfonamido)propanamide) (2.50 g, 4.27 mmol, 1.0 eq.) in MeCN (25.0 mL) was added La wesson’s Reagent (2.07 g, 5.13 mmol, 1.2 eq.) and the reaction mixture was stirred at RT for 24 h. The reaction mixture was cooled to RT and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O MeCN eluent (0.1 % ammonia) to afford product as a yellow solid (0.700 g, 1.79 mmol, 42% yield).

[000226] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 9.63 (s, 1H), 9.35 (s, 1H), 8.58 (s, 1H), 8.36 (dd, J = 8.6, 2.8 Hz, 1H), 8.22 (t, J = 2.0 Hz, 1H), 7.94 (d, J = 7.9 Hz, 1H), 7.72 (t, J = 8.1 Hz, 1H),

7.56 (s, 1H), 7.53 - 7.46 (m, 2H), 7.30 (t, J = 7.8 Hz, 1H), 4.34 (d, J = 5.5 Hz, 1H), 2.92 (dd, J = 13.8, 4.6 Hz, 1H), 2.81 (dd, J = 13.7, 10.0 Hz, 1H). UPLC-MS (basic 2 min): Rt = 0.89 min; m/z = 389.0 for [M-H] ⁺

[000227] Step 4: N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]-3-nitro-benzenesu lfonamide

[000228] To a magnetically stirred solution of 3-(3-cyanophenyl)-2-(3- nitrobenzenesulfonamido) propanethioamide) (0.700 g, 1.793 mmol, 1.0 eq.) in THF (18.0 mL) were added 2-bromo- 1,1 -dimethoxy ethane (0.636 mL, 5.38 mmol, 3.0 eq.) and 4N HC1 in 1,4- Dioxane (1.8 mL, 7.17 mmol, 4.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was cooled down to RT and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a brown solid (0.250 g, 0.603 mmol, 34% yield).

[000229] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 9.21 (s, 1H), 8.36 - 8.29 (m, 1H), 8.09 (s, 1H), 7.87 (d, J = 7.5 Hz, 1H), 7.72 - 7.42 (m, 6H), 7.24 (t, J = 7.9 Hz, 1H), 5.12 - 4.99 (m, 1H), 3.31 - 3.28 (m, 1H), 2.96 (t, J = 12.2 Hz, 1H). UPLC-MS (acidic 2 mm): Rt = 0.99 mm; m/z = 413.0 for [M] ⁺

[000230] Step 5: 3-amino-N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]benzenesul fonamide

[000231] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]-3- nitro-benzene sulfonamide (0.200 g, 0.483 mmol, 1.0 eq.) in ethanol (4 mL) and water (2 mL) were added iron (0.270 g, 4.80 mmol, 10.0 eq.) and ammonium chloride (0.129 g, 2.4 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3 hrs. The reaction mixture was then cooled to RT and was filtered through a plug of celite and washed with EtOH. The filtrate was concentrated to dryness and the residue taken up in EtOAc (10 mL). The organic layer was washed with aq. saturated NaHCO ₃ solution (2 x 10 mL) and brine (20 mL). The organic layer was dried over sodium sulfate and concentrated to dryness to afford product as a brown oil (0.184 g, 0.330 mmol, 68% yield) which was used in the next step without further purification.

[000232] ¹ H NMR (DMSO-d6): 5 8.56 (s, 1H), 7.71 (d, J = 3.2 Hz, 1H), 7.62 (d, J = 3.2 Hz, 1H), 7.55 (d, J = 7.6 Hz, 1H), 7.51 (s, 1H), 7.44 (d, J = 7.9 Hz, 1H), 7.34 (t, J = 7.7 Hz, 1H), 6.97 (t, J = 7.9 Hz, 1H), 6.74 (s, 1H), 6.61 (t, J = 8.8 Hz, 2H), 5.42 (s, 2H), 4.79 (s, 1H), 3.27 - 3.22 (m, 1H), 2.91 (dd, J = 13.7, 9.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 0.94 mm. m/z = 384.9 for [M+H] ⁺

[000233] Step 6: tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[000234] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl]benzene sulfonamide (0.184 g, 0.330 mmol, 1.0 eq.) in DMF (2 mL) were added N-Boc- beta-alanine (0.075 g, 0.396 mmol, 1.2 eq.), DIPEA (0.17 mL, 0.991 mmol, 3.0 eq.) and HATU (0.182 g, 0.495 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 21 h. The reaction mixture was concentrated to dryness to afford product as an orange oil (0.191 g, 0.337 mmol, 100% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 556.2 for [M+H] ⁺

[000235] Step 7: tert-butyl N-[3-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-thiazol-2- yl- ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[000236] To a magnetically stirred solution of tert- butyl N- [3- [3- [[2-(3 -cyanophenyl)- 1- thiazol-2-yl-ethyl]sulfamoyl]anilino]-3-oxo-propyl]carbamate (0.191 g, 0.344 mmol, 1.0 eq.) in EtOH (2.0 mL) were added hydroxylamine hydrochloride (0.048 g, 0.687 mmol, 2.0 eq.) and DIPEA (0.18 mL, 1.03 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown oil (0.503 g, 0.787 mmol, 100% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.94 min. m/z = 589.1 for [M+H] ⁺

[000237] Step 8: [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-thiazol -2-yl- ethyl]phenyl]methylene]amino] acetate

[000238] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-thiazol-2-yl-ethyl]sulfamoyl] anilino]-3-oxo-propyl]carbamate (0.203 g, 0.345 mmol, 1.0 eq) in acetic acid (3.0 mb) was added acetic anhydride (0.098 mL, 1.03 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness and the residue was purified by Normal Phase column chromatography eluting with a 0-10% MeOH, DCM eluent to afford product as an orange oil (0.099 g, 0.141 mmol, 41% yield).

[000239] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 7.90 (s, 1H), 7.66 (d, J = 3.3 Hz, 1H), 7.61 - 7.55 (m, 2H), 7.49 (s, 1H), 7.44 (d, J = 7.5, 2.0 Hz, 1H), 7.23 (t, J = 8.1 Hz, 1H), 7.15 (d, J = 3.9 Hz, 1H), 7.13 - 7.09 (m, 2H), 6.90 - 6.84 (m, 1H), 6.69 (s, 2H), 4.83 (s, 1H), 4.14 - 4.05 (m, 1H), 3.25 - 3.16 (m, 5H), 2.92 (dd, J = 13.7, 9.1 Hz, 1H), 1.38 (s, 9H). UPLC-MS (basic 2 mm): Rt = 0.98 min; m/z = 631.3 for [M] ⁺

[000240] Step 9: tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[000241] To a magnetically stirred solution of [[amino- [3 -[2- [[3 -[3 -(tert- butoxycarbonylamino) propanoylamino]phenyl]sulfonylamino]-2-thiazol-2-yl- ethyl]phenyl]methylene]amino] acetate (0.099 g, 0.141 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.092 g, 1.41 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 18h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.017 g, 0.030 mmol, 21% yield). UPLC-MS (basic 2 min): Rt = 0.92 min; m/z = 573.1 for [M+H] ⁺

[000242] Step 10: 3-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-thiazol-2-yl- ethyl]sulfamoyl]phenyl]propanamide; dihydrochloride

[000243] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-(3- carbamimidoylphenyl)-l-thiazol-2-yl-ethyl]sulfamoyl]anilino] -3-oxo-propyl]carbamate (0.017 g, 0.030 mmol, 1.00 eq.) in DCM (2 mL) was added 4N HC1 in 1,4-Dioxane solution (2.0 mL, 8.00 mmol, 265 eq.) and the reaction mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness and the residue dried in the vacuum oven for 18 h to afford product as a white solid. (0.016 g, 0.029 mmol, 95% yield)

[000244] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 10.44 (s, 1H), 9.24 (s, 2H), 9.06 (s, 2H), 8.80 (d, J = 8.3 Hz, 1H), 7.93 (s, 3H), 7.71 (d, J = 3.2 Hz, 1H), 7.66 (s, 1H), 7.62 (d, J = 3.3 Hz, 1H), 7.57 (d, J = 8.0 Hz, 2H), 7.42 (d, J = 7.6 Hz, 1H), 7.25 (dt, J = 16.2, 7.8 Hz, 2H), 7.13 (d, J = 7.8 Hz, 1H), 4.95 - 4.87 (m, 1H), 3.34 - 3.28 (m, 3H), 3.16 - 3.07 (m, 3H), 3.00 - 2.93 (m, 1H), 2.79 (t, J = 6.9 Hz, 2H). UPLC-MS (basic 6 min): Rt = 1.37 min; m/z = 473.0 for [M+H] ⁺ , 97% purity

Example 5: Exemplary synthesis of Compound 203

[000245] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e)

[000246] To a magnetically stirred solution of 2-{[(tert-butoxy)carbonyl]amino}-3-(3- cyanophenyl)propanoic acid (2.00 g, 6.89 mmol, 1.0 eq.) in toluene (40.0 mL) were added DIPEA (1.8 mL, 10.3 mmol, 1.5 eq.) and 2-aminothiophenol (0.79 mL, 7.58 mmol, 1.1 eq.). The mixture was cooled in an ice/water bath and placed under a nitrogen atmosphere before adding T3P (50% w/w in EtOAc) (1.8 mL, 10.3 mmol, 1.2 eq.) dropwise over 10 minutes. The reaction mixture was allowed to warm to RT for 20 mins and then stirred under reflux for 0.5 h. The reaction mixture was cooled to RT and then diluted with EtOAc (50 mL). The mixture was washed with aq. saturated Na ₂ CO ₃ solution and the organic layer dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, isohexane to afford product as a pale yellow solid (1.77 g, 4.66 mmol, 68% yield).

[000247] ¹ H NMR (DMSO-d6) 5: 8.10 (d, J = 7.7 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.92 (d, J = 8.9 Hz, 1H), 7.82 (s, 1H), 7.72 (d, J = 7.9 Hz, 2H), 7.53 (td, J = 8.1, 3.6 Hz, 2H), 7.45 (t, J = 7.6 Hz, 1H), 5.24 - 5.05 (m, 1H), 3.56 (dd, J = 13.5, 4.8 Hz, 1H), 3.22 - 3.06 (m, 1H), 1.31 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.22 mm. m/z = 380.0 for [M+H] ⁺

[000248] Step 2: l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethan-l-aminium trifluoroacetate

[000249] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl) ethylcarbamate (1.50 g, 3.95 mmol, 1.0 eq,) in DCM (15.0 mL) was added trifluoroacetic acid (15.0 mL, 196 mmol, 49.6 eq,) and the reaction mixture was stirred at RT for Ih. The reaction mixture was concentrated to dryness and the residue dissolved in DCM (20 mL). IM Aqueous potassium carbonate solution (20 mL) was added and the biphasic mixture was stirred vigorously for 20 mins. The phases were separated and the organic layer dried over anhydrous sodium sulfate before filtering and concentrating to dryness to afford product as a yellow oil (1.12 g, 4.01 mmol, 100% yield) which was used in the next step without further purification.

[000250] ¹ H NMR (DMSO-d6) 5: 8.89 (s, 3H), 8.17 (d, J = 7.9 Hz, IH), 8.08 (d, J = 8.1 Hz, IH), 7.82 (s, IH), 7.76 (d, J = 7.6 Hz, IH), 7.59 (d, J = 7.3 Hz, 2H), 7.52 (t, J = 7.7 Hz, 2H), 5.36 (s, IH), 3.41 (qd, J = 13.9, 7.3 Hz, 2H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 279.9 for [M-H] ⁺

[000251] Step 3 : N- [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 -cyanophenyl)ethyl] propane-1-sulfonamide

[000252] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile (0.200 g, 0.716 mmol, 1.0 eq,) in DMF (2 mL) was added triethylamine (0.25 mL, 1.79 mmol, 2.50 eq,) and the reaction mixture was cooled to 0°C. Propane-1-sulfonyl chloride (0.097 mL, 0.859 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 20 h. The reaction mixture was diluted with brine (10 mL) and then extracted with EtOAc (2 x 10 mL). The combined organic layer was washed with aq. sat. NaHCO3 solution (10 mL) and brine (10 mL) and then dried over anhydrous sodium sulfate. The mixture was concentrated to dryness and the residue purified by Normal Phase Column Chromatography with a 5-80% EtOAc, heptane eluent to afford product as cream solid (0.150 g, 0.384 mmol, 54% yield).

[000253] ¹ H NMR (DMSO-d6) 5: 8.42 - 8.35 (m, 1H), 8.13 (d, J = 7.9 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.93 (d, J = 2.1 Hz, 1H), 7.76 (dd, J = 14.4, 7.7 Hz, 2H), 7.58 - 7.50 (m, 2H), 7.45 (td, J = 7.5, 1.2 Hz, 1H), 5.11 (s, 1H), 3.50 (dd, J = 13.7, 4.7 Hz, 1H), 3.11 (dd, J = 13.8, 10.6 Hz, 1H), 2.59 - 2.52 (m, 1H), 2.42 (ddd, J = 14.4, 10.4, 5.3 Hz, 1H), 1.44 - 1.29 (m, 1H), 1.22 (d, J = 8.9 Hz, 1H), 0.68 (t, J = 7.4 Hz, 3H). UPLC-MS (basic 2 mm) Rt = 1.11 mm. m/z = 386.0 for [M+H] ⁺

[000254] Step 4: 3-[2-(l,3-benzothiazol-2-yl)-2-(propylsulfonylamino)ethyl]-N '-hydroxy- benzamidine

[000255] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]propane-1-sulfonamide (0.110 g, 0.296 mmol, 1.00 eq.) in EtOH (2.0 mL) were added hydroxylamine hydrochloride (0.041 g, 0.591 mmol, 2.0 eq.) and DIPEA (0.15 mL, 0.887 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown oil (0.124 g, 0.296 mmol, 100% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.97 min. m/z = 419.0 for [M+H] ⁺

[000256] Step 5: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- (propylsulfonylamino)ethyl]phenyl]methylene]amino] acetate

[000257] To a magnetically stirred solution of 3-[2-(l,3-benzothiazol-2-yl)-2- (propylsulfonylamino)ethyl]-N'-hydroxy-benzamidine (0.210 g, 0.490 mmol, 1.0 eq) in acetic acid (2.0 mL) was added acetic anhydride (0.14 mL, 1.47 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 18 h. The reaction mixture was concentrated to dryness and the residue was purified by Normal Phase column chromatography eluting with a 75-100% EtOAc, isohexane eluent to afford product as a colourless oil (0.100 g, 0.217 mmol, 44% yield).

[000258] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 8.38 (s, 1H), 8.15 - 8.08 (m, 1H), 7.98 (dt, J = 8.0, 1.0 Hz, 1H), 7.83 (s, 1H), 7.61 (dd, J = 7.8, 1.6 Hz, 1H), 7.56 - 7.34 (m, 4H), 6.80 (s, 2H), 5.06 (s, 1H), 3.48 (dd, J = 13.8, 4.5 Hz, 1H), 3.06 (dd, J = 13.8, 10.7 Hz, 1H), 2.46 - 2.26 (m, 2H), 2.13 (s, 3H), 1.40 - 1.10 (m, 1H), 0.61 (t, J = 7.4 Hz, 3H). UPLC-MS (basic 2 mm): Rt = 1.01 min; m/z = 461.0 for [M+H] ⁺

[000259] Step 6: 3-[2-(l,3-benzothiazol-2-yl)-2-(propylsulfonylamino)ethyl]be nzamidine

[000260] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- (propylsulfonylamino)ethyl] phenyl]methylene]amino] acetate (0.100 g, 0.217 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.140 g, 2.17 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 18h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.034 g, 0.080 mmol, 37% yield).

[000261] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 8.15 - 8.08 (m, 1H), 7.98 (d, J = 8.1 Hz, 1H),

7.87 (s, 1H), 7.66 (d, J = 7.8 Hz, 1H), 7.56 - 7.40 (m, 3H), 7.34 (t, J = 7.6 Hz, 1H), 5.05 (dd, J = 10.6, 4.6 Hz, 1H), 3.46 (dd, J = 13.8, 4.6 Hz, 1H), 3.04 (dd, J = 13.7, 10.6 Hz, 1H), 2.44 - 2.24 (m, 2H), 1.32 - 1.12 (m, 1H), 0.61 (t, J = 7.4 Hz, 3H). UPLC-MS (basic 6 mm): Rt = 2.33 mm; m/z = 403.0 for [M] ⁺ , 95% purity

Example 6: Exemplary synthesis of Compound 204

[000262] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e)

[000263] To a magnetically stirred solution of 2-{[(tert-butoxy)carbonyl]amino}-3-(3- cyanophenyl)propanoic acid (2.00 g, 6.89 mmol, 1.0 eq.) in toluene (40.0 mL) were added DIPEA (1.8 mL, 10.3 mmol, 1.5 eq.) and 2-aminothiophenol (0.79 mL, 7.58 mmol, 1.1 eq.). The mixture was cooled in an ice/water bath and placed under a nitrogen atmosphere before adding T3P (50% w/w in EtOAc) (1.8 mL, 10.3 mmol, 1.2 eq.) dropwise over 10 minutes. The reaction mixture was allowed to warm to RT for 20 mins and then stirred under reflux for 0.5 h. The reaction mixture was cooled to RT and then diluted with EtOAc (50 mL). The mixture was washed with aq. saturated Na ₂ CO ₃ solution and the organic layer dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, isohexane to afford product as a pale yellow solid (1.77 g, 4.66 mmol, 68% yield).

[000264] ¹ H NMR (DMSO-d6) 5: 8.10 (d, J = 7.7 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.92 (d, J = 8.9 Hz, 1H), 7.82 (s, 1H), 7.72 (d, J = 7.9 Hz, 2H), 7.53 (td, J = 8.1, 3.6 Hz, 2H), 7.45 (t, J = 7.6 Hz, 1H), 5.24 - 5.05 (m, 1H), 3.56 (dd, J = 13.5, 4.8 Hz, 1H), 3.22 - 3.06 (m, 1H), 1.31 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 380.0 for [M+H] ⁺

[000265] Step 2: l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethan-l-aminium trifluoroacetate

[000266] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl) ethylcarbamate (1.50 g, 3.95 mmol, 1.0 eq,) in DCM (15.0 mL) was added trifluoroacetic acid (15.0 mL, 196 mmol, 49.6 eq,) and the reaction mixture was stirred at RT for Ih. The reaction mixture was concentrated to dryness and the residue dissolved in DCM (20 mL). IM Aqueous potassium carbonate solution (20 mL) was added and the biphasic mixture was stirred vigorously for 20 mins. The phases were separated and the organic layer dried over anhydrous sodium sulfate before filtering and concentrating to dryness to afford product as a yellow oil (1.12 g, 4.01 mmol, 100% yield) which was used in the next step without further purification.

[000267] ¹ H NMR (DMSO-d6) 5: 8.89 (s, 3H), 8.17 (d, J = 7.9 Hz, IH), 8.08 (d, J = 8.1 Hz, IH), 7.82 (s, IH), 7.76 (d, J = 7.6 Hz, IH), 7.59 (d, J = 7.3 Hz, 2H), 7.52 (t, J = 7.7 Hz, 2H), 5.36 (s, IH), 3.41 (qd, J = 13.9, 7.3 Hz, 2H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 279.9 for [M-H] ⁺

[000268] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl] cyclopropanesulfonamide

[000269] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile (0.200 g, 0.716 mmol, 1.0 eq.) in DMF (2 mL) was added triethylamine (0.25 mL, 1.79 mmol, 2.50 eq.) and the reaction mixture was cooled to 0°C. Cyclopropanesulfonyl chloride (0.080 mL, 0.788 mmol, 1.1 eq.) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 20 h. The reaction mixture was diluted with brine (10 mL) and then extracted with EtOAc (2 x 10 mL). The combined organic layer was washed with aq. sat. NaHCO3 solution (10 mL) and brine (10 mL) and then dried over anhydrous sodium sulfate. The mixture was concentrated to dryness and the residue purified by Normal Phase Column Chromatography with a 5-80% EtOAc, heptane eluent to afford product as cream solid (0.083 g, 0.216 mmol, 30% yield).

[000270] 1H NMR (400 MHz, DMSO) 5 8.44 (s, 1H), 8.12 (d, J = 7.9 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.91 (d, J = 2.0 Hz, 1H), 7.80 - 7.68 (m, 2H), 7.57 - 7.49 (m, 2H), 7.45 (t, J = 7.6 Hz, 1H), 5.09 (d, J = 10.0 Hz, 1H), 3.56 - 3.40 (m, 1H), 3.13 (dd, J = 13.8, 10.3 Hz, 1H), 1.95 (ddd, J = 13.0, 8.5, 5.1 Hz, 1H), 0.78 (dt, J = 9.6, 4.8 Hz, 1H), 0.72 - 0.55 (m, 2H), 0.50 (qd, J = 8.3, 4.3 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.08 min. m/z = 384.0 for [M+H] ⁺

[000271] Step 4: 3-[2-(l,3-benzothiazol-2-yl)-2-(cyclopropylsulfonylamino)eth yl]-N'- hydroxy-benzamidine

[000272] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] cyclopropanesulfonamide (0.110 g, 0.216 mmol, 1.00 eq.) in EtOH (2.0 mL) were added hydroxylamine hydrochloride (0.030 g, 0.433 mmol, 2.0 eq.) and DIPEA (0.11 mL, 0.649 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown oil (0.090 g, 0.216 mmol, 100% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.94 min. m/z = 417.0 for [M+H] ⁺

[000273] Step 5: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-(cyclopropylsulfonyl amino) ethyl]phenyl]methylene]amino] acetate

[000274] To a magnetically stirred solution of 3-[2-(l,3-benzothiazol-2-yl)-2- (cyclopropylsulfonylamino)ethyl]-N'-hydroxy-benzamidine (0.150 g, 0.363 mmol, 1.0 eq) in acetic acid (2.0 mL) was added acetic anhydride (0.10 mL, 1.09 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 18 h. The reaction mixture was concentrated to dryness and the residue was purified by Normal Phase column chromatography eluting with a 80-100% EtOAc, isohexane eluent to afford product as a colourless oil (0.067 g, 0.146 mmol, 40% yield).

[000275] ¹ H NMR (400 MHz, DMSO-d ₆ ): 5 8.43 (s, 1H), 8.11 (dt, J = 7.8, 1.2 Hz, 1H), 8.02 - 7.95 (m, 1H), 7.81 (t, J = 1.7 Hz, 1H), 7.60 - 7.47 (m, 3H), 7.43 (ddd, J = 8.4, 7.2, 1.2 Hz, 1H), 7.37 (t, J = 7.7 Hz, 1H), 6.79 (s, 2H), 5.05 (s, 1H), 3.49 (dd, J = 13.8, 4.5 Hz, 1H), 3.09 (dd, J = 13.8, 10.4 Hz, 1H), 2.13 (s, 3H), 1.82 (td, J = 8.1, 4.1 Hz, 1H), 0.72 (dt, J = 10.0, 5.1 Hz, 1H),

0.60 (dq, J = 9.8, 4.7 Hz, 1H), 0.56 - 0.48 (m, 1H), 0.48 - 0.41 (m, 1H). UPLC-MS (basic 2 min): Rt = 0.98 min; m/z = 461.0 for [M+H] ⁺

[000276] Step 6: 3-[2-(l,3-benzothiazol-2-yl)-2- (cyclopropylsulfonylamino)ethyl]benzamidine

[000277] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- (cyclopropylsulfonylamino) ethyl]phenyl]methylene]amino] acetate (0.067 g, 0.146 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.096 g, 1.46 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 18h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.017 g, 0.039 mmol, 27% yield).

[000278] ¹ H NMR (400 MHz, DMSO-d6): 5 8.14 - 8.07 (m, 1H), 7.98 (dt, J = 8.0, 1.0 Hz, 1H), 7.85 (s, 1H), 7.60 (d, J = 7.7 Hz, 1H), 7.56 - 7.39 (m, 3H), 7.33 (t, J = 7.7 Hz, 1H), 5.03 (dd, J = 10.2, 4.6 Hz, 1H), 3.47 (dd, J = 13.7, 4.6 Hz, 1H), 3.08 (dd, J = 13.7, 10.1 Hz, 1H), 1.78 (td, J = 8.0, 4.0 Hz, 1H), 0.78 - 0.67 (m, 1H), 0.65 - 0.56 (m, 1H), 0.51 (ddt, J = 11.4, 8.0, 4.3 Hz, 1H), 0.46 - 0.36 (m, 1H). UPLC-MS (basic 6 mm): Rt = 2.33 mm; m/z = 401.2 for [M+H] ⁺ , 95% purity

Example 7: Exemplary synthesis of Compound 205

[000279] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000280] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.880 g, 1.96 mmol, 1.0 eq.) in DCM (20.0 mb) was added tribromoborane (8.0 mL, 800 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness. The residue by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.301 g, 0.691 mmol, 35% yield).

[000281] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 434.0 for [M-H] ⁺

[000282] Step 2: N-[2-(3-cyanophenyl)-l-[6-(2-methoxyethoxy)-l,3-benzothiazol -2- yl]ethyl]benzenesulfonamide

[000283] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.250 g, 0.574 mmol, 1.0 eq.) in DMF (6 ml) was added sodium hydride 60% in mineral oil (0.035 g, 0.875 mmol, 2.0 eq.) and the reaction mixture was stirred at RT for 15 min. 2-Bromoethyl methyl ether (0.089 g, 0.639 mmol, 3.0 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with MeOH and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.150 g, 0.304 mmol, 53% yield).

[000284] ¹ H NMR 141556-2 (400 MHz, DMSO) 5 8.89 (s, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.61 (d, J = 2.6 Hz, 1H), 7.55 (s, 1H), 7.50 (d, J = 7.8 Hz, 1H), 7.46 (t, J = 7.8 Hz, 3H), 7.38 (t, J = 7.5 Hz, 1H), 7.27 (q, J = 7.3 Hz, 3H), 7.07 (dd, J = 8.8, 2.5 Hz, 1H), 4.87 (s, 1H), 4.18 - 4.12 (m, 2H), 3.72 - 3.65 (m, 2H), 2.99 (dd, J = 13.7, 9.7 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 min. m/z = 494.0 for [M+H] ⁺

[000285] Step 3: 3-[2-(benzenesulfonamido)-2-[6-(2-methoxyethoxy)-l,3-benzoth iazol-2- yl] ethyl] -N'-hydroxy-benzami dine

[000286] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-[6-(2-methoxyethoxy)- l,3-benzothiazol-2-yl]ethyl]benzenesulfonamide (0.193 g, 0.391 mmol, 1.0 eq.) in EtOH (5 mL) were added hydroxylamine hydrochloride (0.068 g, 0.979 mmol, 2.5 eq.) and DIPEA (0.220 mL, 1.30 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a yellow oil (0.220 g, 0.418 mmol, 107% yield) which was used in the next step without further purification. UPLC- MS (acidic 2 min) Rt = 0.93 min. m/z = 527.0 for [M+H] ⁺

[000287] Step 4: [[amino-[3-[2-(benzenesulfonamido)-2-[6-(2-methoxyethoxy)-l, 3- benzothiazol-2-yl]ethyl]phenyl]methylene]amino] acetate

[000288] To a magnetically stirred solution of 3-[2-(benzenesulfonamido)-2-[6-(2- methoxyethoxy)-l,3-benzothiazol-2-yl]ethyl]-N'-hydroxy-benza midine (0.220 g, 0.418 mmol, 1.0 eq) in acetic acid (5.0 mb) was added acetic anhydride (0.120 mL, 1.30 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5- 95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.150 g, 0.264 mmol, 63% yield).

[000289] ¹ H NMR 142144-2 (400 MHz, DMSO) 5 8.86 (d, J = 6.7 Hz, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.61 (d, J = 2.5 Hz, 1H), 7.58 (s, 1H), 7.50 - 7.41 (m, 3H), 7.41 - 7.34 (m, 1H), 7.25 (t, J = 7.6 Hz, 2H), 7.20 (d, J = 7.7 Hz, 1H), 7.12 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.5 Hz, 1H), 6.72 (s, 2H), 4.92 (q, J = 5.3 Hz, 1H), 4.18 - 4.11 (m, 2H), 3.72 - 3.65 (m, 2H), 3.32 (s, 3H), 3.31 - 3.26 (m, 1H), 2.99 (dd, J = 13.9, 9.4 Hz, 1H), 2.15 (s, 3H). UPLC-MS (acidic 2 mm): Rt = 1.03 min; m/z = 569.0 for [M+H] ⁺

[000290] Step 5: 3-[2-(benzenesulfonamido)-2-[6-(2-methoxyethoxy)-l,3-benzoth iazol-2- yl]ethyl]benzamidine

[000291] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-[6-(2- methoxyethoxy)-l,3-benzothiazol-2-yl]ethyl]phenyl]methylene] amino] acetate (0.150 g, 0.264 mmol, 1.0 eq) in acetic acid (4.0 mL) was added zinc (0.759 g, 11.6 mmol, 44.0 eq.). The reaction mixture was stirred at room temperature for 48 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid (0.017 g, 0.034 mmol, 13% yield).

[000292] ¹ H NMR + D2O 142183-2 (400 MHz, DMSO) 5 7.70 (d, J = 8.9 Hz, 1H), 7.55 (s, 1H), 7.52 - 7.37 (m, 4H), 7.30 - 7.21 (m, 2H), 7.17 (td, J = 7.7, 1.7 Hz, 3H), 7.02 (dd, J = 8.9, 2.6 Hz, 1H), 4.71 (dd, J = 8.7, 4.9 Hz, 1H), 4.12 - 4.06 (m, 2H), 3.68 - 3.62 (m, 2H), 3.28 (s, 3H), 3.15 (dd, J = 13.6, 4.8 Hz, 1H), 2.96 (dd, J = 13.5, 8.8 Hz, 1H). UPLC-MS (basic 6 mm): Rt = 2.41 min; m/z = 511.0 for [M-H] ⁺ , 94% purity

Example 8: Exemplary synthesis of Compound 206

[000293] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000294] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.880 g, 1.96 mmol, 1.0 eq.) in DCM (20.0 mb) was added tribromoborane (8.0 mL, 800 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness. The residue by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.301 g, 0.691 mmol, 35% yield).

[000295] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32

(m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 434.0 for [M-H] ⁺

[000296] Step 2: tert-butyl N-[2-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl] oxy] ethyl] carbamate

[000297] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.215 g, 0.494 mmol, 1.0 eq.) in DMF (5 ml) was added sodium hydride 60% in mineral oil (0.075 g, 1.93 mmol, 3.8 eq.) and the reaction mixture was stirred at RT for 15 min. 2-(Boc-amino)ethyl bromide (0.255 g, 1.14 mmol, 2.3 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with MeOH and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.115 g, 0.199 mmol, 40% yield).

[000298] ¹ H NMR 141974-2 (400 MHz, DMSO) 5 7.80 - 7.64 (m, 1H), 7.55 (s, 1H), 7.52 - 7.37 (m, 4H), 7.36 - 7.17 (m, 4H), 7.02 (s, 2H), 4.72 (s, 1H), 4.01 (t, J = 5.9 Hz, 2H), 3.00 (dd, J = 13.3, 8.2 Hz, 1H), 1.39 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.19 mm. m/z = 579.0 for [M+H] ⁺

[000299] Step 3: tert-butyl N-[2-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]ethyl]carbamate

[000300] To a magnetically stirred solution of tert-butyl N-[2-[[2-[l-(benzenesulfonamido)-2- (3-cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]ethyl]carbam ate (0.252 g, 0.436 mmol, 1.0 eq.) in EtOH (6 mL) were added hydroxylamine hydrochloride (0.075 g, 1.08 mmol, 2.0 eq.) and DIPEA (0.250 mL, 1.44 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a yellow oil (0.280 g, 0.458 mmol, 105% yield) which was used in the next step without further purification. UPLC-MS (acidic 2 min) Rt = 1.05 min. m/z = 612.1 for [M+H] ⁺

[000301] Step 4: [[amino-[3-[2-(benzenesulfonamido)-2-[6-[2-(tert- butoxycarbonylamino)ethoxy]- 1 ,3-benzothiazol-2-yl]ethyl]phenyl]methylene]amino] acetate

[000302] To a magnetically stirred solution of tert-butyl N-[2-[[2-[l-(benzenesulfonamido)-2- [3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6 -yl]oxy]ethyl]carbamate (0.280 g, 0.458 mmol, 1.0 eq) in acetic acid (6.0 mL) was added acetic anhydride (0.130 mL, 1.40 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.130 g, 0.199 mmol, 43% yield).

[000303] ¹ H NMR 142143-2 (400 MHz, DMSO) 5 8.85 (s, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.63 - 7.55 (m, 2H), 7.46 (dt, J = 8.4, 1.6 Hz, 3H), 7.41 - 7.33 (m, 1H), 7.25 (t, J = 7.7 Hz, 2H), 7.20 (d, J = 7.6 Hz, 1H), 7.12 (t, J = 7.7 Hz, 1H), 7.05 (td, J = 9.3, 4.0 Hz, 2H), 6.72 (s, 2H), 4.90 (d, J = 8.2 Hz, 1H), 4.01 (t, J = 5.8 Hz, 2H), 2.99 (dd, J = 13.9, 9.4 Hz, 1H), 1.39 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.11 min; m/z = 654.1 for [M+H] ⁺

[000304] Step 5: tert-butyl N-[2-[[2-[l-(benzenesulfonamido)-2-(3- carbamimidoylphenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]ethyl]c arbamate

[000305] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-[6-[2- (tert-butoxycarbonylamino)ethoxy]-l,3-benzothiazol-2-yl]ethy l]phenyl]methylene]amino] acetate (0.130 g, 0.199 mmol, 1.0 eq) in acetic acid (4.0 mL) was added zinc (0.705 g, 10.8 mmol, 54.0 eq.). The reaction mixture was stirred at room temperature for 48 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5- 95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid (0.029 g, 0.048 mmol, 25% yield).

[000306] ¹ H NMR 142181-3 (400 MHz, DMSO) 5 7.73 (d, J = 8.9 Hz, 1H), 7.62 (s, 1H), 7.55 (d, J = 2.5 Hz, 1H), 7.51 - 7.42 (m, 3H), 7.30 (t, J = 7.4 Hz, 1H), 7.21 (t, J = 7.3 Hz, 3H), 7.14 (t,

J = 7.6 Hz, 1H), 7.02 (dd, J = 8.7, 2.9 Hz, 2H), 4.80 (t, J = 7.1 Hz, 1H), 4.00 (t, J = 5.8 Hz, 2H), 2.99 (dd, J = 13.5, 8.7 Hz, 1H), 1.39 (s, 9H). UPLC-MS (basic 6 min): Rt = 3.02 min; m/z = 596.0 for [M-H] ⁺ , 90% purity

[000307] Step 6: 3-[2-[6-(2-aminoethoxy)-l,3-benzothiazol-2-yl]-2- (benzenesulfonamido)ethyl]benzamidine; dihydrochloride

[000308] To a magnetically stirred solution of tert-butyl N-[2-[[2-[l-(benzenesulfonamido)-2- (3-carbamimidoylphenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]ethy l]carbamate (0.029 g, 0.049 mmol, 1.0 eq) in Et ₂ O (2.0 mb) was added 4M HC1 in dioxane (1.00 mb, 4.00 mmol, 82.2 eq.). The reaction mixture was stirred at room temperature for 48h. The precipitate was collected by filtration to afford the product as an off-white solid (0.015 g, 0.026 mmol, 28% yield).

[000309] ¹ H NMR 142798-2 (400 MHz, DMSO) 5 9.24 (s, 2H), 9.06 (s, 2H), 8.92 (d, J = 8.1

Hz, 1H), 8.17 (s, 3H), 7.84 (d, J = 8.9 Hz, 1H), 7.74 - 7.68 (m, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.46 (d, J = 7.6 Hz, 3H), 7.39 (t, J = 7.5 Hz, 1H), 7.27 (dt, J = 15.0, 7.7 Hz, 3H), 7.15 (dd, J = 8.9, 2.5 Hz, 1H), 5.01 (td, J = 9.3, 4.9 Hz, 1H), 4.24 (t, J = 5.0 Hz, 2H), 3.37 (dd, J = 13.9, 4.9 Hz, 1H), 3.26 (q, J = 5.5 Hz, 2H), 3.03 (dd, J = 14.0, 10.1 Hz, 1H).UPLC-MS (basic 6 mm): Rt = 1.64 min; m/z = 496.1 for [M-H] ⁺ , 96% purity. Chiral analysis performed by Reach Separations showed 50.4% chiral purity.

Example 9: Exemplary synthesis of Compound 207

[000310] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000311] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.880 g, 1.96 mmol, 1.0 eq.) in DCM (20.0 mb) was added tribromoborane (8.0 mL, 800 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness. The residue by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.301 g, 0.691 mmol, 35% yield).

[000312] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 434.0 for [M-H] ⁺

[000313] Step 2: tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3- benzothiazol-6-yl] oxy] azetidine-1-carboxylate

[000314] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.215 g, 0.494 mmol, 1.0 eq.) in DMF (5 ml) was added sodium hydride 60% in mineral oil (0.050 g, 1.25 mmol, 2.5 eq.) and the reaction mixture was stirred at RT for 15 min. l-Boc-3-iodoazetidine (0.215 g, 0.759 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with MeOH and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.161 g, 0.273 mmol, 55% yield).

[000315] ¹ H NMR (400 MHz, DMSO) 5 7.78 (d, J = 8.9 Hz, 1H), 7.52 (s, 1H), 7.49 (d, J = 7.6 Hz, 1H), 7.44 (td, J = 7.5, 1.9 Hz, 4H), 7.32 (d, J = 7.1 Hz, 1H), 7.25 (dt, J = 10.2, 7.6 Hz, 3H), 7.00 (dd, J = 8.9, 2.5 Hz, 1H), 5.03 (tt, J = 6.6, 4.0 Hz, 1H), 4.84 - 4.59 (m, 1H), 4.34 (t, J = 8.3 Hz, 2H), 4.09 - 3.78 (m, 2H), 3.23 (d, J = 14.8 Hz, 1H), 2.99 (dd, J = 13.5, 8.8 Hz, 1H), 1.39 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.24 mm. m/z = 591.1 for [M+H] ⁺

[000316] Step 3: tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]azetidine-1-carboxylate

[000317] To a magnetically stirred solution of tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]azetidine-l-car boxylate (0.161 g, 0.273 mmol, 1.0 eq.) in EtOH (4 mL) were added hydroxylamine hydrochloride (0.047 g, 0.676 mmol, 2.5 eq.) and DIPEA (0.150 mL, 0.861 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a yellow oil (0.180 g, 0.289 mmol, 106% yield) which was used in the next step without further purification.UPLC-MS (acidic 2 min) Rt = 1.09 min. m/z = 624.1 for [M+H] ⁺

[000318] Step 4: tert-butyl 3-[[2-[2-[3-(N'-acetoxycarbamimidoyl)phenyl]-l- (benzenesulfonamido)ethyl]-l,3-benzothiazol-6-yl]oxy]azetidi ne-1-carboxy late

[000319] To a magnetically stirred solution of tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-[3- (N'-hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl ]oxy]azetidine-1-carboxylate (0.180 g, 0.289 mmol, 1.0 eq) in acetic acid (4.0 mb) was added acetic anhydride (0.080 mL, 0.846 mmol, 2.9 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.072 g, 0.108 mmol, 38% yield).

[000320] ¹ H NMR 142373-2 (400 MHz, DMSO) 5 8.91 - 8.84 (m, 1H), 7.87 - 7.67 (m, 2H), 7.59 (d, J = 12.8 Hz, 1H), 7.48 - 7.41 (m, 4H), 7.36 (q, J = 7.0 Hz, 1H), 7.23 (dt, J = 14.5, 8.7 Hz, 4H), 7.13 (q, J = 8.3 Hz, 1H), 7.03 (dd, J = 8.9, 2.5 Hz, 1H), 6.72 (s, 1H), 5.03 (s, 1H), 4.91 (q, J = 7.8 Hz, 1H), 4.33 (d, J = 8.4 Hz, 2H), 3.82 (dd, J = 10.2, 3.8 Hz, 2H), 3.26 (d, J = 5.8 Hz, 1H), 3.05 - 2.94 (m, 1H), 2.23 - 1.97 (m, 3H), 1.40 (s, 9H). UPLC-MS (basic2 mm): Rt = 1.17 min; m/z = 666.2 for [M+H] ⁺

[000321] Step 5: tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-(3-carbamimidoylphenyl)ethyl ]- l,3-benzothiazol-6-yl]oxy]azetidine-1-carboxylate

[000322] To a magnetically stirred solution of tert-butyl 3-[[2-[2-[3-(N'- acetoxycarbamimidoyl)phenyl]-l-(benzenesulfonamido)ethyl]-l, 3-benzothiazol-6- yl] oxy] azetidine-1-carboxylate (0.072 g, 0.108 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.350 g, 5.35 mmol, 49.5 eq.). The reaction mixture was stirred at room temperature for 48 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid.

(0.013g, 0.021 mmol, 20% yield).

[000323] ¹ H NMR 142800-2 (400 MHz, DMSO) 5 7.76 (d, J = 8.9 Hz, 1H), 7.63 (s, 1H), 7.50 (s, 1H), 7.45 (d, J = 7.8 Hz, 2H), 7.41 (s, 1H), 7.30 (t, J = 7.4 Hz, 1H), 7.22 (d, J = 7.5 Hz, 3H), 7.15 (t, J = 7.6 Hz, 1H), 7.00 (d, J = 8.4 Hz, 1H), 5.02 (s, 1H), 4.82 (s, 1H), 4.34 (s, 2H), 3.81 (d,

J = 9.6 Hz, 2H), 2.99 (dd, J = 13.5, 8.7 Hz, 1H), 1.39 (s, 9H). UPLC-MS (basic 6 min): Rt = 3.37 min; m/z = 608.1 for [M-H] ⁺ , 99% purity

[000324] Step 6: 3-[2-[6-(azetidin-3-yloxy)-l,3-benzothiazol-2-yl]-2- (benzenesulfonamido)ethyl]benzamidine; dihydrochloride

[000325] To a magnetically stirred solution of tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-(3- carbamimidoylphenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]azetidi ne-l-carboxylate (0.013 g, 0.021 mmol, 1.0 eq) in Et ₂ O (2.0 mb) was added 4M HC1 in dioxane (0.535 mL, 2.14 mmol, 100 eq.). The reaction mixture was stirred at room temperature for 48 h. The precipitate was concentrated to dryness and dried in the vacuum oven to afford the product as an off-white solid. (0.012 g, 0.020 mmol, 12% yield).

[000326] ¹ H NMR (400 MHz, DMSO) 5 9.25 - 9.00 (m, 2H), 8.99 - 8.85 (m, 3H), 7.86 (d, J = 8.9 Hz, 1H), 7.71 (s, 1H), 7.62 - 7.53 (m, 2H), 7.47 (t, J = 8.1 Hz, 3H), 7.39 (d, J = 7.4 Hz, 1H), 7.34 - 7.21 (m, 3H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 5.13 (s, 1H), 5.03 (s, 1H), 4.49 (s, 2H), 4.04 (s, 2H), 3.41 - 3.39 (m, 1H), 3.07 - 2.99 (m, 1H), 2.63 - 2.53 (m, 2H). UPLC-MS (basic 6 mm): Rt = 1.99 min; m/z = 507.9 for [M-H] ⁺ , 97% purity

Example 10: Exemplary synthesis of Compound 208

[000327] Step 1: tert-butyl N-[(lS)-2-(4-cyanophenyl)-l-(6-methoxy-l, 3-benzothiazol-2- y 1) ethyl] carbamate

[000328] To a stirred solution of N-Boc-4-cyano-L- phenylalanine (1.01 g, 3.49 mmol, 1.0 eq.) and 2-amino-5-methoxy-benzenethiol in toluene (8.0 ml) was added DIPEA (1.8 ml, 10.5 mmol, 3.0 eq) and T3P (50% w/w in EtOAc) (4.2 mL, 6.98 mmol, 2.0 eq.). The reaction mixture was heated to reflux for 4 h. The reaction mixture was cooled to RT and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford product as a brown solid (0.474 g, 1.16 mmol, 33% yield).

[000329] 1H NMR (400 MHz, DMSO) 5 7.87 (t, J = 9.0 Hz, 2H), 7.79 (d, J = 7.8 Hz, 2H), 7.66 (s, 1H), 7.55 (d, J = 7.8 Hz, 2H), 7.10 (dd, J = 8.8, 2.5 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.84 (s, 3H), 3.54 (dd, J = 13.9, 4.6 Hz, 1H), 3.22 - 3.11 (m, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 min) Rt = 1.21 min. m/z = 410.0 for [M+H] ⁺

[000330] Step 2: 4-[(2S)-2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]ben zonitrile

[000331] To a stirred solution of tert-butyl N-[(l S)-2-(4-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl] carbamate (474 mg, 1.16 mmol, 1.00 eq) in DCM (5.0 ml) was added trifluoroacetic acid (5.0 ml) and the reaction mixture was left to stir for 3 h. The reaction mixture was concentrated to dryness, dissolved in DCM (20 ml) and stirred in aq. Na ₂ CO ₃ (20 ml) for 18 h. The phases were separated, the aqueous phase was extracted with DCM (2 x 20 ml), the organics combined, dried over Na ₂ SO ₄ and concentrated to dryness to obtain the product as a brown solid (308 mg, 0.996 mmol, 86% yield).

[000332] 1H NMR (400 MHz, DMSO) 5 7.80 (d, J = 8.9 Hz, 1H), 7.74 (d, J = 7.9 Hz, 2H), 7.62 (d, J = 2.6 Hz, 1H), 7.46 (d, J = 7.9 Hz, 2H), 7.06 (dd, J = 8.9, 2.5 Hz, 1H), 4.44 (dd, J = 8.5, 5.0 Hz, 1H), 3.83 (s, 3H), 3.39 (dd, J = 13.4, 5.0 Hz, 1H), 3.05 (dd, J = 13.4, 8.4 Hz, 1H), 2.40 (s, 2H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 309.9 for [M+H] ⁺

[000333] Step 3: N-[(lS)-2-(4-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide

[000334] To a magnetically stirred solution of 4-[(2S)-2-amino-2-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzonitrile (0.308 g, 0.996 mmol, 1.0 eq.) in DMF (6.0 mL) was added triethylamine (0.210 mL, 1.50 mmol, 1.50 eq.) and the resulting solution was cooled to -5 °C. Benzenesulphonyl chloride (150 mg, 1.19 mmol, 1.20 eq.) was added and the reaction mixture was allowed to warm to RT and stirred for 18 h. The reaction mixture was diluted with EtO Ac (10 ml) and brine (10 ml), the phases separated and the aqueous extracted with further EtO Ac (2 x 10 ml). The combined organics were dried over Na ₂ SO ₄ and concentrated in vacuo. The crude material was purified by Normal Phase column chromatography eluting with a 0-100 % Hex:EtOAc eluent to afford product as a brown solid (0.368 g, 0.819 mmol, 82% yield).

[000335] H NMR (400 MHz, DMSO) 5 8.94 (s, 1H), 7.81 (d, J = 8.9 Hz, 1H), 7.76 - 7.70 (m, 1H), 7.65 (d, J = 2.5 Hz, 1H), 7.60 (d, J = 11.1 Hz, 1H), 7.50 (d, J = 7.9 Hz, 2H), 7.47 - 7.42 (m, 3H), 7.36 - 7.27 (m, 3H), 7.09 (dd, J = 9.1, 2.6 Hz, 1H), 4.95 (s, 1H), 3.83 (s, 3H), 3.40 (dd, J = 13.7, 5.1 Hz, 1H), 3.03 (dd, J = 13.9, 9.9 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.14 mm. m/z = 450.0 for [M-H] ⁺

[000336] Step 4: 4-[(2S)-2-(benzenesulfonamido)-2-(6-methoxy-l,3-benzothiazol -2-yl)ethyl]- N'-hydroxy-benzamidine

[000337] To a magnetically stirred solution of N-[(lS)-2-(4-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.368 g, 0.819 mmol, 1.0 eq.) in EtOH (4.0 mL) were added hydroxylamine hydrochloride (0.114 g, 1.64 mmol, 2.0 eq.) and DIPEA (0.430 mL, 2.46 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 3 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a yellow oil (0.824 g, 1.71 mmol, 209% yield) which was used in the next step without further purification. UPLC- MS (basic 2 min) Rt = 0.99 min. m/z = 483.0 for [M+H] ⁺

[000338] Step 5: [[amino-[4-[(2S)-2-(benzenesulfonamido)-2-(6-methoxy-l,3-ben zothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000339] To a magnetically stirred solution of 4-[(2S)-2-(benzenesulfonamido)-2-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]-N'-hydroxy-benzamidine (0.824 g, 1.70 mmol, 1.0 eq) in acetic acid (8.0 mL) was added acetic anhydride (0.484mL, 5.12 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness and the residue was purified by Normal Phase column chromatography eluting with a 0-100 % Hex:EtOAc eluent to afford product as a brown solid (0.162 g, 0.309 mmol, 18% yield). UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 525.0 for [M+H] ⁺

[000340] 1H NMR (400 MHz, DMSO) 5 8.94 (s, 1H), 7.88 - 7.81 (m, 1H), 7.74 (d, J = 7.9 Hz, 1H), 7.71 - 7.65 (m, 1H), 7.52 (d, J = 7.9 Hz, 3H), 7.44 (q, J = 8.9 Hz, 1H), 7.33 (t, J = 8.4 Hz, 2H), 7.30 - 7.21 (m, 2H), 7.14 (td, J = 10.1, 5.5 Hz, 1H), 5.02 - 4.90 (m, 1H), 3.88 (d, J = 2.6 Hz, 3H), 3.13 - 3.03 (m, 1H), 2.20 (s, 2H)

[000341] Step 6: 4-[(2S)-2-(benzenesulfonamido)-2-(6-methoxy-l,3-benzothiazol -2- yl)ethyl]benzamidine

[000342] To a magnetically stirred solution of [[amino-[4-[(2S)-2-(benzenesulfonamido)-2-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]phenyl]methylene]amino] acetate (0.162 g, 0.309 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.202 g, 3.10 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % formic acid) to afford the product as a white solid (0.021 g, 0.045 mmol, 15% yield).

[000343] 1H NMR (400 MHz, DMSO) 5 7.73 (d, J = 9.1 Hz, 2H), 7.61 - 7.44 (m, 5H), 7.34 - 7.11 (m, 5H), 7.08 - 6.90 (m, 1H), 4.80 - 4.68 (m, 1H), 3.81 (s, 3H), 3.22 - 3.13 (m, 1H), 3.13 - 2.98 (m, 1H), amidine protons not observed. UPLC-MS (basic 6 min): Rt = 2.57 min; m/z = 467.1 for [M+H] ⁺ , 95% purity. Chiral analysis performed by Reach Separations showed 71% chiral purity.

Example 11: Exemplary synthesis of Compound 209

[000344] Step 1: tert-butyl N-[(lR)-2-(4-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000345] To a stirred solution of N-Boc-4-cyano-D-phenylalanine (1.01 g, 3.49 mmol, 1.0 eq.) and 2-amino-5-methoxy-benzenethiol in toluene (8.0 ml) was added DIPEA (1.8 ml, 10.5 mmol, 3.0 eq) and T3P (50% w/w in EtOAc) (4.2 mL, 6.98 mmol, 2.0 eq.). The reaction mixture was heated to reflux for 4 h. The reaction mixture was cooled to RT and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford product as a brown solid (0.490 g, 1.20 mmol, 34% yield).

[000346] 1H NMR (400 MHz, DMSO) 5 7.87 (t, J = 8.9 Hz, 2H), 7.79 (d, J = 7.9 Hz, 2H), 7.66 (s, 1H), 7.55 (d, J = 7.9 Hz, 2H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.17 - 5.06 (m, 1H), 3.84 (s, 3H), 3.58 - 3.49 (m, 1H), 3.16 (dd, J = 13.6, 11.0 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.0 for [M+H] ⁺

[000347] Step 2: 4-[(2R)-2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]ben zonitrile

[000348] To a stirred solution of tert-butyl N-[(lR)-2-(4-cyanophenyl)-1-(6-methoxy-l ,3- benzothiazol-2-yl)ethyl]carbamate (490 mg, 1.20 mmol, 1.00 eq) in DCM (5.0 ml) was added trifluoroacetic acid (5.0 ml) and the reaction was left to stir for 3 h. The reaction was concentrated to dryness, dissolved in DCM (20 ml) and stirred in aq. Na2COi (20 ml) for 18 h. The phases were separated, the aqueous phase was extracted with DCM (2 x 20 ml), the organics combined, dried over Na ₂ SO ₄ and concentrated to dryness to obtain the product as a brown solid (426 mg, 1.38 mmol, 115% yield).

[000349] H NMR (400 MHz, DMSO) 5 7.80 (d, J = 8.8 Hz, 1H), 7.74 (d, J = 7.9 Hz, 2H), 7.64 - 7.58 (m, 1H), 7.46 (d, J = 7.8 Hz, 2H), 7.06 (dd, J = 9.0, 2.6 Hz, 1H), 4.51 - 4.37 (m, 1H), 3.83 (d, J = 1.9 Hz, 3H), 3.39 (dd, J = 13.4, 4.7 Hz, 1H), 3.10 - 2.99 (m, 1H), 2.39 (s, 2H). UPLC- MS (basic 2 min) Rt = 1.02 min. m/z = 309.9 for [M+H] ⁺

[000350] Step 3: N-[(lR)-2-(4-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide

[000351] To a magnetically stirred solution of 4-[(2R)-2-amino-2-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzonitrile (0.381 g, 1.23 mmol, 1.0 eq.) in DMF (8.0 mL) was added triethylamine (0.210 mL, 1.50 mmol, 1.22 eq.) and the resulting solution was cooled to -5 °C. Benzenesulphonyl chloride (218 mg, 1.23 mmol, 1.2 eq.) was added and the reaction mixture was allowed to warm to RT and stirred for 18 h. The reaction mixture was diluted with EtOAc (10 ml) and brine (10 ml), the phases separated and the aqueous extracted with further EtOAc (2 x 10 ml). The combined organics were dried over Na ₂ SO ₄ and concentrated in vacuo. The crude material was purified by Normal Phase column chromatography eluting with a 0-100 % Hex:EtOAc eluent to afford product as a brown solid (0.468 g, 1.04 mmol, 85% yield).

[000352] H NMR (400 MHz, DMSO) 5 8.94 (d, J = 8.4 Hz, 1H), 7.96 (s, 1H), 7.81 (d, J = 8.9 Hz, 1H), 7.78 - 7.70 (m, 1H), 7.65 (s, 1H), 7.50 (d, J = 7.8 Hz, 2H), 7.48 - 7.43 (m, 2H), 7.36 - 7.27 (m, 3H), 7.09 (dd, J = 8.9, 2.5 Hz, 1H), 4.96 (td, J = 9.2, 4.6 Hz, 1H), 3.83 (s, 3H), 3.40 (dd, J = 13.7, 4.8 Hz, 1H), 3.03 (dd, J = 13.8, 10.3 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.14 mm. m/z = 450.0 for [M-H] ⁺

[000353] Step 4: 4-[(2R)-2-(benzenesulfonamido)-2-(6-methoxy-l,3-benzothiazol -2-yl)ethyl]- N'-hydroxy-benzamidine

[000354] To a magnetically stirred solution of N-[(lR)-2-(4-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.468 g, 1.04 mmol, 1.0 eq.) in EtOH (5 mL) were added hydroxylamine hydrochloride (0.145 g, 2.08 mmol, 2.0 eq.) and DIPEA (0.540 mL, 3.12 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 3 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a yellow oil (0.636 g, 1.30 mmol, 127% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.99 min. m/z = 482.9 for [M+H] ⁺

[000355] Step 5: [[amino-[4-[(2R)-2-(benzenesulfonamido)-2-(6-methoxy-l,3-ben zothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000356] To a magnetically stirred solution of 4-[(2R)-2-(benzenesulfonamido)-2-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]-N'-hydroxy-benzamidine (0.636 g, 1.32 mmol, 1.0 eq) in acetic acid (7.0 mL) was added acetic anhydride (0.370 mL, 3.95 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness and the residue was purified by Normal Phase column chromatography eluting with a 0-100 % Hex:EtOAc eluent to afford product as a brown solid (0.086 g, 0.164 mmol, 12% yield). UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 525.0 for [M+H] ⁺

[000357] 1H NMR (400 MHz, DMSO) 5 7.79 (dd, J = 8.9, 7.1 Hz, 1H), 7.68 (d, J = 8.1 Hz, 1H), 7.62 (dd, J = 8.0, 2.6 Hz, 1H), 7.49 - 7.44 (m, 3H), 7.40 (t, J = 7.6 Hz, 1H), 7.28 (t, J = 8.2 Hz, 2H), 7.20 (dd, J = 14.7, 7.8 Hz, 2H), 7.11 - 7.04 (m, 1H), 4.91 (ddd, J = 15.6, 9.5, 5.6 Hz, 1H), 3.83 (d, J = 2.5 Hz, 3H), 3.07 - 2.97 (m, 1H), 2.15 (d, J = 3.2 Hz, 3H)

[000358] Step 6: 4-[(2R)-2-(benzenesulfonamido)-2-(6-methoxy-l,3-benzothiazol -2- yl)ethyl]benzamidine

[000359] To a magnetically stirred solution of [[amino-[4-[(2R)-2-(benzenesulfonamido)-2-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]phenyl]methylene]amino] acetate (0.086 g, 0.164 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.107 g, 1.64 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % formic acid) to afford the product as a white solid (0.016 g, 0.034 mmol, 21% yield). 1H NMR (400 MHz, DMSO) 5 7.74 (d, J= 8.9 Hz, 2H), 7.65 - 7.38 (m, 5H), 7.38 - 7.11 (m, 5H), 7.03 (d, J= 11.4 Hz, 1H), 4.84 - 4.72 (m, 1H), 3.81 (s, 3H), 3.24 - 3.18 (m, 1H), 3.11 - 3.01 (m, 1H), amidine protons not observed. UPLC-MS (basic 6 min): Rt = 2.53 min; m/z = 467.1 for [M+H] ⁺ , 98% purity. Chiral analysis performed by Reach Separations showed 80% chiral purity.

Example 12: Exemplary synthesis of Compound 210

[000360] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000361] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.880 g, 1.96 mmol, 1.0 eq.) in DCM (20.0 mb) was added tribromoborane (8.0 mL, 800 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.301 g, 0.691 mmol, 35% yield).

[000362] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 434.0 for [M-H] ⁺

[000363] Step 2: N-[2-(3-cyanophenyl)-l-(6-isobutoxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide

[000364] To a magnetically stirred solution N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.250 g, 0.574 mmol, 1.0 eq.) in DMF (4 ml) was added sodium hydride 60% in mineral oil (0.052 g, 1.29 mmol, 1.4 eq.) and the reaction mixture was stirred at RT for 15 min. 1 -Bromo-2-methyl propane (0.109 ml, 1.01 mmol, 1.10 eq.) was added and the reaction mixture was stirred at RT for 18 h. The reaction mixture was quenched with MeOH and then concentrated to dryness. The residue was purified by Normal Phase column chromatography eluting with a 0-100 % Hex:EtOAc eluent to afford product as a light brown solid (0.239 g, 0.486 mmol, 53% yield).

[000365] 1H NMR (400 MHz, DMSO) 5 8.90 (d, J = 8.5 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.64 (s, 1H), 7.58 (s, 1H), 7.54 - 7.48 (m, 3H), 7.48 - 7.43 (m, 3H), 7.30 (t, J = 7.6 Hz, 3H), 7.09 (dd, J = 8.8, 2.4 Hz, 1H), 4.96 (td, J = 9.7, 4.8 Hz, 1H), 3.82 (d, J = 6.5 Hz, 2H), 3.37 (dd, J = 13.9, 5.0 Hz, 1H), 2.99 (ddd, J = 14.8, 10.4, 4.5 Hz, 1H), 2.07 (dq, J = 13.3, 6.6 Hz, 1H), 1.01 (d, J = 6.7 Hz, 6H). UPLC-MS (basic 2 mm) Rt = 1.30 mm. m/z = 492.0 for [M+H] ⁺

[000366] Step 3: 3-[2-(benzenesulfonamido)-2-(6-isobutoxy-l,3-benzothiazol-2- yl)ethyl]-N'- hydroxy-benzamidine

[000367] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-isobutoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.239 g, 0.486 mmol, 1.0 eq.) in EtOH (3 mL) were added hydroxylamine hydrochloride (0.068 g, 0.972 mmol, 2.0 eq.) and DIPEA (0.220 mL, 1.30 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a yellow oil (0.450 g, 0.858 mmol, 176% yield) which was used in the next step without further purification.

[000368] H NMR (400 MHz, DMSO) 5 7.76 (d, J = 8.9 Hz, 1H), 7.59 (d, J = 2.4 Hz, 1H), 7.54 (s, 1H), 7.48 (d, J = 7.9 Hz, 2H), 7.42 (d, J = 7.1 Hz, 2H), 7.37 (d, J = 7.3 Hz, 1H), 7.26 (t, J = 7.6 Hz, 3H), 7.10 - 7.03 (m, 3H), 5.74 (s, 2H), 4.90 (dd, J = 9.4, 6.0 Hz, 1H), 3.81 (d, J = 6.5 Hz,

2H), 3.25 (dd, J = 13.6, 5.7 Hz, 1H), 2.99 (dd, J = 13.9, 9.1 Hz, 1H), 2.05 (dt, J = 13.3, 6.6 Hz, 1H), 1.00 (d, J = 6.7 Hz, 6H) UPLC-MS (acidic 2 min) Rt = 1.18 min. m/z = 525.0 for [M+H] ⁺

[000369] Step 4: (benzenesulfonamido)-2-(6-isobutoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000370] To a magnetically stirred solution 3-[2-(benzenesulfonamido)-2-(6-isobutoxy-l,3- benzothiazol-2-yl)ethyl]-N'-hydroxy-benzamidine (0.450 g, 0.858 mmol, 1.0 eq) in acetic acid (5.0 mb) was added acetic anhydride (0.240 mb, 2.57 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 3 h mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.101 g, 0.178 mmol, 21% yield).

[000371] H NMR (400 MHz, DMSO) 5 8.86 (s, 1H), 7.78 (d, J = 9.0 Hz, 1H), 7.62 - 7.56 (m, 2H), 7.49 - 7.44 (m, 3H), 7.39 (t, J = 7.5 Hz, 1H), 7.27 (t, J = 7.6 Hz, 2H), 7.21 (d, J = 7.7 Hz, 1H), 7.13 (t, J = 7.7 Hz, 1H), 7.07 (dd, J = 9.0, 2.4 Hz, 1H), 6.73 (s, 2H), 4.95 - 4.88 (m, 1H), 3.81 (d, J = 6.5 Hz, 2H), 3.31 - 3.25 (m, 1H), 2.99 (dd, J = 13.9, 9.5 Hz, 1H), 2.16 (s, 3H), 2.06 (dt, J = 13.4, 6.6 Hz, 1H), 1.01 (d, J = 6.7 Hz, 6H). UPLC-MS (basic 2 mm): Rt = 1.22 mm; m/z = 567.0 for [M+H] ⁺

[000372] Step 5: 3-[2-(benzenesulfonamido)-2-(6-isobutoxy-l,3-benzothiazol-2- yl)ethyl]benzamidine

[000373] To a magnetically stirred solution of [amino-[3-[2-(benzenesulfonamido)-2-(6- isobutoxy-l,3-benzothiazol-2-yl)ethyl]phenyl]methylene]amino ] acetate (0.101 g, 0.178 mmol, 1.0 eq) in acetic acid (2.0 mb) was added zinc (0.117 g, 1.78 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 48 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid (0.021 g, 0.041 mmol, 23% yield).

[000374] 1H NMR (400 MHz, DMSO) 5 7.73 (d, J = 8.9 Hz, 1H), 7.63 (s, 1H), 7.55 (s, 1H), 7.48 (d, J = 9.2 Hz, 3H), 7.32 (t, J = 7.2 Hz, 1H), 7.23 (t, J = 7.8 Hz, 3H), 7.15 (t, J = 7.6 Hz, 1H), 7.04 (dd, J = 9.0, 2.5 Hz, 1H), 4.82 (q, J = 7.2 Hz, 1H), 3.80 (d, J = 6.5 Hz, 2H), 3.23 (dd, J = 13.6, 5.1 Hz, 2H), 3.00 (dd, J = 13.4, 8.8 Hz, 1H), 2.05 (dt, J = 13.2, 6.7 Hz, 1H), 1.00 (d, J = 6.6 Hz, 6H). UPLC-MS (basic 6 min): Rt = 3.63 min; m/z = 509.1 for [M-H] ⁺ , 98% purity. Chiral analysis shows 50:50 mixture of enantiomers.

Example 13: Exemplary synthesis of Compound 214

[000375] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000376] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.20 mmol, 1.0 eq.) in DCM (60.0 mL) was added tribromoborane (2.2 mL, 13 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness to afford product as a light brown solid (1.7 g, 3.90 mmol, 121% yield) which was used in the next step without further purification.

[000377] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 434.0 for [M-H] ⁺

[000378] Step 2: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl]oxy]propyl]carbamate

[000379] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.40 mmol, 1.0 eq.) in DMF (35 ml) was added sodium hydride 60% in mineral oil (0.480 g, 12.1 mmol, 3.5 eq.) and the reaction mixture was stirred at RT for 15 min. 3-(Boc-amino)propyl bromide (1.23 g, 5.17 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with water (300 mL) and then extracted with EtOAc (3 x 100 mb). The combined organic phase was washed with brine, dried over anhydrous sodium sulfate and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (1.27 g, 2.14 mmol, 62% yield).

[000380] ¹ H NMR (400 MHz, DMSO) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 593.1 for [M+H] ⁺

[000381] Step 3: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]carbamate

[000382] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3-cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]carba mate (0.400 g, 0.675 mmol, 1.0 eq.) in EtOH (10 mL) were added hydroxylamine hydrochloride (0.116 g, 1.67 mmol, 2.5 eq.) and DIPEA (0.37 mL, 2.13 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a dark brown glass (0.734 g, 0.631 mmol, 94% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.10 min. m/z = 626.1 for [M+H] ⁺

[000383] Step 4: [ [amino- [3- [2-(benzenesulfonamido)-2- [6- [3 -(tert- butoxy carbonylamino)propoxy]- 1 ,3-benzothiazol-2-yl]ethyl]phenyl]methylene]amino] acetate

[000384] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- [3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6 -yl]oxy]propyl]carbamate (0.872 g, 1.39 mmol, 1.0 eq) in acetic acid (14.0 mL) was added acetic anhydride (0.40 mL, 4.24 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.149 g, 0.183 mmol, 13% yield).

[000385] ¹ H NMR 142373-2 (400 MHz, DMSO) 5 8.87 (s, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.58 (d, J = 2.6 Hz, 2H), 7.50 - 7.45 (m, 3H), 7.30 - 7.05 (m, 6H), 6.95 - 6.89 (m, 1H), 6.73 (s, 2H), 4.97 - 4.86 (m, 1H), 3.27 (d, J = 5.6 Hz, 1H), 3.13 - 3.08 (m, 2H), 2.99 (dd, J = 13.7, 9.4 Hz, 1H), 2.15 (s, 3H), 1.89 - 1.83 (m, 2H), 1.38 (s, 9H), 1.38 - 1.35 (m, 2H). UPLC-MS (basic 2 min): Rt = 1.13 min; m/z = 668.2 for [M+H] ⁺

[000386] Step 5: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3- carbamimidoylphenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl] carbamate

[000387] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3- (tert-butoxycarbonylamino)propoxy]-l,3-benzothiazol-2-yl]eth yl]phenyl]methylene]amino] acetate (0.149 g, 0.223 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.292 g, 4.46 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5- 95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.067 g, 0.109 mmol, 49% yield). UPLC-MS (basic 4 min): Rt = 1.28 min; m/z = 610.3 for [M+H] ⁺ , 99% purity

[000388] Step 6: 3-[2-[6-(3-aminopropoxy)-l,3-benzothiazol-2-yl]-2- (benzenesulfonamido)ethyl]benzamidine; dihydrochloride

[000389] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3-carbamimidoylphenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]prop yl]carbamate (0.045 g, 0.074 mmol, 1.0 eq) in DCM (1.0 mL) was added 4M HC1 in dioxane (1.8 mL, 7.38 mmol, 100 eq.). The reaction mixture was stirred at room temperature for 1 h. The precipitate was concentrated to dryness and dried in the vacuum oven to afford the product as an off-white solid. (0.043 g, 0.072 mmol, 97% yield).

[000390] ¹ H NMR (400 MHz, DMSO) 5 9.25 (s, 2H), 9.06 (s, 2H), 8.91 (d, J = 8.2 Hz, 1H), 7.95 (s, 3H), 7.82 (d, J = 8.9 Hz, 1H), 7.73 (s, 1H), 7.65 (d, J = 2.6 Hz, 1H), 7.58 (d, J = 8.4 Hz, 1H), 7.51 - 7.44 (m, 3H), 7.40 (t, J = 7.4 Hz, 1H), 7.28 (dt, J = 13.9, 7.6 Hz, 3H), 7.12 (dd, J = 8.9, 2.6 Hz, 1H), 5.08 - 4.97 (m, 1H), 4.14 (t, J = 6.1 Hz, 2H), 3.38 (dd, J = 13.4, 4.3 Hz, 1H), 3.09 - 3.03 (m, 1H), 2.99 (dd, J = 12.5, 6.1 Hz, 2H), 2.10 - 2.01 (m, 2H). UPLC-MS (basic 6 min): Rt = 1.99 min; m/z = 510.1 for [M+H] ⁺ (as the free base), 97% purity.

Example 14: Exemplary synthesis of Compound 212

[000391] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000392] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.20 mmol, 1.0 eq.) in DCM (60.0 mL) was added tribromoborane (2.2 mL, 13 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness to afford product as a light brown solid (1.7 g, 3.90 mmol, 121% yield) which was used in the next step without further purification.

[000393] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 434.0 for [M-H] ⁺

[000394] Step 2: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl]oxy]propyl]carbamate

[000395] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.40 mmol, 1.0 eq.) in DMF (35 ml) was added sodium hydride 60% in mineral oil (0.480 g, 12.1 mmol, 3.5 eq.) and the reaction mixture was stirred at RT for 15 min. 3-(Boc-amino)propyl bromide (1.23 g, 5.17 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with water (300 mL) and then extracted with EtOAc (3 x 100 mb). The combined organic phase was washed with brine, dried over anhydrous sodium sulfate and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (1.27 g, 2.14 mmol, 62% yield).

[000396] ¹ H NMR (400 MHz, DMSO) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 593.1 for [M+H] ⁺

[000397] Step 3: N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2-yl]-2-(3- cyanophenyl)ethyl]benzenesulfonamide; hydrochloride

[000398] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3 -cyanophenyl) ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]carbamate (0.800 g, 1.35 mmol, 1.0 eq.) in Et ₂ O (14 mL) was added 4M HC1 solution in dioxane (6.7 mL, 27.0 mmol, 20.0 eq.) and the reaction mixture was stirred at RT for 18 h. The resulting precipitate was filtered and the solid washed with ether (50 mL) to afford product as a beige solid (0.702 g, 1.33 mmol, 98% yield) which was used in the next step without further purification.

[000399] ¹ H NMR (400 MHz, DMSO) 5 8.92 (d, J = 8.3 Hz, 1H), 7.97 (s, 3H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 (t, J = 1.7 Hz, 1H), 7.50 (dq, J = 8.0, 1.7 Hz, 2H), 7.43 (tt,

J = 8.6, 1.3 Hz, 3H), 7.33 - 7.24 (m, 3H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 4.95 (ddd, J = 10.3, 8.3, 4.7 Hz, 1H), 4.13 (t, J = 6.1 Hz, 2H), 3.39 - 3.31 (m, 1H), 3.03 - 2.91 (m, 2H), 2.11 - 1.99 (m, 2H). UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 493.1 for [M] ⁺ as the free base

[000400] Step 4: N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl] oxy] propyl] acetamide

[000401] To a magnetically stirred solution of N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2- yl]-2-(3-cyanophenyl)ethyl]benzenesulfonamide; hydrochloride (0.350 g, 0.662 mmol, 1.0 eq.) in DCM (10 mL) were added triethylamine (0.10 mL, 0.744 mmol, 1.12 eq.) and acetyl chloride (0.053 mL, 0.744 mmol, 1.12 eq.) at 0 °C. The reaction mixture was allowed to warm to RT and stirred for 1 h. The reaction mixture was concentrated to dryness to afford product as a brown gum (0.297 g, 0.556 mmol, 84% yield) which was used in the next step without further purification.

[000402] ¹ H NMR (400 MHz, DMSO) 5 8.93 (s, 1H), 7.96 (t, J = 5.6 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.65 - 7.56 (m, 2H), 7.54 - 7.38 (m, 5H), 7.29 (ddd, J = 10.3, 5.8, 2.5 Hz, 3H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 4.95 (s, 1H), 4.05 (t, J = 6.3 Hz, 2H), 3.20 (q, J = 6.6 Hz, 2H), 1.87 (p, J = 6.7 Hz, 2H), 1.81 (s, 3H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 534.9 for [M] ⁺

[000403] Step 5: N-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]acetamide

[000404] To a magnetically stirred solution of N-[3-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]acetamid e (0.354 g, 0.662 mmol, 1.0 eq.) in EtOH (10 mL) were added hydroxylamine hydrochloride (0.114 g, 1.64 mmol, 2.5 eq.) and DIPEA (0.36 mL, 2.09 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a dark brown glass (0.341 g, 0.601 mmol, 91% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.91 min. m/z = 568.3 for [M+H] ⁺

[000405] Step 6: [[[3-[2-[6-(3-acetamidopropoxy)-l,3-benzothiazol-2-yl]-2- (benzenesulfonamido)ethyl]phenyl]-amino-methylene]amino] acetate

[000406] To a magnetically stirred solution of N-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]acetamide (0.376 g, 0.662 mmol, 1.0 eq) in acetic acid (8.0 mL) was added acetic anhydride (0.19 mL, 2.01 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.172 g, 0.206 mmol, 31% yield).

[000407] ¹ H NMR (400 MHz, DMSO) 5 8.87 (s, 1H), 7.97 - 7.89 (m, 1H), 7.78 (dd, J = 8.9, 2.9 Hz, 1H), 7.63 - 7.56 (m, 2H), 7.50 - 7.46 (m, 2H), 7.43 - 7.32 (m, 1H), 7.30 - 7.04 (m, 5H), 6.73 (s, 2H), 5.00 - 4.83 (m, 1H), 4.05 (t, J = 6.3 Hz, 2H), 3.30 - 3.26 (m, 1H), 3.21 (q, J = 6.7 Hz, 2H), 3.00 (dd, J = 13.8, 9.4 Hz, 1H), 2.15 (s, 3H), 1.92 - 1.83 (m, 2H), 1.81 (s, 3H). UPLC- MS (basic 2 min): Rt = 0.93 min; m/z = 610.1 for [M+H] ⁺

[000408] Step 7: N-[3-[[2-[l-(benzenesulfonamido)-2-(3-carbamimidoylphenyl)et hyl]-l,3- benzothiazol-6-yl] oxy] propyl] acetamide

[000409] To a magnetically stirred solution of [[[3-[2-[6-(3-acetamidopropoxy)-l,3- benzothiazol-2-yl]-2-(benzenesulfonamido)ethyl]phenyl]-amino -methylene]amino] acetate (0.172 g, 0.282 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.369 g, 5.64 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.086 g, 0.154 mmol, 55% yield).

[000410] ¹ H NMR (400 MHz, DMSO) 5 7.95 - 7.88 (m, 1H), 7.74 (d, J = 8.9 Hz, 1H), 7.68 - 7.58 (m, 1H), 7.58 - 7.44 (m, 4H), 7.39 - 7.09 (m, 6H), 7.03 (d, J =8.8 Hz, 1H), 4.91 - 4.76 (m,

1H), 4.03 (t, J = 6.1 Hz, 2H), 3.22 - 3.19 (m, 2H), 3.04 - 2.97 (m, 1H), 1.92 - 1.83 (m, 2H), 1.81 (s, 3H). amidine protons not observed; 1H under H ₂ O peak. UPLC-MS (basic 4 min): Rt = 1.01 min; m/z = 552.2 for [M+H] ⁺ , 99% purity Chiral analysis performed by Reach indicated 50.2% chiral purity.

Example 15: Exemplary synthesis of Compound 212

[000411] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000412] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.20 mmol, 1.0 eq.) in DCM (60.0 mL) was added tribromoborane (2.2 mL, 13 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness to afford product as a light brown solid (1.7 g, 3.90 mmol, 121% yield) which was used in the next step without further purification.

[000413] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 434.0 for [M-H] ⁺

[000414] Step 2: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl]oxy]propyl]carbamate

[000415] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.40 mmol, 1.0 eq.) in DMF (35 ml) was added sodium hydride 60% in mineral oil (0.480 g, 12.1 mmol, 3.5 eq.) and the reaction mixture was stirred at RT for 15 min. 3-(Boc-amino)propyl bromide (1.23 g, 5.17 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with water (300 mL) and then extracted with EtOAc (3 x 100 mL). The combined organic phase was washed with brine, dried over anhydrous sodium sulfate and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (1.27 g, 2.14 mmol, 62% yield).

[000416] ¹ H NMR (400 MHz, DMSO) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H),

3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 593.1 for [M+H] ⁺

[000417] Step 3: N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2-yl]-2-(3- cyanophenyl)ethyl]benzenesulfonamide; hydrochloride

[000418] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3 -cyanophenyl) ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]carbamate (0.800 g, 1.35 mmol, 1.0 eq.) in Et ₂ O (14 mb) was added 4M HC1 solution in dioxane (6.7 mb, 27.0 mmol, 20.0 eq.) and the reaction mixture was stirred at RT for 18 h. The resulting precipitate was filtered and the solid washed with ether (50 mb) to afford product as a beige solid (0.702 g, 1.33 mmol, 98% yield) which was used in the next step without further purification.

[000419] ¹ H NMR (400 MHz, DMSO) 5 8.92 (d, J = 8.3 Hz, 1H), 7.97 (s, 3H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 (t, J = 1.7 Hz, 1H), 7.50 (dq, J = 8.0, 1.7 Hz, 2H), 7.43 (tt, J = 8.6, 1.3 Hz, 3H), 7.33 - 7.24 (m, 3H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 4.95 (ddd, J = 10.3, 8.3, 4.7 Hz, 1H), 4.13 (t, J = 6.1 Hz, 2H), 3.39 - 3.31 (m, 1H), 3.03 - 2.91 (m, 2H), 2.11 - 1.99 (m, 2H). UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 493.1 for [M] ⁺ as the free base

[000420] Step 4: N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl] oxy] propyl] acetamide

[000421] To a magnetically stirred solution of N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2- yl]-2-(3-cyanophenyl)ethyl]benzenesulfonamide; hydrochloride (0.350 g, 0.662 mmol, 1.0 eq.) in DCM (10 mb) were added triethylamine (0.10 mL, 0.744 mmol, 1.12 eq.) and acetyl chloride (0.053 mL, 0.744 mmol, 1.12 eq.) at 0 °C. The reaction mixture was allowed to warm to RT and stirred for 1 h. The reaction mixture was concentrated to dryness to afford product as a brown gum (0.297 g, 0.556 mmol, 84% yield) which was used in the next step without further purification.

[000422] ¹ H NMR (400 MHz, DMSO) 5 8.93 (s, 1H), 7.96 (t, J = 5.6 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.65 - 7.56 (m, 2H), 7.54 - 7.38 (m, 5H), 7.29 (ddd, J = 10.3, 5.8, 2.5 Hz, 3H), 7.08

(dd, J = 8.9, 2.6 Hz, 1H), 4.95 (s, 1H), 4.05 (t, J = 6.3 Hz, 2H), 3.20 (q, J = 6.6 Hz, 2H), 1.87 (p, J = 6.7 Hz, 2H), 1.81 (s, 3H). UPLC-MS (basic 2 min) Rt = 1.02 min. m/z = 534.9 for [M] ⁺

[000423] Step 5: N-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]acetamide

[000424] To a magnetically stirred solution of N-[3-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]acetamid e (0.354 g, 0.662 mmol, 1.0 eq.) in EtOH (10 mL) were added hydroxylamine hydrochloride (0.114 g, 1.64 mmol, 2.5 eq.) and DIPEA (0.36 mL, 2.09 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a dark brown glass (0.341 g, 0.601 mmol, 91% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.91 min. m/z = 568.3 for [M+H] ⁺

[000425] Step 6: [[[3-[2-[6-(3-acetamidopropoxy)-l,3-benzothiazol-2-yl]-2- (benzenesulfonamido)ethyl]phenyl]-amino-methylene]amino] acetate

[000426] To a magnetically stirred solution of N-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]acetamide (0.376 g, 0.662 mmol, 1.0 eq) in acetic acid (8.0 mL) was added acetic anhydride (0.19 mL, 2.01 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.172 g, 0.206 mmol, 31% yield).

[000427] ¹ H NMR (400 MHz, DMSO) 5 8.87 (s, 1H), 7.97 - 7.89 (m, 1H), 7.78 (dd, J = 8.9, 2.9 Hz, 1H), 7.63 - 7.56 (m, 2H), 7.50 - 7.46 (m, 2H), 7.43 - 7.32 (m, 1H), 7.30 - 7.04 (m, 5H), 6.73 (s, 2H), 5.00 - 4.83 (m, 1H), 4.05 (t, J = 6.3 Hz, 2H), 3.30 - 3.26 (m, 1H), 3.21 (q, J = 6.7 Hz, 2H), 3.00 (dd, J = 13.8, 9.4 Hz, 1H), 2.15 (s, 3H), 1.92 - 1.83 (m, 2H), 1.81 (s, 3H). UPLC- MS (basic 2 min): Rt = 0.93 min; m/z = 610.1 for [M+H] ⁺

Example 16: Exemplary synthesis of Compound 213

[000428] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000429] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.20 mmol, 1.0 eq.) in DCM (60.0 mL) was added tribromoborane (2.2 mL, 13 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness to afford product as a light brown solid (1.7 g, 3.90 mmol, 121% yield) which was used in the next step without further purification.

[000430] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 434.0 for [M-H] ⁺

[000431] Step 2: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl]oxy]propyl]carbamate

[000432] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.40 mmol, 1.0 eq.) in DMF (35 ml) was added sodium hydride 60% in mineral oil (0.480 g, 12.1 mmol, 3.5 eq.) and the reaction mixture was stirred at RT for 15 min. 3-(Boc-amino)propyl bromide (1.23 g, 5.17 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with water (300 mL) and then extracted with EtOAc (3 x 100 mb). The combined organic phase was washed with brine, dried over anhydrous sodium sulfate and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (1.27 g, 2.14 mmol, 62% yield).

[000433] ¹ H NMR (400 MHz, DMSO) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 593.1 for [M+H] ⁺

[000434] Step 3: N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2-yl]-2-(3- cyanophenyl)ethyl]benzenesulfonamide; hydrochloride

[000435] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3 -cyanophenyl) ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]carbamate (0.800 g, 1.35 mmol, 1.0 eq.) in Et ₂ O (14 mL) was added 4M HC1 solution in dioxane (6.7 mL, 27.0 mmol, 20.0 eq.) and the reaction mixture was stirred at RT for 18 h. The resulting precipitate was filtered and the solid washed with ether (50 mL) to afford product as a beige solid (0.702 g, 1.33 mmol, 98% yield) which was used in the next step without further purification.

[000436] ¹ H NMR (400 MHz, DMSO) 5 8.92 (d, J = 8.3 Hz, 1H), 7.97 (s, 3H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 (t, J = 1.7 Hz, 1H), 7.50 (dq, J = 8.0, 1.7 Hz, 2H), 7.43 (tt, J = 8.6, 1.3 Hz, 3H), 7.33 - 7.24 (m, 3H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 4.95 (ddd, J = 10.3, 8.3, 4.7 Hz, 1H), 4.13 (t, J = 6.1 Hz, 2H), 3.39 - 3.31 (m, 1H), 3.03 - 2.91 (m, 2H), 2.11 - 1.99 (m, 2H). UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 493.1 for [M] ⁺ as the free base

[000437] Step 4: N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl] oxy] propyl] acetamide

[000438] To a magnetically stirred solution of N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2- yl]-2-(3-cyanophenyl)ethyl]benzenesulfonamide; hydrochloride (0.350 g, 0.662 mmol, 1.0 eq.) in DCM (10 mL) were added triethylamine (0.10 mL, 0.744 mmol, 1.12 eq.) and N- methylaminoformyl chloride (0.062 g, 0.662 mmol, 1.0 eq.) at 0 °C. The reaction mixture was allowed to warm to RT and stirred for 1 h. The reaction mixture was concentrated to dryness to afford product as a brown gum (0.321 g, 0.584 mmol, 88% yield) which was used in the next step without further purification.

[000439] ¹ H NMR (400 MHz, DMSO) 5 8.91 (d, J = 8.5 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.65 - 7.56 (m, 2H), 7.55 - 7.39 (m, 5H), 7.34 - 7.25 (m, 3H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 6.01 (t, J = 5.8 Hz, 1H), 5.74 (d, J = 4.7 Hz, 1H), 4.96 (t, J = 11.3 Hz, 1H), 4.05 (t, J = 6.3 Hz, 2H), 3.21 - 3.12 (m, 2H), 3.00 (dd, J = 13.8, 10.3 Hz, 1H), 2.54 (d, J = 4.7 Hz, 3H), 1.85 (p, J = 6.5 Hz, 2H). UPLC-MS (basic 2 mm) Rt = 1.01 mm. m/z = 550.0 for [M] ⁺

[000440] Step 5: l-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]-3-methyl-urea

[000441] To a magnetically stirred solution of l-[3-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]-3-methy l-urea (0.364 g, 0.662 mmol, 1.0 eq.) in EtOH (10 mL) were added hydroxylamine hydrochloride (0.114 g, 1.64 mmol, 2.5 eq.) and DIPEA (0.36 mL, 2.09 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a dark brown glass (0.337 g, 0.578 mmol, 87% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.90 min. m/z = 583.3 for [M+H] ⁺

[000442] Step 6: [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3- (methylcarbamoylamino)propoxy]-l,3-benzothiazol-2-yl]ethyl]p henyl]methylene]amino] acetate

[000443] To a magnetically stirred solution of l-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]-3-methyl-urea (0.386 g, 0.662 mmol, 1.0 eq) in acetic acid (8.0 mL) was added acetic anhydride (0.19 mL, 2.01 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.136 g, 0.163 mmol, 25% yield).

[000444] ¹ H NMR (400 MHz, DMSO) 5 8.87 (s, 1H), 7.78 (dd, J = 8.9, 3.9 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.49 - 7.45 (m, 2H), 7.38 (t, J = 7.4 Hz, 1H), 7.31 - 7.01 (m, 6H), 6.73 (s, 2H), 5.97 (t, J = 5.6 Hz, 1H), 5.75 - 5.68 (m, 1H), 4.96 - 4.86 (m, 1H), 4.04 (t, J = 6.3 Hz, 2H), 3.29 - 3.24 (m, 1H), 3.16 (q, J = 6.6 Hz, 2H), 2.99 (dd, J = 13.9, 9.3 Hz, 1H), 2.54 (d, J = 4.7 Hz, 3H), 2.15 (s, 3H), 1.88 - 1.82 (m, 2H). UPLC-MS (basic 2 mm): Rt = 0.92 mm; m/z = 625.1 for [M+H] ⁺

[000445] Step 7: l-[3-[[2-[l-(benzenesulfonamido)-2-(3-carbamimidoylphenyl)et hyl]-l,3- benzothiazol-6-yl]oxy]propyl]-3-methyl-urea

[000446] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3- (methylcarbamoylamino)propoxy]-l,3-benzothiazol-2-yl]ethyl]p henyl]methylene]amino] acetate (0.136 g, 0.218 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.285 g, 4.35 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.065 g, 0.112 mmol, 51% yield).

[000447] ¹ H NMR (400 MHz, DMSO) 5 7.74 (d, J = 8.9 Hz, 1H), 7.66 - 7.60 (m, 1H), 7.56 - 7.53 (m, 1H), 7.51 - 7.45 (m, 3H), 7.35 - 7.28 (m, 1H), 7.28 - 7.08 (m, 5H), 7.04 (dd, J = 8.9, 2.4 Hz, 1H), 6.01 - 5.93 (m, 1H), 5.75 - 5.68 (m, 1H), 4.87 - 4.79 (m, 1H), 4.03 (t, J = 6.2 Hz, 2H), 3.17 - 3.13 (m, 2H), 3.03 - 2.97 (m, 1H), 2.54 (d, J = 4.7 Hz, 3H), 1.89 - 1.80 (m, 2H). amidine protons not observed; 1H under H ₂ O peak. UPLC-MS (basic 4 min): Rt = 1.00 min; m/z = 567.2 for [M+H] ⁺ , 98% purity Chiral analysis performed by Reach indicated 50.0% chiral purity.

Example 17: Exemplary synthesis of Compound 214

[000448] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000449] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.20 mmol, 1.0 eq.) in DCM (60.0 mL) was added tribromoborane (2.2 mL, 13 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness to afford product as a light brown solid (1.7 g, 3.90 mmol, 121% yield) which was used in the next step without further purification.

[000450] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). nUPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 434.0 for [M-H] ⁺

[000451] Step 2: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl]oxy]propyl]carbamate

[000452] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.40 mmol, 1.0 eq.) in DMF (35 ml) was added sodium hydride 60% in mineral oil (0.480 g, 12.1 mmol, 3.5 eq.) and the reaction mixture was stirred at RT for 15 min. 3-(Boc-amino)propyl bromide (1.23 g, 5.17 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with water (300 mL) and then extracted with EtOAc (3 x 100 mL). The combined organic phase was washed with brine, dried over anhydrous sodium sulfate and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (1.27 g, 2.14 mmol, 62% yield).

[000453] ¹ H NMR (400 MHz, DMSO) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 593.1 for [M+H] ⁺

[000454] Step 3: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]carbamate

[000455] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3-cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]carba mate (0.400 g, 0.675 mmol, 1.0 eq.) in EtOH (10 mL) were added hydroxylamine hydrochloride (0.116 g, 1.67 mmol, 2.5 eq.) and DIPEA (0.37 mL, 2.13 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a dark brown glass (0.734 g, 0.631 mmol, 94% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.10 min. m/z = 626.1 for [M+H] ⁺

[000456] Step 4: [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3-(tert- butoxycarbonylamino)propoxy]- 1 ,3-benzothiazol-2-yl]ethyl]phenyl]methylene]amino] acetate

[000457] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- [3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6 -yl]oxy]propyl]carbamate (0.872 g, 1.39 mmol, 1.0 eq) in acetic acid (14.0 mL) was added acetic anhydride (0.40 mL, 4.24 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.149 g, 0.183 mmol, 13% yield).

[000458] ¹ H NMR 142373-2 (400 MHz, DMSO) 5 8.87 (s, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.58 (d, J = 2.6 Hz, 2H), 7.50 - 7.45 (m, 3H), 7.30 - 7.05 (m, 6H), 6.95 - 6.89 (m, 1H), 6.73 (s, 2H), 4.97 - 4.86 (m, 1H), 3.27 (d, J = 5.6 Hz, 1H), 3.13 - 3.08 (m, 2H), 2.99 (dd, J = 13.7, 9.4 Hz, 1H), 2.15 (s, 3H), 1.89 - 1.83 (m, 2H), 1.38 (s, 9H), 1.38 - 1.35 (m, 2H). UPLC-MS (basic 2 min): Rt = 1.13 min; m/z = 668.2 for [M+H] ⁺

[000459] Step 5: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3- carbamimidoylphenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl] carbamate

[000460] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3- (tert-butoxycarbonylamino)propoxy]-l,3-benzothiazol-2-yl]eth yl]phenyl]methylene]amino] acetate (0.149 g, 0.223 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.292 g, 4.46 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5- 95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.067 g, 0.109 mmol, 49% yield). UPLC-MS (basic 4 min): Rt = 1.28 min; m/z = 610.3 for [M+H] ⁺ , 99% purity. Product purified by SFC using Lux Cl (21.2mm x 250mm, 5um) with a 35:65 MeOH:CO2 (0.2% v/v NH3) eluent to afford product as a white solid (0.006 g). UPLC-MS (acidic 4 min): Rt = 1.28 min; m/z = 610.3 for [M+H]+, 100% purity Chiral analysis performed by Reach Separations showed 99.9% chiral purity. Rt = 1.65 min.

[000461] Step 6: 3-[2-[6-(3-aminopropoxy)-l,3-benzothiazol-2-yl]-2- (benzenesulfonamido)ethyl]benzamidine; dihydrochloride

[000462] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3-carbamimidoylphenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]prop yl]carbamate (0.006 g, 0.009 mmol, 1.0 eq) in DCM (0.5 mL) was added 4M HC1 in dioxane (0.23 mL, 0.918 mmol, 100 eq.). The reaction mixture was stirred at room temperature for 2 h. The precipitate was concentrated to dryness and dried in the vacuum oven to afford the product as an off-white solid. (0.005 g, 0.009 mmol, 93% yield).

[000463] ¹ H NMR (400 MHz, DMSO) 5 9.23 (s, 2H), 9.01 (s, 2H), 8.90 (d, J = 8.2 Hz, 1H), 7.89 (s, 3H), 7.82 (d, J = 8.9 Hz, 1H), 7.72 (s, 1H), 7.65 (d, J = 2.6 Hz, 1H), 7.58 (d, J = 7.8 Hz, 1H), 7.50 - 7.43 (m, 3H), 7.40 (t, J = 7.5 Hz, 1H), 7.28 (dt, J = 15.4, 7.6 Hz, 3H), 7.12 (dd, J = 8.9, 2.6 Hz, 1H), 5.08 - 4.95 (m, 1H), 4.14 (t, J = 6.1 Hz, 2H), 3.39 - 3.35 (m, 1H), 3.09 - 3.03 (m, 1H), 3.03 - 2.96 (m, 2H), 2.13 - 1.99 (m, 2H). UPLC-MS (basic 4 mm): Rt = 1.08 mm; m/z = 510.2 for [M+H] ⁺ (as the free base), 100% purity

Example 18: Exemplary synthesis of Compound 214

[000464] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000465] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.20 mmol, 1.0 eq.) in DCM (60.0 mL) was added tribromoborane (2.2 mL, 13 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness to afford product as a light brown solid (1.7 g, 3.90 mmol, 121% yield) which was used in the next step without further purification.

[000466] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 434.0 for [M-H] ⁺

[000467] Step 2: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl]oxy]propyl]carbamate

[000468] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.40 mmol, 1.0 eq.) in DMF (35 ml) was added sodium hydride 60% in mineral oil (0.480 g, 12.1 mmol, 3.5 eq.) and the reaction mixture was stirred at RT for 15 min. 3-(Boc-amino)propyl bromide (1.23 g, 5.17 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with water (300 mL) and then extracted with EtOAc (3 x 100 mb). The combined organic phase was washed with brine, dried over anhydrous sodium sulfate and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (1.27 g, 2.14 mmol, 62% yield).

[000469] ¹ H NMR (400 MHz, DMSO) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 593.1 for [M+H] ⁺

[000470] Step 3: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]carbamate

[000471] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3-cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]carba mate (0.400 g, 0.675 mmol, 1.0 eq.) in EtOH (10 mL) were added hydroxylamine hydrochloride (0.116 g, 1.67 mmol, 2.5 eq.) and DIPEA (0.37 mL, 2.13 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a dark brown glass (0.734 g, 0.631 mmol, 94% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.10 min. m/z = 626.1 for [M+H] ⁺

[000472] Step 4: [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3-(tert- butoxycarbonylamino)propoxy]-l,3-benzothiazol-2-yl]ethyl]phe nyl]methylene]amino] acetate

[000473] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- [3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6 -yl]oxy]propyl]carbamate (0.872 g, 1.39 mmol, 1.0 eq) in acetic acid (14.0 mL) was added acetic anhydride (0.40 mL, 4.24 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.149 g, 0.183 mmol, 13% yield).

[000474] ¹ H NMR 142373-2 (400 MHz, DMSO) 5 8.87 (s, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.58 (d, J = 2.6 Hz, 2H), 7.50 - 7.45 (m, 3H), 7.30 - 7.05 (m, 6H), 6.95 - 6.89 (m, 1H), 6.73 (s, 2H), 4.97 - 4.86 (m, 1H), 3.27 (d, J = 5.6 Hz, 1H), 3.13 - 3.08 (m, 2H), 2.99 (dd, J = 13.7, 9.4 Hz, 1H), 2.15 (s, 3H), 1.89 - 1.83 (m, 2H), 1.38 (s, 9H), 1.38 - 1.35 (m, 2H). UPLC-MS (basic 2 min): Rt = 1.13 min; m/z = 668.2 for [M+H] ⁺

[000475] Step 5: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3- carbamimidoylphenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl] carbamate

[000476] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3- (tert-butoxycarbonylamino)propoxy]-l,3-benzothiazol-2-yl]eth yl]phenyl]methylene]amino] acetate (0.149 g, 0.223 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.292 g, 4.46 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5- 95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.067 g, 0.109 mmol, 49% yield). UPLC-MS (basic 4 min): Rt = 1.28 min; m/z = 610.3 for [M+H] ⁺ , 99% purity Product purified by SFC using Lux Cl (21.2mm x 250mm, 5um) with a 35:65 MeOH:CO2 (0.2% v/v NH3) eluent to afford product as a white solid (0.007 g). UPLC-MS (acidic 4 min): Rt = 1.28 min; m/z = 610.3 for [M+H]+, 100% purity. Chiral analysis performed by Reach Separations showed 99.5% chiral purity. Rt = 1.98 min.

[000477] Step 6: 3-[2-[6-(3-aminopropoxy)-l,3-benzothiazol-2-yl]-2- (benzenesulfonamido)ethyl]benzamidine; dihydrochloride

[000478] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3-carbamimidoylphenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]prop yl]carbamate (0.007 g, 0.011 mmol, 1.0 eq) in DCM (0.5 mL) was added 4M HC1 in dioxane (0.27 mL, 1.07 mmol, 100 eq.). The reaction mixture was stirred at room temperature for 1 h. The precipitate was concentrated to dryness and dried in the vacuum oven to afford the product as an off-white solid. (0.006 g, 0.009 mmol, 92% yield).

[000479] ¹ H NMR (400 MHz, DMSO) 5 9.24 (s, 2H), 9.02 (s, 2H), 8.90 (d, J = 8.2 Hz, 1H), 7.90 (s, 3H), 7.82 (d, J = 8.9 Hz, 1H), 7.72 (s, 1H), 7.65 (d, J = 2.5 Hz, 1H), 7.58 (d, J = 8.1 Hz, 1H), 7.51 - 7.44 (m, 3H), 7.40 (t, J = 7.5 Hz, 1H), 7.28 (dt, J = 15.5, 7.6 Hz, 3H), 7.12 (dd, J = 8.9, 2.6 Hz, 1H), 5.11 - 4.93(m, 1H), 4.14 (t, J = 6.1 Hz, 2H), 3.40 - 3.35 (m, 1H), 3.09 - 3.02 (m, 1H), 3.02 - 2.95 (m, 2H), 2.11 - 2.01 (m, 2H). UPLC-MS (basic 4 mm): Rt = 1.50 mm; m/z = 510.0 for [M+H] ⁺ (as the free base), 95% purity

Example 19: Exemplary synthesis of Compound 214

[000480] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000481] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.20 mmol, 1.0 eq.) in DCM (60.0 mL) was added tribromoborane (2.2 mL, 13 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness to afford product as a light brown solid (1.7 g, 3.90 mmol, 121% yield) which was used in the next step without further purification.

[000482] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 434.0 for [M-H] ⁺

[000483] Step 2: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl]oxy]propyl]carbamate

[000484] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.40 mmol, 1.0 eq.) in DMF (35 ml) was added sodium hydride 60% in mineral oil (0.480 g, 12.1 mmol, 3.5 eq.) and the reaction mixture was stirred at RT for 15 min. 3-(Boc-amino)propyl bromide (1.23 g, 5.17 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with water (300 mL) and then extracted with EtOAc (3 x 100 mb). The combined organic phase was washed with brine, dried over anhydrous sodium sulfate and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (1.27 g, 2.14 mmol, 62% yield).

[000485] ¹ H NMR (400 MHz, DMSO) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 593.1 for [M+H] ⁺

[000486] Step 3: N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2-yl]-2-(3- cyanophenyl)ethyl]benzenesulfonamide; hydrochloride

[000487] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3 -cyanophenyl) ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]carbamate (0.800 g, 1.35 mmol, 1.0 eq.) in Et20 (14 mL) was added 4M HC1 solution in dioxane (6.7 mL, 27.0 mmol, 20.0 eq.) and the reaction mixture was stirred at RT for 18 h. The resulting precipitate was filtered and the solid washed with ether (50 mL) to afford product as a beige solid (0.702 g, 1.33 mmol, 98% yield) which was used in the next step without further purification.

[000488] ¹ H NMR (400 MHz, DMSO) 5 8.92 (d, J = 8.3 Hz, 1H), 7.97 (s, 3H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 (t, J = 1.7 Hz, 1H), 7.50 (dq, J = 8.0, 1.7 Hz, 2H), 7.43 (tt, J = 8.6, 1.3 Hz, 3H), 7.33 - 7.24 (m, 3H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 4.95 (ddd, J = 10.3, 8.3, 4.7 Hz, 1H), 4.13 (t, J = 6.1 Hz, 2H), 3.39 - 3.31 (m, 1H), 3.03 - 2.91 (m, 2H), 2.11 - 1.99 (m, 2H). UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 493.1 for [M] ⁺ as the free base

[000489] Step 4: N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl] oxy] propyl] acetamide

[000490] To a magnetically stirred solution of N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2- yl]-2-(3-cyanophenyl)ethyl]benzenesulfonamide; hydrochloride (0.350 g, 0.662 mmol, 1.0 eq.) in DCM (10 mL) were added triethylamine (0.10 mL, 0.744 mmol, 1.12 eq.) and acetyl chloride (0.053 mL, 0.744 mmol, 1.12 eq.) at 0 °C. The reaction mixture was allowed to warm to RT and stirred for 1 h. The reaction mixture was concentrated to dryness to afford product as a brown gum (0.297 g, 0.556 mmol, 84% yield) which was used in the next step without further purification.

[000491] ¹ H NMR (400 MHz, DMSO) 5 8.93 (s, 1H), 7.96 (t, J = 5.6 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.65 - 7.56 (m, 2H), 7.54 - 7.38 (m, 5H), 7.29 (ddd, J = 10.3, 5.8, 2.5 Hz, 3H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 4.95 (s, 1H), 4.05 (t, J = 6.3 Hz, 2H), 3.20 (q, J = 6.6 Hz, 2H), 1.87 (p, J = 6.7 Hz, 2H), 1.81 (s, 3H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 534.9 for [M] ⁺

[000492] Step 5: N-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]acetamide

[000493] To a magnetically stirred solution of N-[3-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]acetamid e (0.354 g, 0.662 mmol, 1.0 eq.) in EtOH (10 mL) were added hydroxylamine hydrochloride (0.114 g, 1.64 mmol, 2.5 eq.) and DIPEA (0.36 mL, 2.09 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a dark brown glass (0.341 g, 0.601 mmol, 91% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.91 min. m/z = 568.3 for [M+H] ⁺

[000494] Step 6: [[[3-[2-[6-(3-acetamidopropoxy)-l,3-benzothiazol-2-yl]-2- (benzenesulfonamido)ethyl]phenyl]-amino-methylene]amino] acetate

[000495] To a magnetically stirred solution of N-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]acetamide (0.376 g, 0.662 mmol, 1.0 eq) in acetic acid (8.0 mL) was added acetic anhydride (0.19 mL, 2.01 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.172 g, 0.206 mmol, 31% yield).

[000496] ¹ H NMR (400 MHz, DMSO) 5 8.87 (s, 1H), 7.97 - 7.89 (m, 1H), 7.78 (dd, J = 8.9, 2.9 Hz, 1H), 7.63 - 7.56 (m, 2H), 7.50 - 7.46 (m, 2H), 7.43 - 7.32 (m, 1H), 7.30 - 7.04 (m, 5H), 6.73 (s, 2H), 5.00 - 4.83 (m, 1H), 4.05 (t, J = 6.3 Hz, 2H), 3.30 - 3.26 (m, 1H), 3.21 (q, J = 6.7 Hz, 2H), 3.00 (dd, J = 13.8, 9.4 Hz, 1H), 2.15 (s, 3H), 1.92 - 1.83 (m, 2H), 1.81 (s, 3H). UPLC- MS (basic 2 min): Rt = 0.93 min; m/z = 610.1 for [M+H] ⁺

[000497] Step 7: N-[3-[[2-[l-(benzenesulfonamido)-2-(3-carbamimidoylphenyl)et hyl]-l,3- benzothiazol-6-yl] oxy] propyl] acetamide

[000498] To a magnetically stirred solution of [[[3-[2-[6-(3-acetamidopropoxy)-l,3- benzothiazol-2-yl]-2-(benzenesulfonamido)ethyl]phenyl]-amino -methylene]amino] acetate (0.172 g, 0.282 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.369 g, 5.64 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by

Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % HiChMeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.086 g, 0.154 mmol, 55% yield).

[000499] ¹ H NMR (400 MHz, DMSO) 5 7.95 - 7.88 (m, 1H), 7.74 (d, J = 8.9 Hz, 1H), 7.68 - 7.58 (m, 1H), 7.58 - 7.44 (m, 4H), 7.39 - 7.09 (m, 6H), 7.03 (d, J =8.8 Hz, 1H), 4.91 - 4.76 (m, 1H), 4.03 (t, J = 6.1 Hz, 2H), 3.22 - 3.19 (m, 2H), 3.04 - 2.97 (m, 1H), 1.92 - 1.83 (m, 2H), 1.81 (s, 3H). amidine protons not observed; 1H under H ₂ O peak. UPLC-MS (basic 4 min): Rt = 1.01 min; m/z = 552.2 for [M+H] ⁺ , 99% purity. Chiral analysis performed by Reach indicated 50.2% chiral purity.

[000500] Product purified by SFC using Lux Cl (21 ,2mm x 250mm, 5um) with a 40:60 MeOH:CO2 (0.2% v/v NH3) eluent to afford product as a white solid (0.005 g). UPLC-MS (basic 4 min): Rt = 1.01 min; m/z = 552.2 for [M+H]+, 100% purity. Chiral analysis performed by Reach Separations showed 99.8% chiral purity. Rt = 1.559 min.

Example 20: Exemplary synthesis of Compound 213

[000501] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000502] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.20 mmol, 1.0 eq.) in DCM (60.0 mL) was added tribromoborane (2.2 mL, 13 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness to afford product as a light brown solid (1.7 g, 3.90 mmol, 121% yield) which was used in the next step without further purification.

[000503] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 434.0 for [M-H] ⁺

[000504] Step 2: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl]oxy]propyl]carbamate

[000505] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.40 mmol, 1.0 eq.) in DMF (35 ml) was added sodium hydride 60% in mineral oil (0.480 g, 12.1 mmol, 3.5 eq.) and the reaction mixture was stirred at RT for 15 min. 3-(Boc-amino)propyl bromide (1.23 g, 5.17 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with water (300 mL) and then extracted with EtOAc (3 x 100 mb). The combined organic phase was washed with brine, dried over anhydrous sodium sulfate and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (1.27 g, 2.14 mmol, 62% yield).

[000506] ¹ H NMR (400 MHz, DMSO) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 593.1 for [M+H] ⁺

[000507] Step 3: N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2-yl]-2-(3- cyanophenyl)ethyl]benzenesulfonamide; hydrochloride

[000508] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3 -cyanophenyl) ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]carbamate (0.800 g, 1.35 mmol, 1.0 eq.) in Et20 (14 mL) was added 4M HC1 solution in dioxane (6.7 mL, 27.0 mmol, 20.0 eq.) and the reaction mixture was stirred at RT for 18 h. The resulting precipitate was filtered and the solid washed with ether (50 mL) to afford product as a beige solid (0.702 g, 1.33 mmol, 98% yield) which was used in the next step without further purification.

[000509] ¹ H NMR (400 MHz, DMSO) 5 8.92 (d, J = 8.3 Hz, 1H), 7.97 (s, 3H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 (t, J = 1.7 Hz, 1H), 7.50 (dq, J = 8.0, 1.7 Hz, 2H), 7.43 (tt, J = 8.6, 1.3 Hz, 3H), 7.33 - 7.24 (m, 3H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 4.95 (ddd, J = 10.3, 8.3, 4.7 Hz, 1H), 4.13 (t, J = 6.1 Hz, 2H), 3.39 - 3.31 (m, 1H), 3.03 - 2.91 (m, 2H), 2.11 - 1.99 (m, 2H). UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 493.1 for [M] ⁺ as the free base

[000510] Step 4: N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl] oxy] propyl] acetamide

[000511] To a magnetically stirred solution of N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2- yl]-2-(3-cyanophenyl)ethyl]benzenesulfonamide; hydrochloride (0.350 g, 0.662 mmol, 1.0 eq.) in DCM (10 mL) were added triethylamine (0.10 mL, 0.744 mmol, 1.12 eq.) and N- methylaminoformyl chloride (0.062 g, 0.662 mmol, 1.0 eq.) at 0 °C. The reaction mixture was allowed to warm to RT and stirred for 1 h. The reaction mixture was concentrated to dryness to afford product as a brown gum (0.321 g, 0.584 mmol, 88% yield) which was used in the next step without further purification.

[000512] ¹ H NMR (400 MHz, DMSO) 5 8.91 (d, J = 8.5 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.65 - 7.56 (m, 2H), 7.55 - 7.39 (m, 5H), 7.34 - 7.25 (m, 3H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 6.01 (t, J = 5.8 Hz, 1H), 5.74 (d, J = 4.7 Hz, 1H), 4.96 (t, J = 11.3 Hz, 1H), 4.05 (t, J = 6.3 Hz, 2H), 3.21 - 3.12 (m, 2H), 3.00 (dd, J = 13.8, 10.3 Hz, 1H), 2.54 (d, J = 4.7 Hz, 3H), 1.85 (p, J = 6.5 Hz, 2H). UPLC-MS (basic 2 mm) Rt = 1.01 mm. m/z = 550.0 for [M] ⁺

[000513] Step 5: l-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]-3-methyl-urea

[000514] To a magnetically stirred solution of l-[3-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]-3-methy l-urea (0.364 g, 0.662 mmol, 1.0 eq.) in EtOH (10 mL) were added hydroxylamine hydrochloride (0.114 g, 1.64 mmol, 2.5 eq.) and DIPEA (0.36 mL, 2.09 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a dark brown glass (0.337 g, 0.578 mmol, 87% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.90 min. m/z = 583.3 for [M+H] ⁺

[000515] Step 6: [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3- (methylcarbamoylamino)propoxy]-l,3-benzothiazol-2-yl]ethyl]p henyl]methylene]amino] acetate

[000516] To a magnetically stirred solution of l-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]-3-methyl-urea (0.386 g, 0.662 mmol, 1.0 eq) in acetic acid (8.0 mL) was added acetic anhydride (0.19 mL, 2.01 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.136 g, 0.163 mmol, 25% yield).

[000517] ¹ H NMR (400 MHz, DMSO) 5 8.87 (s, 1H), 7.78 (dd, J = 8.9, 3.9 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.49 - 7.45 (m, 2H), 7.38 (t, J = 7.4 Hz, 1H), 7.31 - 7.01 (m, 6H), 6.73 (s, 2H), 5.97 (t, J = 5.6 Hz, 1H), 5.75 - 5.68 (m, 1H), 4.96 - 4.86 (m, 1H), 4.04 (t, J = 6.3 Hz, 2H), 3.29 - 3.24 (m, 1H), 3.16 (q, J = 6.6 Hz, 2H), 2.99 (dd, J = 13.9, 9.3 Hz, 1H), 2.54 (d, J = 4.7 Hz, 3H), 2.15 (s, 3H), 1.88 - 1.82 (m, 2H). UPLC-MS (basic 2 mm): Rt = 0.92 mm; m/z = 625.1 for [M+H] ⁺

[000518] Step 7: l-[3-[[2-[l-(benzenesulfonamido)-2-(3-carbamimidoylphenyl)et hyl]-l,3- benzothiazol-6-yl]oxy]propyl]-3-methyl-urea

[000519] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3- (methylcarbamoylamino)propoxy]-l,3-benzothiazol-2-yl]ethyl]p henyl]methylene]amino] acetate

(0.136 g, 0.218 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.285 g, 4.35 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.065 g, 0.112 mmol, 51% yield).

[000520] ¹ H NMR (400 MHz, DMSO) 5 7.74 (d, J = 8.9 Hz, 1H), 7.66 - 7.60 (m, 1H), 7.56 - 7.53 (m, 1H), 7.51 - 7.45 (m, 3H), 7.35 - 7.28 (m, 1H), 7.28 - 7.08 (m, 5H), 7.04 (dd, J = 8.9, 2.4 Hz, 1H), 6.01 - 5.93 (m, 1H), 5.75 - 5.68 (m, 1H), 4.87 - 4.79 (m, 1H), 4.03 (t, J = 6.2 Hz, 2H), 3.17 - 3.13 (m, 2H), 3.03 - 2.97 (m, 1H), 2.54 (d, J = 4.7 Hz, 3H), 1.89 - 1.80 (m, 2H). amidine protons not observed; 1H under H ₂ O peak. UPLC-MS (basic 4 min): Rt = 1.00 min; m/z = 567.2 for [M+H] ⁺ , 98% purity. Chiral analysis performed by Reach indicated 50.0% chiral purity.

Example 21: Exemplary synthesis of Compound 213

[000521] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000522] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.20 mmol, 1.0 eq.) in DCM (60.0 mL) was added tribromoborane (2.2 mL, 13 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness to afford product as a light brown solid (1.7 g, 3.90 mmol, 121% yield) which was used in the next step without further purification.

[000523] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H).UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 434.0 for [M-H] ⁺

[000524] Step 2: tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl]oxy]propyl]carbamate

[000525] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.40 mmol, 1.0 eq.) in DMF (35 ml) was added sodium hydride 60% in mineral oil (0.480 g, 12.1 mmol, 3.5 eq.) and the reaction mixture was stirred at RT for 15 min. 3-(Boc-amino)propyl bromide (1.23 g, 5.17 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with water (300 mL) and then extracted with EtOAc (3 x 100 mb). The combined organic phase was washed with brine, dried over anhydrous sodium sulfate and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (1.27 g, 2.14 mmol, 62% yield).

[000526] ¹ H NMR (400 MHz, DMSO) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 593.1 for [M+H] ⁺

[000527] Step 3: N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2-yl]-2-(3- cyanophenyl)ethyl]benzenesulfonamide; hydrochloride

[000528] To a magnetically stirred solution of tert-butyl N-[3-[[2-[l-(benzenesulfonamido)-2- (3 -cyanophenyl) ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]carbamate (0.800 g, 1.35 mmol, 1.0 eq.) in Et20 (14 mL) was added 4M HC1 solution in dioxane (6.7 mL, 27.0 mmol, 20.0 eq.) and the reaction mixture was stirred at RT for 18 h. The resulting precipitate was filtered and the solid washed with ether (50 mL) to afford product as a beige solid (0.702 g, 1.33 mmol, 98% yield) which was used in the next step without further purification.

[000529] ¹ H NMR (400 MHz, DMSO) 5 8.92 (d, J = 8.3 Hz, 1H), 7.97 (s, 3H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 (t, J = 1.7 Hz, 1H), 7.50 (dq, J = 8.0, 1.7 Hz, 2H), 7.43 (tt, J = 8.6, 1.3 Hz, 3H), 7.33 - 7.24 (m, 3H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 4.95 (ddd, J = 10.3, 8.3, 4.7 Hz, 1H), 4.13 (t, J = 6.1 Hz, 2H), 3.39 - 3.31 (m, 1H), 3.03 - 2.91 (m, 2H), 2.11 - 1.99 (m, 2H). UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 493.1 for [M] ⁺ as the free base

[000530] Step 4: N-[3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3 - benzothiazol-6-yl] oxy] propyl] acetamide

[000531] To a magnetically stirred solution of N-[l-[6-(3-aminopropoxy)-l,3-benzothiazol-2- yl]-2-(3-cyanophenyl)ethyl]benzenesulfonamide; hydrochloride (0.350 g, 0.662 mmol, 1.0 eq.) in DCM (10 mL) were added triethylamine (0.10 mL, 0.744 mmol, 1.12 eq.) and N- methylaminoformyl chloride (0.062 g, 0.662 mmol, 1.0 eq.) at 0 °C. The reaction mixture was allowed to warm to RT and stirred for 1 h. The reaction mixture was concentrated to dryness to afford product as a brown gum (0.321 g, 0.584 mmol, 88% yield) which was used in the next step without further purification.

[000532] ¹ H NMR (400 MHz, DMSO) 5 8.91 (d, J = 8.5 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.65 - 7.56 (m, 2H), 7.55 - 7.39 (m, 5H), 7.34 - 7.25 (m, 3H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 6.01 (t, J = 5.8 Hz, 1H), 5.74 (d, J = 4.7 Hz, 1H), 4.96 (t, J = 11.3 Hz, 1H), 4.05 (t, J = 6.3 Hz, 2H), 3.21 - 3.12 (m, 2H), 3.00 (dd, J = 13.8, 10.3 Hz, 1H), 2.54 (d, J = 4.7 Hz, 3H), 1.85 (p, J = 6.5 Hz, 2H). UPLC-MS (basic 2 mm) Rt = 1.01 mm. m/z = 550.0 for [M] ⁺

[000533] Step 5: l-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]-3-methyl-urea

[000534] To a magnetically stirred solution of l-[3-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]propyl]-3-methy l-urea (0.364 g, 0.662 mmol, 1.0 eq.) in EtOH (10 mL) were added hydroxylamine hydrochloride (0.114 g, 1.64 mmol, 2.5 eq.) and DIPEA (0.36 mL, 2.09 mmol, 3.2 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a dark brown glass (0.337 g, 0.578 mmol, 87% yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.90 min. m/z = 583.3 for [M+H] ⁺

[000535] Step 6: [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3- (methylcarbamoylamino)propoxy]-l,3-benzothiazol-2-yl]ethyl]p henyl]methylene]amino] acetate

[000536] To a magnetically stirred solution of l-[3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]propyl]-3-methyl-urea (0.386 g, 0.662 mmol, 1.0 eq) in acetic acid (8.0 mL) was added acetic anhydride (0.19 mL, 2.01 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 60 mins. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a white solid (0.136 g, 0.163 mmol, 25% yield).

[000537] ¹ H NMR (400 MHz, DMSO) 5 8.87 (s, 1H), 7.78 (dd, J = 8.9, 3.9 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.49 - 7.45 (m, 2H), 7.38 (t, J = 7.4 Hz, 1H), 7.31 - 7.01 (m, 6H), 6.73 (s, 2H), 5.97 (t, J = 5.6 Hz, 1H), 5.75 - 5.68 (m, 1H), 4.96 - 4.86 (m, 1H), 4.04 (t, J = 6.3 Hz, 2H), 3.29 - 3.24 (m, 1H), 3.16 (q, J = 6.6 Hz, 2H), 2.99 (dd, J = 13.9, 9.3 Hz, 1H), 2.54 (d, J = 4.7 Hz, 3H), 2.15 (s, 3H), 1.88 - 1.82 (m, 2H). UPLC-MS (basic 2 mm): Rt = 0.92 mm; m/z = 625.1 for [M+H] ⁺

[000538] Step 7: l-[3-[[2-[l-(benzenesulfonamido)-2-(3-carbamimidoylphenyl)et hyl]-l,3- benzothiazol-6-yl]oxy]propyl]-3-methyl-urea

[000539] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3- (methylcarbamoylamino)propoxy]-l,3-benzothiazol-2-yl]ethyl]p henyl]methylene]amino] acetate

(0.136 g, 0.218 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.285 g, 4.35 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography on a 120 g C18 cartridge eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford the product as a white solid. (0.065 g, 0.112 mmol, 51% yield).

[000540] ¹ H NMR (400 MHz, DMSO) 5 7.74 (d, J = 8.9 Hz, 1H), 7.66 - 7.60 (m, 1H), 7.56 -

7.53 (m, 1H), 7.51 - 7.45 (m, 3H), 7.35 - 7.28 (m, 1H), 7.28 - 7.08 (m, 5H), 7.04 (dd, J = 8.9, 2.4 Hz, 1H), 6.01 - 5.93 (m, 1H), 5.75 - 5.68 (m, 1H), 4.87 - 4.79 (m, 1H), 4.03 (t, J = 6.2 Hz, 2H), 3.17 - 3.13 (m, 2H), 3.03 - 2.97 (m, 1H), 2.54 (d, J = 4.7 Hz, 3H), 1.89 - 1.80 (m, 2H). amidine protons not observed; 1H under H ₂ O peak. UPLC-MS (basic 4 min): Rt = 1.00 min; m/z = 567.2 for [M+H] ⁺ , 98% purity. Chiral analysis performed by Reach indicated 50.0% chiral purity. Product purified by SFC using Lux Cl (21.2mm x 250mm, 5um) with a 40:60 MeOH:CO2 (0.2% v/v NH3) eluent to afford product as a white solid (0.003 g).

[000541] ¹ H NMR (400 MHz, DMSO) 5 7.74 (d, J = 8.9 Hz, 1H), 7.65 (s, 1H), 7.54 (d, J = 2.4 Hz, 1H), 7.48 (dd, J = 17.1, 7.5 Hz, 3H), 7.31 (t, J = 7.3 Hz, 1H), 7.27 - 7.06 (m, 5H), 7.03 (dd, J = 8.9, 2.5 Hz, 1H), 6.02 - 5.91 (m, 1H), 5.78 - 5.67 (m, 1H), 4.80 (dd, J = 8.5, 5.2 Hz, 1H), 4.02 (t, J = 6.2 Hz, 2H), 3.22 (d, J = 8.7 Hz, 1H), 3.18 - 3.13 (m, 2H), 3.00 (dd, J = 13.4, 8.8 Hz, 1H),

2.54 (d, J = 4.7 Hz, 3H), 1.88 - 1.81 (m, 2H). amidine protons not observed. UPLC-MS (basic 4 min): Rt = 1.00 min; m/z = 567.2 for [M+H]+, 99% purity. Chiral analysis performed by Reach Separations showed 98.9% chiral purity. Rt = 2.181 min.

Example 22: Exemplary synthesis of Compound 215

[000542] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000543] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (1.50 g, 3.20 mmol, 1.0 eq.) in DCM (60.0 mL) was added tribromoborane (2.2 mL, 13 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness to afford product as a light brown solid (1.7 g, 3.90 mmol, assumed quantitative yield) which was used in the next step without further purification.

[000544] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32

(m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 434.0 for [M-H] ⁺

[000545] Step 2: tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3- benzothiazol-6-yl]oxymethyl]azetidine-1-carboxylate

[000546] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.347 g, 0.797 mmol, 1.0 eq.) in anhydrous NMP (7 ml), under nitrogen, was added sodium hydride 60% in mineral oil (82.0 mg, 2.05 mmol, 2.6 eq.) and the reaction mixture was stirred at RT for 15 min. l-Boc-3-(iodomethyl)azetidine (0.347 g, 1.17 mmol, 1.47 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction was re-dosed with sodium hydride 60% in mineral oil (45.0 mg, 1.13 mmol, 1.41 eq.) and l-Boc-3-(iodomethyl)azetidine (0.170 g, 0.572 mmol, 0.718 eq.) before being stirred, at 60 °C, for a further 24 h. The reaction mixture was quenched with methanol (1 mL) and was purified by Reverse Phase column chromatography eluting with a 5-95 % MeCN:H ₂ O eluent (0.1 % ammonia) to afford product as a pale brown solid (0.226 g, 0.374 mmol, 47% yield).

[000547] 1H NMR (400 MHz, DMSO-d6) 5 8.90 (s, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.65 (d, J =

2.4 Hz, 1H), 7.57 (s, 1H), 7.50 (t, J = 8.0 Hz, 2H), 7.45 (d, J = 7.9 Hz, 2H), 7.40 (d, J = 7.4 Hz, 1H), 7.28 (td, J = 7.8, 3.0 Hz, 3H), 7.09 (dd, J = 8.8, 2.4 Hz, 1H), 4.93 (s, 1H), 4.40 (s, 1H), 4.18 (d, J = 6.5 Hz, 2H), 3.98 (s, 2H), 3.68 (d, J = 8.5 Hz, 2H), 2.99 (dd, J = 13.8, 9.5 Hz, 2H), 1.39 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.23 mm. m/z = 549.0 for [M+H] ⁺

[000548] Step 3: tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy methyl]azetidine-1-carboxylate

[000549] To a magnetically stirred solution of tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxymethyl]azetidine -l-carboxylate (0.226 g, 0.374 mmol, 1.0 eq.) in EtOH (6 mL) were added hydroxylamine hydrochloride (65.0 mg, 0.935 mmol,

2.5 eq.) and DIPEA (0.20 mL, 1.15 mmol, 3.07 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown glass (0.273 g, 0.428 mmol, assumed quantitative yield) which was used in the next step without further purification. UPLC-MS (acidic 2 min) Rt = 1.05 min. m/z = 638.2 for [M+H] ⁺

[000550] Step 4: tert-butyl 3-[[2-[2-[3-(N'-acetoxycarbamimidoyl)phenyl]-l- (benzenesulfonamido)ethyl]-l,3-benzothiazol-6-yl]oxymethyl]a zetidine-1-carboxylate

[000551] To a magnetically stirred solution of tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-[3- (N'-hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl ]oxymethyl]azetidine-l- carboxylate (0.273 g, 0.428 mmol, 1.0 eq) in acetic acid (6.0 mb) was added acetic anhydride (0.12 mL, 1.27 mmol, 2.97 eq.) and the resulting mixture was stirred at RT for 1 h. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a pale brown solid (0.119 g, 0.175 mmol, 41% yield).

[000552] 1H NMR (400 MHz, DMSO-d6) 5 8.86 (s, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.63 (d, J = 2.5 Hz, 1H), 7.57 (s, 1H), 7.46 (t, J = 6.6 Hz, 3H), 7.38 (t, J = 7.4 Hz, 1H), 7.26 (t, J = 7.7 Hz, 2H), 7.20 (d, J = 7.8 Hz, 1H), 7.12 (t, J = 7.8 Hz, 1H), 7.10 - 7.04 (m, 1H), 6.72 (s, 2H), 4.92 (t, J = 7.6 Hz, 1H), 4.17 (d, J = 6.5 Hz, 2H), 3.98 (t, J = 8.3 Hz, 2H), 3.68 (t, J = 7.0 Hz, 2H), 3.27 (d, J = 5.5 Hz, 1H), 2.98 (dt, J = 15.4, 7.8 Hz, 2H), 2.15 (s, 3H), 1.39 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.15 min; m/z = 680.2 for [M+H] ⁺

[000553] Step 5 : tert-butyl 3 - [ [2- [ 1 -(benzenesulfonamido)-2-(3 -carbamimidoylpheny 1) ethyl ] - 1 ,3-benzothiazol-6-yl] oxymethyl]azetidine-1-carboxylate

[000554] To a magnetically stirred solution of tert-butyl 3-[[2-[2-[3-(N'- acetoxy carbamimidoyl)phenyl] -1-(benzenesulfonamido)ethy 1] - 1 ,3 -benzothiazol-6- yl]oxymethyl] azetidine-1-carboxylate (0.119 g, 0.175 mmol, 1.0 eq) in acetic acid (3.0 mL) was added zinc (0.589 g, 9.01 mmol, 51.5 eq.). The reaction mixture was stirred at room temperature for 24 h. The reaction mixture was filtered through a plug of celite, washing with copious ethanol, dichloromethane and acetonitrile, and then concentrated to dryness to afford product as an off-white solid (50.0 mg, 0.0804 mmol, 46% yield) which was used in the next step without further purification. UPLC-MS (acidic 6 min): Rt = 3.00 min; m/z = 622.1 for [M+H] ⁺

[000555] Step 6: 3-[2-[6-(azetidin-3-ylmethoxy)-l,3-benzothiazol-2-yl]-2- (benzenesulfonamido)ethyl]benzamidine

[000556] To a magnetically stirred solution of 4 M HC1 in dioxane (1.0 mL, 4.00 mmol, 49.7 eq.) and diethyl ether (2 mL) was added tert-butyl 3-[[2-[l-(benzenesulfonamido)-2-(3- carbamimidoylphenyl)ethyl]-l,3-benzothiazol-6-yl]oxymethyl]a zetidine-1-carboxylate (50.0 mg, 0.0804 mmol, 1.0 eq). The reaction mixture was stirred at room temperature for 24 h. The precipitate was concentrated to dryness and the residue was purified by reverse phase preparative-HPLC eluting with a 20-100 % H ₂ O:MeCN eluent (0.05 % TFA), followed by a re- purification by reverse phase preparative-HPLC with a 20-100% MeCN:H ₂ O eluent (10 mM ammonium bicarbonate + 0.1% ammonia), to afford product as a white solid (7.4 mg, 0.0142 mmol, 18% yield).

[000557] 1H NMR (400 MHz, DMSO-d6) 5 7.83 (d, J = 8.9 Hz, 1H), 7.69 (d, J = 6.3 Hz, 2H), 7.56 (d, J = 7.9 Hz, 1H), 7.46 (d, J = 7.7 Hz, 3H), 7.39 (t, J = 7.5 Hz, 1H), 7.27 (dt, J = 15.7, 7.7 Hz, 3H), 7.15 (d, J = 8.9 Hz, 1H), 5.01 (dd, J = 9.9, 4.8 Hz, 1H), 4.19 (d, J = 5.8 Hz, 2H), 4.07 (s, 2H), 3.85 (s, 2H), 3.37 (dd, J = 13.9, 4.9 Hz, 1H), 3.24 (s, 1H), 3.03 (dd, J = 13.9, 10.0 Hz, 1H) - 5H unobserved. UPLC-MS (basic 2.4 min): Rt = 0.85 min; m/z = 522.2 for [M+H] ⁺ (as the free base), 97% purity

Example 23: Exemplary synthesis of Compound 216

[000558] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000559] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.880 g, 1.96 mmol, 1.0 eq.) in DCM (20.0 mb) was added tribromoborane (8.0 mL, 800 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % HiChMeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.301 g, 0.691 mmol, 35% yield).

[000560] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 434.0 for [M-H] ⁺

[000561] Step 2: Ethyl 4-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3- benzothiazol-6-yl]oxy]butanoate

[000562] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.415 g, 0.953 mmol, 1.0 eq.) in anhydrous NMP (8 mL), under nitrogen, was added sodium hydride 60% in mineral oil (0.105 g, 2.63 mmol, 2.75 eq.) and the reaction mixture was stirred at RT for 15 min. Ethyl-4-iodobutanoate (0.363 g, 1.50 mmol, 1.57 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with MeOH (1 mL) and purified by Reverse Phase column chromatography eluting with a 5-95 % MeCN:H ₂ O eluent (0.1 % ammonia) to afford product as a pale brown solid (0.217 g, 0.395 mmol, 41% yield).

[000563] 1H NMR (400 MHz, DMSO-d6) 5 8.89 (s, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.60 (s, 1H), 7.55 (s, 1H), 7.53 - 7.42 (m, 4H), 7.38 (d, J = 7.1 Hz, 1H), 7.27 (q, J = 7.0 Hz, 3H), 7.05 (d, J = 9.0 Hz, 1H), 4.88 (s, 1H), 4.06 (h, J = 6.7 Hz, 4H), 2.99 (dd, J = 13.7, 9.7 Hz, 1H), 2.39 - 2.25 (m, 1H), 2.00 (p, J = 6.9 Hz, 2H), 1.93 - 1.59 (m, 1H), 1.18 (t, J = 7.2 Hz, 3H) - 1H unobserved. UPLC-MS (basic 2 min) Rt = 1.21 min. m/z = 550.1 for [M+H] ⁺

[000564] Step 3: 4-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3-be nzothiazol-6- yl] oxy] butanoic acid

[000565] To a magnetically stirred mixture of ethyl 4-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]butanoate (0.217 g, 0.395 mmol, 0.844 eq.) and lithium hydroxide (0.100 g, 2.38 mmol, 5.10 eq.) in THF (3 mL) and water (3 ml) was added ethyl 4- [ [2- [ 1 -(benzenes ulfonamido)-2-(3 -cyanophenyl) ethyl] - 1 ,3 -benzothiazol-6- yl]oxy]butanoate (40.0 mg, 0.0728 mmol, 0.156 eq.). The resulting mixture was stirred at RT for 24 h before being acidified with 1 M HC1 (25 mL). The precipitate that formed was collected by filtration, washed with copious water and dried in vacuo to afford product as a pale brown solid (0.149 g, 0.286 mmol, 61% yield).

[000566] 1H NMR (400 MHz, DMSO-d6) 5 12.15 (s, 1H), 8.89 (d, J = 8.4 Hz, 1H), 7.80 (d, J = 9.0 Hz, 1H), 7.66 - 7.56 (m, 2H), 7.51 (dt, J = 8.0, 1.9 Hz, 2H), 7.47 - 7.39 (m, 3H), 7.29 (td, J = 7.8, 3.2 Hz, 3H), 7.12 - 7.03 (m, 1H), 5.01 - 4.91 (m, 1H), 4.07 (dt, J = 17.9, 6.7 Hz, 2H), 3.37 (d, J = 4.9 Hz, 1H), 2.99 (dd, J = 13.9, 10.4 Hz, 1H), 2.41 (t, J = 7.3 Hz, 2H), 1.98 (p, J = 6.9 Hz, 2H). UPLC-MS (basic 2 mm) Rt = 1.06 mm. m/z = 520.1 for [M+H] ⁺

[000567] Step 4: 4-[[2-[l-(benzenesulfonamido)-2-(3-cyanophenyl)ethyl]-l,3-be nzothiazol-6- yl] oxy]butanamide

[000568] To a magnetically stirred mixture of 4-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]butanoic acid (0.149 g, 0.286 mmol, 1.00 eq.) in DCM (3 mL) was added cone, ammonia (0.10 mL, 1.80 mmol, 6.30 eq.) followed by DIPEA (0.13 mL, 0.746 mmol, 2.61 eq.) and then benzotriazol- 1-yloxy- tris(dimethylamino)phosphonium;hexafluorophosphate (0.149 g, 0.337 mmol, 1.18 eq.). The resulting mixture was stirred at RT for 1 h before being concentrated to dryness. The residue was purified by Reverse Phase column chromatography eluting with a 5-95 % MeCN:H ₂ O eluent (0.1 % ammonia) to afford product as an off-white solid (0.105 g, 0.202 mmol, 71% yield).

[000569] 1H NMR (400 MHz, DMSO-d6) 5 8.89 (s, 1H), 7.79 (d, J = 8.9 Hz, 1H), 7.65 - 7.55 (m, 2H), 7.51 (dd, J = 7.9, 4.2 Hz, 2H), 7.47 - 7.39 (m, 3H), 7.38 - 7.21 (m, 4H), 7.08 (dd, J = 8.9, 2.5 Hz, 1H), 6.78 (s, 1H), 4.95 (dd, J = 10.5, 4.6 Hz, 1H), 4.03 (t, J = 6.5 Hz, 2H), 3.39 - 3.33 (m, 1H), 2.99 (dd, J = 13.8, 10.4 Hz, 1H), 2.25 (t, J = 7.4 Hz, 2H), 1.95 (p, J = 6.8 Hz, 2H). UPLC-MS (basic 2 mm) Rt = 0.99 mm. m/z = 521.1 for [M+H] ⁺

[000570] Step 5: 4-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]butanamide

[000571] To a magnetically stirred solution of 4-[[2-[l-(benzenesulfonamido)-2-(3- cyanophenyl)ethyl]-l,3-benzothiazol-6-yl]oxy]butanamide (0.105 g, 0.202 mmol, 1.0 eq.) in EtOH (3 mb) were added hydroxylamine hydrochloride (0.035 g, 0.504 mmol, 2.5 eq.) and DIPEA (0.10 mL, 0.574 mmol, 2.85 eq.). The reaction mixture was stirred under reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown glass (0.150 g, 0.271 mmol, assumed quantitative yield) which was used in the next step without further purification. UPLC-MS (acidic 2 min) Rt = 0.82 min. m/z = 554.0 for [M+H] ⁺

[000572] Step 6: [[amino-[3-[2-[6-(4-amino-4-oxo-butoxy)-l,3-benzothiazol-2-y l]-2- (benzenesulfonamido)ethyl]phenyl]methylene]amino] acetate

[000573] To a magnetically stirred solution of 4-[[2-[l-(benzenesulfonamido)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]-l,3-benzothiazol-6-yl]oxy ]butanamide (0.150 g, 0.271 mmol, 1.0 eq) in acetic acid (4.0 mL) was added acetic anhydride (0.080 mL, 0.846 mmol, 3.12 eq.) and the resulting mixture was stirred at RT for 1 h. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5- 95 % H ₂ O:MeCN eluent (0.1 % formic acid) to afford product as a pale brown solid (0.081 g, 0.136 mmol, 50% yield).

[000574] 1H NMR (400 MHz, DMSO-d6) 5 8.85 (s, 1H), 7.78 (dd, J = 8.9, 4.8 Hz, 1H), 7.63 - 7.55 (m, 2H), 7.51 - 7.31 (m, 5H), 7.31 - 7.00 (m, 6H), 6.78 (s, 1H), 6.72 (s, 1H), 4.91 (s, 1H), 4.02 (t, J = 6.4 Hz, 2H), 3.26 (d, J = 5.6 Hz, 1H), 2.99 (dd, J = 13.8, 9.3 Hz, 1H), 2.24 (t, J = 7.4 Hz, 2H), 2.15 (s, 3H), 1.96 (q, J = 6.9 Hz, 2H). UPLC-MS (basic 2 mm): Rt = 0.91 mm; m/z = 596.1 for [M+H] ⁺

[000575] Step 7: 4-[[2-[l-(benzenesulfonamido)-2-(3-carbamimidoylphenyl)ethyl ]-l,3- benzothiazol-6-yl]oxy]butanamide

[000576] To a magnetically stirred solution of [[amino-[3-[2-[6-(4-amino-4-oxo-butoxy)-l,3- benzothiazol-2-yl]-2-(benzenesulfonamido)ethyl]phenyl]methyl ene]amino] acetate (0.081 g, 0.136 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.473 g, 7.23 mmol, 53.2 eq.). The reaction mixture was stirred at room temperature for 24h. The reaction mixture was filtered through a plug of celite, washing with copious DCM, ethanol and acetonitrile, and then concentrated to dryness. The residue was purified by Reverse Phase preparative HPLC eluting with a 15-100% H ₂ O:MeCN gradient (0.05% TFA) followed by a re-purification via reverse phase preparative HPLC eluting with a 5-100% MeCN:H ₂ O gradient (0.1% NH ₃ ) to afford product as a white solid (13.0 mg, 0.0246 mmol, 18% yield).

[000577] 1H NMR (400 MHz, DMSO-d6) 5 7.72 (d, J = 8.9 Hz, 1H), 7.62 (s, 1H), 7.54 (d, J = 2.5 Hz, 1H), 7.52 - 7.41 (m, 3H), 7.36 - 7.26 (m, 2H), 7.22 (d, J = 7.6 Hz, 3H), 7.15 (t, J = 7.6 Hz, 1H), 7.02 (dd, J = 8.9, 2.5 Hz, 1H), 6.77 (s, 1H), 4.80 (d, J = 7.5 Hz, 1H), 4.00 (t, J = 6.5 Hz, 2H), 2.99 (dd, J = 13.6, 8.6 Hz, 1H), 2.23 (t, J = 7.4 Hz, 2H), 1.94 (p, J = 7.6 Hz, 2H) - 4H unobserved and 1H obscured by H ₂ O peak. UPLC-MS (basic 6 min): Rt = 1.87 min; m/z = 538.0 for [M-H] ⁺ , 98% purity Chiral analysis performed by Reach Separations showed 50.8% chiral purity.

Example 24: Exemplary synthesis of Compound 103

[000578] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000579] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (0.100 g, 0.344 mmol, 1.0 eq.) in toluene (2.0 mL) were added DIPEA (0.18 mL, 1.03 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (0.059 g, 0.379 mmol, 1.1 eq.) and T3P (0.21 mL, 0.689 mmol, 2.0 eq.). The resulting mixture was stirred at RT for 20 min then at reflux for 2 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (2 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 4 mL), washed with saturated sodium hydrogen carbonate solution (4 mL), washed with brine (4 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography eluting with 0-60% ethyl acetate in heptane to afford product as a brown solid (0.050 g, 0.122 mmol, 35% yield).

[000580] 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 9.0 Hz, 2H), 7.79 (s, 1H), 7.73 - 7.63 (m, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 5.16 - 5.05 (m, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.8, 4.4 Hz, 1H), 3.11 (dd, J = 13.8, 11.0 Hz, 1H), 1.30 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.0 for [M+H] ⁺

[000581] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile

[000582] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (2.90 g, 7.08 mmol, 1.0 eq,) in DCM (29.0 mL) was added trifluoroacetic acid (29.0 mL, 379 mmol, 53.5 eq,) and the reaction mixture was stirred at RT for 20 min. The reaction mixture was concentrated to dryness before being suspended in DCM (25 mL). To this suspension was added K ₂ CO ₃ (6 g) in water (25 mL) and the resulting mixture was vigorously stirred for 20 min. The phases were separated and aqueous was extracted with further DCM (3 x 25 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.99 g, 6.43 mmol, 91% yield) which was used in the next step without further purification.

[000583] 1H NMR (400 MHz, DMSO-d6) 5 7.80 (d, J = 8.9 Hz, 1H), 7.74 (s, 1H), 7.67 (d, J = 7.7 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.06 (dd, J = 8.9, 2.5 Hz, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.5 Hz, 3H), 3.37 (dd, J = 13.5, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 309.9 for [M+H] ⁺

[000584] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000585] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (1.99 g, 6.43 mmol, 1.0 eq,) in DMF (20.0 mL) was added triethylamine (1.3 mL, 9.65 mmol, 1.5 eq,) and the reaction mixture was cooled to 0°C. 3 -nitrobenzene- 1- sulfonyl chloride (1.71 g, 7.72 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 18 h. The reaction mixture was concentrated to dryness and the residue purified by normal phase column chromatography eluting with 10- 100% ethyl acetate in hexane to afford product (2.00 g, 4.04 mmol, 63% yield).

[000586] 1H NMR (400 MHz, DMSO-d6) 5 9.29 (d, J = 8.5 Hz, 1H), 8.20 (d, J = 8.6 Hz, 1H), 8.09 (s, 1H), 7.88 (d, J = 7.8 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.63 (s, 2H), 7.62 - 7.51 (m, 2H), 7.44 (d, J = 7.8 Hz, 1H), 7.25 (t, J = 7.8 Hz, 1H), 7.11 - 7.04 (m, 1H), 5.17 - 5.07 (m, 1H), 3.82 (s, 3H), 3.39 (dd, J = 14.0, 4.7 Hz, 1H), 3.09 - 2.98 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 min. m/z = 494.5 for [M+H] ⁺

[000587] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000588] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (2.00 g, 4.04 mmol, 1.0 eq.) in ethanol (16 mL) and water (8.0 mL) were added iron (2.26 g, 40.4 mmol, 10.0 eq.) and ammonium chloride (1.08 g, 20.2 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH. The filtrate was concentrated to dryness and the residue taken up in DCM (20 mL). The organic layer was washed with aq. saturated NaHCO3 solution (20 mL) and the aqueous was extracted with further DCM (3 x 20 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.61 g, 3.47 mmol, 86% yield) which was used in the next step without further purification.

[000589] 1H NMR (400 MHz, DMSO-d6) 5 8.65 (s, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J =

2.5 Hz, 1H), 7.58 - 7.50 (m, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.8, 2.6 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (s, 1H), 6.59 (d, J = 8.0 Hz, 2H), 5.40 (s, 2H), 4.84 (d, J = 9.0 Hz, 1H), 3.83 (d, J = 1.4 Hz, 3H), 3.35 (d, J = 5.3 Hz, 1H), 2.96 (dd, J = 13.8, 9.6 Hz, 1H). - 1H signal obscured by H ₂ O peak, some residual solvent present (10% wt.). UPLC- MS (basic 2 min) Rt = 1.08 min. m/z = 464.9 for [M+H] ⁺

[000590] Step 5: tert-butyl N-[2-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate

[000591] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.500 g, 1.08 mmol, 1.0 eq.) in DMF (5 mL) were added N-alpha-t-BOC-glycine (0.230 g, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.23 mmol, 3.0 eq.) and HATU (0.620 g, 1.61 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 23 h. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography on a 90 g C18 cartridge eluting with a 5-95 % MeCN:H ₂ O eluent (0.1 % ammonia) to afford the product as a white solid (0.440 g, 0.711 mmol, 66% yield).

[000592] 1H NMR (400 MHz, DMSO-d6) 5 10.05 (s, 1H), 8.00 (d, J = 10.3 Hz, 1H), 7.82 (d, J = 8.9 Hz, 2H), 7.65 (d, J = 2.6 Hz, 1H), 7.54 (d, J = 7.1 Hz, 2H), 7.47 (dd, J = 14.5, 7.7 Hz, 2H), 7.28 (t, J = 7.7 Hz, 1H), 7.22 (t, J = 7.9 Hz, 1H), 7.13 (d, J = 7.9 Hz, 1H), 7.09 (dd, J = 8.9,

2.6 Hz, 2H), 4.87 (dd, J = 10.4, 4.5 Hz, 1H), 3.83 (d, J = 0.8 Hz, 3H), 3.75 (d, J = 6.2 Hz, 2H), 3.37 (d, J = 4.2 Hz, 1H), 3.02 - 2.91 (m, 1H), 1.42 (s, 9H). - 1H obscured by H ₂ O peak. UPLC- MS (basic 2 min) Rt = 1.14 min. m/z = 622.1 for [M+H] ⁺

[000593] Step 6: tert-butyl N-[2-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy - 1 ,3 -benzothiazol-2-yl)ethy 1] sulfamoyl] anilino] -2-oxo-ethyl] carbamate

[000594] To a magnetically stirred solution of tert-butyl N-[2-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo -ethyl]carbamate (0.440 g, 0.711 mmol, 1.0 eq.) in EtOH (10.0 mL) were added hydroxylamine hydrochloride (0.099 g, 1.42 mmol, 2.0 eq.) and DIPEA (0.37 mL, 2.13 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 20 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as an off-white gum (0.720 g, 1.10 mmol, assumed quantitative yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 655.1 for [M+H] ⁺

[000595] Step 7: [[amino-[3-[2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000596] To a magnetically stirred solution of tert-butyl N-[2-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-2- oxo-ethyl] carbamate (0.720 g, 1.10 mmol, 1.0 eq) in acetic acid (15.0 mL) was added acetic anhydride (0.31 mL, 3.29 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 22 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-100% ethyl acetate in hexane to afford product as an off-white glass (0.260 g, 0.366 mmol, 33% yield).

[000597] 1H NMR (400 MHz, DMSO-d6) 5 10.00 (s, 1H), 8.85 (s, 1H), 7.89 (t, J = 1.9 Hz, 1H), 7.78 (dd, J = 8.9, 3.2 Hz, 1H), 7.60 (d, J = 2.5 Hz, 1H), 7.54 (s, 1H), 7.48 (d, J = 7.8 Hz, 1H), 7.43 (dt, J = 7.7, 1.5 Hz, 1H), 7.19 (t, J = 6.4 Hz, 1H), 7.17 - 7.09 (m, 2H), 7.09 - 7.02 (m, 1H), 6.68 (s, 2H), 4.87 (s, 1H), 3.82 (s, 3H), 3.72 (d, J = 6.1 Hz, 2H), 3.26 (s, 1H), 2.98 (dd, J = 13.9, 9.4 Hz, 1H), 2.15 (s, 3H), 1.41 (s, 9H). - 1H obscured by H ₂ O peak UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 697.1 for [M+H] ⁺

[000598] Step 8: tert-butyl N-[2-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carba mate

[000599] To a magnetically stirred solution of [[amino-[3-[2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.260 g, 0.366 mmol, 1.0 eq) in acetic acid (5.0 mL) was added zinc (0.240 g, 3.66 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 20 h. The reaction mixture was filtered, washing with methanol, and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 30-100 % MeCN:H ₂ O eluent (0.05 % TFA) to afford product as a white solid (0.19 g, 0.301 mmol, 82% yield). Product obtained as a mixture of boc-protected and boc-deprotected material (as TFA salt). UPLC-MS (acidic 6 min): Rt = 1.50 min; m/z = 539.0 for [M-Boc] ⁺ , 39% purity. Rt = 1.68 min; m/z = 539.0 for [M-Boc] ⁺ , 34% purity. Rt = 2.60 min; m/z = 639.2 for [M+H] ⁺ , 15% purity.

[000600] Step 9: 2-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethyl]sulfamoyl]phenyl]acetamide; dihydrochloride

[000601] To tert-butyl N-[2-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzoth iazol- 2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate (0.018 g, 0.0282 mmol, 1.00 eq.) was added 4 N HC1 in 1,4-Dioxane solution (2.0 mL, 8.00 mmol, 284 eq.) and the reaction mixture was stirred at RT overnight. The reaction mixture was concentrated to dryness and the residue dried in the vacuum oven overnight to afford product as a white solid. (0.009 g, 0.0147 mmol, 52% yield).

[000602] 1H NMR (400 MHz, DMSO-d6) 5 10.79 (s, 1H), 9.21 (s, 2H), 9.08 (s, 2H), 8.94 (d, J = 8.1 Hz, 1H), 8.25 (s, 3H), 7.90 (t, J = 1.9 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.70 (s, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.58 (d, J = 7.8 Hz, 1H), 7.50 (dt, J = 7.9, 1.7 Hz, 1H), 7.47 (d, J = 7.7 Hz, 1H), 7.29 (t, J = 7.8 Hz, 1H), 7.18 (t, J = 7.8 Hz, 1H), 7.13 (dt, J = 7.8, 1.5 Hz, 1H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 5.02 - 4.91 (m, 1H), 3.83 (s, 3H), 3.42 - 3.34 (m, 1H), 3.03 (dd, J = 13.9, 10.2 Hz, 1H). - aliphatic CH ₂ overlap with H ₂ O peak. UPLC-MS (acidic 6 min): Rt = 1.73 min; m/z = 538.9 for [M] ⁺ , 100% purity

Example 25: Exemplary synthesis of Compound 104

[000603] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000604] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (0.100 g, 0.344 mmol, 1.0 eq.) in toluene (2.0 mL) were added DIPEA (0.18 mL, 1.03 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (0.059 g, 0.379 mmol, 1.1 eq.) and T3P (0.21 mL, 0.689 mmol, 2.0 eq.). The resulting mixture was stirred at RT for 20 min then at reflux for 2 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (2 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 4 mL), washed with saturated sodium hydrogen carbonate solution (4 mL), washed with brine (4 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography eluting with 0-60% ethyl acetate in heptane to afford product as a brown solid (0.050 g, 0.122 mmol, 35% yield).

[000605] 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 9.0 Hz, 2H), 7.79 (s, 1H), 7.73 - 7.63 (m, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 5.16 - 5.05 (m, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.8, 4.4 Hz, 1H), 3.11 (dd, J = 13.8, 11.0 Hz, 1H), 1.30 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.0 for [M+H] ⁺

[000606] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile

[000607] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (2.90 g, 7.08 mmol, 1.0 eq,) in DCM (29.0 mL) was added trifluoroacetic acid (29.0 mL, 379 mmol, 53.5 eq,) and the reaction mixture was stirred at RT for 20 min. The reaction mixture was concentrated to dryness before being suspended in DCM (25 mL). To this suspension was added K ₂ CO ₃ (6 g) in water (25 mL) and the resulting mixture was vigorously stirred for 20 min. The phases were separated and aqueous was extracted with further DCM (3 x 25 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.99 g, 6.43 mmol, 91% yield) which was used in the next step without further purification.

[000608] 1H NMR (400 MHz, DMSO-d6) 5 7.80 (d, J = 8.9 Hz, 1H), 7.74 (s, 1H), 7.67 (d, J = 7.7 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.06 (dd, J = 8.9, 2.5 Hz, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.5 Hz, 3H), 3.37 (dd, J = 13.5, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 309.9 for [M+H] ⁺

[000609] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000610] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (1.99 g, 6.43 mmol, 1.0 eq,) in DMF (20.0 mL) was added triethylamine (1.3 mL, 9.65 mmol, 1.5 eq,) and the reaction mixture was cooled to 0°C. 3 -nitrobenzene- 1- sulfonyl chloride (1.71 g, 7.72 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 18 h. The reaction mixture was concentrated to dryness and the residue purified by normal phase column chromatography eluting with 10- 100% EtOAc in hexane to afford product (2.00 g, 4.04 mmol, 63% yield).

[000611] 1H NMR (400 MHz, DMSO-d6) 5 9.29 (d, J = 8.5 Hz, 1H), 8.20 (d, J = 8.6 Hz, 1H), 8.09 (s, 1H), 7.88 (d, J = 7.8 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.63 (s, 2H), 7.62 - 7.51 (m, 2H), 7.44 (d, J = 7.8 Hz, 1H), 7.25 (t, J = 7.8 Hz, 1H), 7.11 - 7.04 (m, 1H), 5.17 - 5.07 (m, 1H), 3.82 (s, 3H), 3.39 (dd, J = 14.0, 4.7 Hz, 1H), 3.09 - 2.98 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 min. m/z = 494.5 for [M+H] ⁺

[000612] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000613] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (2.00 g, 4.04 mmol, 1.0 eq.) in ethanol (16 mL) and water (8.0 mL) were added iron (2.26 g, 40.4 mmol, 10.0 eq.) and ammonium chloride (1.08 g, 20.2 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH. The filtrate was concentrated to dryness and the residue taken up in DCM (20 mL). The organic layer was washed with aq. saturated NaHCO3 solution (20 mL) and the aqueous was extracted with further DCM (3 x 20 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.61 g, 3.47 mmol, 86% yield) which was used in the next step without further purification.

[000614] 1H NMR (400 MHz, DMSO-d6) 5 8.65 (s, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.5 Hz, 1H), 7.58 - 7.50 (m, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.8, 2.6 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (s, 1H), 6.59 (d, J = 8.0 Hz, 2H), 5.40 (s, 2H), 4.84 (d, J = 9.0 Hz, 1H), 3.83 (d, J = 1.4 Hz, 3H), 3.35 (d, J = 5.3 Hz, 1H), 2.96 (dd, J = 13.8, 9.6 Hz, 1H). - 1H signal obscured by H ₂ O peak, some residual solvent present (10% wt.). UPLC- MS (basic 2 min) Rt = 1.08 min. m/z = 464.9 for [M+H] ⁺

[000615] Step 5: tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[000616] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-

1.3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.500 g, 1.08 mmol, 1.0 eq.) in DMF (5 mL) were added N-Boc-beta-alanine (0.240 g, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.23 mmol, 3.0 eq.) and HATU (0.620 g, 1.61 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 23 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography on a 20 g cartridge eluting with 10-100 % ethyl acetate in iso-hexane to afford the product (0.890 g, 1.12 mmol, assumed quantitative yield).

[000617] 1H NMR (400 MHz, DMSO-d6) 5 10.05 (s, 1H), 8.90 (d, J = 8.3 Hz, 1H), 8.75 (d, J = 4.4 Hz, 1H), 8.52 (d, J = 8.4 Hz, 1H), 7.86 - 7.78 (m, 2H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 - 7.40 (m, 3H), 7.22 (q, J = 8.3 Hz, 2H), 7.15 - 7.05 (m, 2H), 6.88 (s, OH), 4.86 (d, J = 13.2 Hz, 1H), 3.83 (s, 3H), 3.25 (q, J = 6.6 Hz, 1H), 3.01 - 2.91 (m, 1H), 2.68 (s, 5H), 1.38 (s, 11H). - 3H extra. 80% purity by weight due to residual solvent. UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 636.1 for [M+H] ⁺

[000618] Step 6: tert-butyl N-[3-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy -

1.3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-prop yl]carbamate

[000619] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo -propyl]carbamate (0.890 g, 1.12 mmol, 1.0 eq.) in EtOH (18.0 mL) were added hydroxylamine hydrochloride (0.160 g, 2.24 mmol, 2.0 eq.) and DIPEA (0.59 mL, 3.36 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 20 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown oil (1.20 g, 1.79 mmol, assumed quantitative yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 669.2 for [M+H] ⁺

[000620] Step 7: [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-(6-meth oxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate

[000621] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-3- oxo-propyl] carbamate (1.20 g, 1.79 mmol, 1.0 eq) in acetic acid (12.0 mL) was added acetic anhydride (0.51 mL, 5.38 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 74 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 60-100% ethyl acetate in heptane to afford product as a yellow oil (0.430 g, 0.601 mmol, 33% yield).

[000622] 1H NMR (400 MHz, DMSO-d6) 5 9.98 (s, 1H), 8.83 (s, 1H), 7.88 (s, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.71 - 7.57 (m, 1H), 7.55 (t, J = 1.7 Hz, 1H), 7.50 (d, J = 8.0 Hz, 1H), 7.43 (dt, J = 7.7, 1.4 Hz, 1H), 7.25 - 7.01 (m, 5H), 6.88 (d, J = 14.6 Hz, 1H), 6.69 (s, 2H), 4.86 (s, 1H), 3.82 (s, 3H), 3.23 (dq, J = 13.1, 5.9 Hz, 2H), 3.04 - 2.91 (m, 1H), 2.69 (s, 2H), 2.14 (s, 3H), 1.38 (s, 10H). UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 711.2 for [M+H] ⁺

[000623] Step 8: tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carb amate

[000624] To a magnetically stirred solution of [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-(6-meth oxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate (0.430 g, 0.601 mmol, 1.0 eq) in acetic acid (8.0 mL) was added zinc (0.390 g, 6.01 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 17 h. The reaction mixture was filtered, washing with acetonitrile and methanol, and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 20-100 % MeCN:H ₂ O eluent (0.05 % TFA) to afford product as an off-white solid (0.15 g, 0.224 mmol, 37% yield). UPLC-MS (basic 6 min): Rt = 2.88 min; m/z = 653.2 for [M+H] ⁺

[000625] Step 9: 3-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethyl]sulfamoyl]phenyl]propanamide;trihydrochloride

[000626] To a mixture of tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carb amate (0.010 g, 0.0153 mmol, 1.00 eq.) in diethyl ether (1 mL) was added 4 N HC1 in 1,4-Dioxane solution (1.0 mL, 4.00 mmol, 261 eq.) and the reaction mixture was stirred at RT for 3.5 h. The reaction mixture was concentrated to dryness and the residue dried in the vacuum oven overnight to afford product as a white solid. (0.009 g, 0.0133 mmol, 87% yield).

[000627] 1H NMR (400 MHz, DMSO-d6) 5 10.32 (s, 1H), 9.22 (s, 2H), 9.02 (s, 2H), 8.86 (d, J = 8.2 Hz, 1H), 7.90 (t, J = 1.9 Hz, 1H), 7.86 (s, 3H), 7.79 (d, J = 8.9 Hz, 1H), 7.71 (s, 1H), 7.62 (d, J = 2.6 Hz, 1H), 7.56 (d, J = 7.9 Hz, 1H), 7.53 - 7.47 (m, 1H), 7.46 (d, J = 7.6 Hz, 1H), 7.27 (t, J = 7.8 Hz, 1H), 7.17 (t, J = 7.9 Hz, 1H), 7.15 - 7.11 (m, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.01 - 4.91 (m, 1H), 3.83 (s, 3H), 3.41 - 3.31 (m, 1H), 3.13 - 2.99 (m, 3H), 2.74 (t, J = 6.8 Hz, 2H). - 1H overlap with H ₂ O peak, 1H obscured by peak overlap. (N.B. 1 wt.% residual 1,4- dioxane). UPLC-MS (acidic 6 min): Rt = 1.71 min; m/z = 553.0 for [M] ⁺ , 98% purity.

Example 26: Exemplary synthesis of Compound 105

[000628] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000629] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (0.100 g, 0.344 mmol, 1.0 eq.) in toluene (2.0 mL) were added DIPEA (0.18 mL, 1.03 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (0.059 g, 0.379 mmol, 1.1 eq.) and T3P (0.21 mL, 0.689 mmol, 2.0 eq.). The resulting mixture was stirred at RT for 20 min then at reflux for 2 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (2 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 4 mL), washed with saturated sodium hydrogen carbonate solution (4 mL), washed with brine (4 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography eluting with 0-60% ethyl acetate in heptane to afford product as a brown solid (0.050 g, 0.122 mmol, 35% yield).

[000630] 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 9.0 Hz, 2H), 7.79 (s, 1H), 7.73 - 7.63 (m, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 5.16 - 5.05 (m, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.8, 4.4 Hz, 1H), 3.11 (dd, J = 13.8, 11.0 Hz, 1H), 1.30 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.0 for [M+H] ⁺

[000631] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile

[000632] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (2.90 g, 7.08 mmol, 1.0 eq,) in DCM (29.0 mL) was added trifluoroacetic acid (29.0 mL, 379 mmol, 53.5 eq,) and the reaction mixture was stirred at RT for 20 min. The reaction mixture was concentrated to dryness before being suspended in DCM (25 mL). To this suspension was added K ₂ CO ₃ (6 g) in water (25 mL) and the resulting mixture was vigorously stirred for 20 min. The phases were separated and aqueous was extracted with further DCM (3 x 25 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.99 g, 6.43 mmol, 91% yield) which was used in the next step without further purification.

[000633] 1H NMR (400 MHz, DMSO-d6) 5 7.80 (d, J = 8.9 Hz, 1H), 7.74 (s, 1H), 7.67 (d, J = 7.7 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.06 (dd, J = 8.9, 2.5 Hz, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.5 Hz, 3H), 3.37 (dd, J = 13.5, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 309.9 for [M+H] ⁺

[000634] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000635] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (1.99 g, 6.43 mmol, 1.0 eq,) in DMF (20.0 mL) was added triethylamine (1.3 mL, 9.65 mmol, 1.5 eq,) and the reaction mixture was cooled to 0°C. 3 -nitrobenzene- 1- sulfonyl chloride (1.71 g, 7.72 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 18 h. The reaction mixture was concentrated to dryness and the residue purified by normal phase column chromatography eluting with 10- 100% EtOAc in hexane to afford product (2.00 g, 4.04 mmol, 63% yield).

[000636] 1H NMR (400 MHz, DMSO-d6) 5 9.29 (d, J = 8.5 Hz, 1H), 8.20 (d, J = 8.6 Hz, 1H), 8.09 (s, 1H), 7.88 (d, J = 7.8 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.63 (s, 2H), 7.62 - 7.51 (m, 2H), 7.44 (d, J = 7.8 Hz, 1H), 7.25 (t, J = 7.8 Hz, 1H), 7.11 - 7.04 (m, 1H), 5.17 - 5.07 (m, 1H), 3.82 (s, 3H), 3.39 (dd, J = 14.0, 4.7 Hz, 1H), 3.09 - 2.98 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 min. m/z = 494.5 for [M+H] ⁺

[000637] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000638] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (2.00 g, 4.04 mmol, 1.0 eq.) in ethanol (16 mL) and water (8.0 mL) were added iron (2.26 g, 40.4 mmol, 10.0 eq.) and ammonium chloride (1.08 g, 20.2 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH. The filtrate was concentrated to dryness and the residue taken up in DCM (20 mL). The organic layer was washed with aq. saturated NaHCO3 solution (20 mL) and the aqueous was extracted with further DCM (3 x 20 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.61 g, 3.47 mmol, 86% yield) which was used in the next step without further purification.

[000639] 1H NMR (400 MHz, DMSO-d6) 5 8.65 (s, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.5 Hz, 1H), 7.58 - 7.50 (m, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.8, 2.6 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (s, 1H), 6.59 (d, J = 8.0 Hz, 2H), 5.40 (s, 2H),

4.84 (d, J = 9.0 Hz, 1H), 3.83 (d, J = 1.4 Hz, 3H), 3.35 (d, J = 5.3 Hz, 1H), 2.96 (dd, J = 13.8, 9.6 Hz, 1H). - 1H signal obscured by H ₂ O peak, some residual solvent present (10% wt.). UPLC- MS (basic 2 min) Rt = 1.08 min. m/z = 464.9 for [M+H] ⁺

[000640] Step 5: tert-butyl N-[4-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl] sulfamoyl] anilino] -4-oxo-butyl] carbamate

[000641] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-

1.3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.570 g, 1.22 mmol, 1.0 eq.) in DMF (5 mL) were added 4-(tert-butoxycarbonylamino)butanoic acid (0.300 g, 1.46 mmol, 1.2 eq.), DIPEA (0.64 mL, 3.65 mmol, 3.0 eq.) and HATU (0.700 g, 1.82 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 22 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography on a 20 g cartridge eluting with 40-60% ethyl acetate in heptane to afford the product (0.750 g, 1.15 mmol, 95% yield).

[000642] 1H NMR (400 MHz, DMSO-d6) 5 10.00 (s, 1H), 8.89 (d, J = 8.3 Hz, 1H), 8.74 (d, J = 4.4 Hz, 1H), 8.52 (d, J = 8.4 Hz, 1H), 7.81 (d, J = 10.2 Hz, 2H), 7.64 (s, 1H), 7.57 - 7.47 (m, 4H), 7.47 - 7.40 (m, 2H), 7.22 (q, J = 8.3 Hz, 2H), 7.10 (t, J = 8.9 Hz, 2H), 6.85 (s, 1H), 4.89 (d, J = 12.3 Hz, 1H), 3.83 (s, 3H), 3.01 - 2.95 (m, 3H), 2.69 (s, 2H), 2.32 (t, J = 7.3 Hz, 2H), 1.71 (t, J = 7.4 Hz, 2H), 1.38 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.15 mm. m/z = 650.2 for [M+H] ⁺

[000643] Step 6: tert-butyl N-[4-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy -

1.3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo-buty l]carbamate

[000644] To a magnetically stirred solution of tert-butyl N-[4-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo -butyl]carbamate (0.750 g, 1.15 mmol, 1.0 eq.) in EtOH (15.0 mL) were added hydroxylamine hydrochloride (0.160 g, 2.36 mmol, 2.05 eq.) and DIPEA (0.60 mL, 3.46 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18.5 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown oil (1.22 g, 1.79 mmol, assumed quantitative yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 683.2 for [M+H] ⁺

[000645] Step 7: [[amino- [3-[2-[[3-[4-(tert- butoxy carbonylamino)butanoylamino]phenyl]sulfonylamino]-2-(6-metho xy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000646] To a magnetically stirred solution of tert-butyl N-[4-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-4- oxo-butyl] carbamate (1.22 g, 1.79 mmol, 1.0 eq) in acetic acid (12.0 mL) was added acetic anhydride (0.51 mL, 5.36 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 1.5 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 60-100% ethyl acetate in heptane to afford product as an orange oil (0.490 g, 0.682 mmol, 38% yield).

[000647] 1H NMR (400 MHz, DMSO-d6) 5 9.93 (s, 1H), 8.83 (s, 1H), 7.86 (s, 1H), 7.77 (d, J = 9.0 Hz, 1H), 7.61 - 7.53 (m, 2H), 7.51 (d, J = 8.0 Hz, 1H), 7.43 (d, J = 7.7 Hz, 1H), 7.23 - 7.02 (m, 5H), 6.84 (s, 1H), 6.69 (s, 2H), 4.86 (s, 1H), 3.81 (s, 3H), 3.26 (dd, J = 14.1, 5.8 Hz, 1H), 2.99 (dd, J = 13.9, 8.1 Hz, 3H), 2.28 (t, J = 7.5 Hz, 2H), 2.14 (s, 3H), 1.76 - 1.64 (m, 2H), 1.38 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.09 mm; m/z = 725.2 for [M+H] ⁺

[000648] Step 8: tert-butyl N-[4-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo-butyl]carba mate

[000649] To a magnetically stirred solution of [[amino- [3-[2-[[3-[4-(tert- butoxy carbonylamino)butanoylamino]phenyl]sulfonylamino]-2-(6-metho xy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.490 g, 0.682 mmol, 1.0 eq) in acetic acid (10.0 mL) was added zinc (0.450 g, 6.82 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 17 h. The reaction mixture was then redosed with further zinc (0.450 g, 6.82 mmol, 10.0 eq.) and stirred at RT for 23 h The reaction mixture was filtered, washing with acetonitrile and methanol, and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 20-100 % MeCN:H ₂ O eluent (0.05 % TFA) to afford product (0.45 g, 0.673 mmol, 99% yield). UPLC-MS (basic 6 min): Rt = 2.92 min; m/z = 667.3 for [M+H] ⁺

[000650] Step 9: 4-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethy 1] sulfamoyl] phenyl] butanamide; dihydrochloride

[000651] A mixture of tert-butyl N-[4-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo-butyl]carba mate (0.010 g, 0.0150 mmol, 1.00 eq.) and 4 N HC1 in 1,4-Dioxane solution (0.20 mL, 0.802 mmol, 53.5 eq.) was stirred at RT for 2 h. The reaction mixture was concentrated to dryness and the residue dried in the vacuum oven overnight to afford product as a white solid. (0.0069 g, 0.0106 mmol, 70% yield).

[000652] 1H NMR (400 MHz, DMSO-d6) 5 10.26 (d, J = 9.3 Hz, 1H), 9.25 (s, 2H), 9.11 (s, 2H), 8.87 (d, J = 8.0 Hz, 1H), 7.95 (d, J = 10.5 Hz, 3H), 7.89 (t, J = 2.0 Hz, 1H), 7.79 (dd, J = 8.9, 5.3 Hz, 1H), 7.71 (s, 1H), 7.63 (dd, J = 6.9, 2.6 Hz, 1H), 7.59 - 7.48 (m, 1H), 7.45 (q, J = 7.1 Hz, 1H), 7.23 (t, J = 7.7 Hz, 1H), 7.16 (t, J = 7.8 Hz, 1H), 7.14 - 7.06 (m, 2H), 4.95 (td, J = 9.4, 4.8 Hz, 1H), 3.83 (d, J = 1.8 Hz, 3H), 3.41 - 3.31 (m, 1H), 3.11 - 2.97 (m, 1H), 2.87 (q, J = 6.6 Hz, 2H), 1.89 (p, J = 7.5 Hz, 2H). - 4.5 wt.% residual 1,4-dioxane, 0.1 wt.% residual MeOH. UPLC-MS (acidic 6 min): Rt = 1.78 min; m/z = 567.0 for [M] ⁺ , 98% purity. Chiral analysis performed by Reach Separations showed 52.0% chiral purity.

Example 27: Exemplary synthesis of Compound 217

[000653] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000654] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.880 g, 1.96 mmol, 1.0 eq.) in DCM (20.0 mb) was added tribromoborane (8.0 mL, 800 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness. The residue by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.301 g, 0.691 mmol, 35% yield).

[000655] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32

(m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 434.0 for [M-H] ⁺

[000656] Step 2 : N-[2-(3-cyanophenyl)-1- [6-(2-tetrahydropyran-2-yloxy ethoxy)- 1,3- benzothiazol-2-yl]ethyl]benzenesulfonamide

[000657] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.200 g, 0.459 mmol, 1.0 eq.) in anhydrous DMF (4 ml) was added sodium hydride 60% in mineral oil (0.064 g, 1.61 mmol, 3.5 eq.) and the reaction mixture was stirred at RT for 15 min. 2-(2-bromoethoxy)tetrahydropyran (0.10 mL, 0.689 mmol, 1.5 eq.) was added and the reaction mixture was stirred at RT for 22 h. The reaction mixture was quenched with MeOH and then concentrated to dryness. The residue was purified by normal phase column chromatography (20 g cartridge) eluting with 0-100% ethyl acetate in heptane to afford product as a brown solid (0.150 g, 0.266 mmol, 58% yield).

[000658] H NMR (400 MHz, DMSO-d6) 5 8.91 (d, J = 8.4 Hz, 1H), 7.81 (d, J = 8.9 Hz, 1H), 7.67 (d, J = 2.5 Hz, 1H), 7.59 (s, 1H), 7.55 - 7.49 (m, 2H), 7.49 - 7.40 (m, 3H), 7.30 (td, J = 7.8, 3.3 Hz, 3H), 7.12 (dd, J = 8.9, 2.5 Hz, 1H), 4.97 (td, J = 9.5, 4.4 Hz, 1H), 4.68 (d, J = 3.5 Hz, 1H), 4.21 (t, J = 4.7 Hz, 2H), 3.96 (dt, J = 9.4, 4.5 Hz, 1H), 3.78 (tt, J = 11.5, 6.7 Hz, 3H), 3.49 - 3.42 (m, 2H), 3.41 - 3.34 (m, 1H), 3.00 (dd, J = 13.9, 10.4 Hz, 1H), 1.77 - 1.60 (m, 3H), 1.49 (d, J = 13.5 Hz, 7H). UPLC-MS (basic 2 mm) Rt = 1.22 mm. m/z = 564.0 for [M+H] ⁺

[000659] Step 3: 3-[2-(benzenesulfonamido)-2-[6-(2-tetrahydropyran-2-yloxyeth oxy)-l,3- benzothiazol-2-yl]ethyl]-N'-hydroxy-benzamidine

[000660] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-[6-(2-tetrahydropyran- 2-yloxyethoxy)-l,3-benzothiazol-2-yl]ethyl]benzenesulfonamid e (0.320 g, 0.568 mmol, 1.0 eq.) in EtOH (3 mL) were added hydroxylamine hydrochloride (0.079 g, 1.14 mmol, 2.0 eq.) and DIPEA (0.30 mL, 1.70 mmol, 3.2 eq.). The reaction mixture was stirred at 60 °C for 2 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a gummy brown solid (0.400 g, 0.550 mmol, 97% yield) which was used in the next step without further purification.

[000661] 1H NMR (400 MHz, DMSO-d6) 5 8.99 - 8.82 (m, 2H), 7.78 (d, J = 8.9 Hz, 2H), 7.65 - 7.42 (m, 5H), 7.39 (t, J = 7.5 Hz, 1H), 7.26 (t, J = 7.7 Hz, 3H), 7.10 (d, J = 8.9 Hz, 1H), 5.02 - 4.86 (m, 1H), 4.26 - 4.14 (m, 2H), 4.03 - 3.88 (m, 1H), 3.90 - 3.71 (m, 3H), 3.51 - 3.43 (m, 1H), 3.03 (d, J = 9.4 Hz, 1H), 1.75 - 1.60 (m, 2H), 1.57 - 1.38 (m, 6H). Contains DIPEA and EtOH. UPLC-MS (basic 2 mm) Rt = 1.08 mm. m/z = 597.0 for [M+H] ⁺

[000662] Step 4: 2-[[2-[2-[3-(N'-acetoxycarbamimidoyl)phenyl]-l- (benzenesulfonamido)ethyl]-l,3-benzothiazol-6-yl]oxy]ethyl acetate

[000663] To a magnetically stirred solution of 3-[2-(benzenesulfonamido)-2-[6-(2- tetrahydropyran-2-yloxyethoxy)-l,3-benzothiazol-2-yl]ethyl]- N'-hydroxy-benzamidine (0.340 g, 0.467 mmol, 1.0 eq) in acetic acid (2.0 mL) was added acetic anhydride (0.130 mL, 1.40 mmol, 3.0 eq.) and the resulting mixture was stirred at RT overnight. The reaction mixture was acidified to pH 1.0 by the slow addition of cone. HC1. The reaction mixture was concentrated to dryness and the residue was purified by Reverse Phase column chromatography eluting with a 5-95 % MeCN:H ₂ O eluent (0.1 % ammonia) to afford product as a brown gummy solid (0.091 g, 0.153 mmol, 33% yield).

[000664] 1H NMR (400 MHz, DMSO-d6) 5 8.88 (s, 2H), 7.80 (d, J = 8.8 Hz, 1H), 7.69 - 7.51 (m, 2H), 7.51 - 7.30 (m, 4H), 7.29 - 6.90 (m, 4H), 6.83 - 6.67 (m, 1H), 4.97 - 4.88 (m, 1H), 4.43 - 4.31 (m, 2H), 4.33 - 4.23 (m, 2H), 3.30 (s, 3H), 3.24 - 3.10 (m, 1H), 3.10 - 2.94 (m, 1H), 2.06 (s, 3H). UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 597.1 for [M+H] ⁺

[000665] Step 5: 3-[2-(benzenesulfonamido)-2-[6-(2-hydroxyethoxy)-l,3-benzoth iazol-2- yl]ethyl]benzamidine

[000666] To a magnetically stirred solution of 2-[[2-[2-[3-(N'-acetoxycarbamimidoyl)phenyl]- l-(benzenesulfonamido)ethyl]-l,3-benzothiazol-6-yl]oxy]ethyl acetate (0.090 g, 0.151 mmol, 1.0 eq) in acetic acid (1.0 mL) was added zinc (0.197 g, 3.02 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature over a weekend. The reaction mixture was filtered and then concentrated to dryness. The residue was purified by reverse phase preparative HPLC eluting with 5-95 % MeCN:H ₂ O (0.05 % TFA) to afford the product as a white solid (0.008 g, 0.0159 mmol, 11% yield).

[000667] 1H NMR (400 MHz, DMSO-d6) 5 7.74 (d, J = 9.0 Hz, 1H), 7.71 - 7.52 (m, 3H), 7.52 - 7.38 (m, 3H), 7.36 - 7.30 (m, 1H), 7.27 - 7.08 (m, 4H), 7.08 - 7.02 (m, 1H), 4.87 - 4.82 (m, 1H), 4.08 - 4.01 (m, 2H), 3.79 - 3.71 (m, 2H), 3.03 - 2.97 (m, 1H), 1.05 (d, J = 6.1 Hz, 1H). amidine protons not observed. 1H under water peak (3.23). UPLC-MS (acidic 4 min): Rt = 0.99 min; m/z = 497.1 for [M-H] ⁺ , 99% purity. Chiral analysis performed by Reach Separations showed 51.4% chiral purity.

Example 28: Exemplary synthesis of Compound 167

[000668] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000669] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (0.100 g, 0.344 mmol, 1.0 eq.) in toluene (2.0 mL) were added DIPEA (0.18 mL, 1.03 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (0.059 g, 0.379 mmol, 1.1 eq.) and T3P (0.21 mL, 0.689 mmol, 2.0 eq.). The resulting mixture was stirred at RT for 20 min then at reflux for 2 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (2 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 4 mL), washed with saturated sodium hydrogen carbonate solution (4 mL), washed with brine (4 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography eluting with 0-60% ethyl acetate in heptane to afford product as a brown solid (0.050 g, 0.122 mmol, 35% yield).

[000670] 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 9.0 Hz, 2H), 7.79 (s, 1H), 7.73 - 7.63 (m, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 5.16 - 5.05 (m, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.8, 4.4 Hz, 1H), 3.11 (dd, J = 13.8, 11.0 Hz, 1H), 1.30 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.0 for [M+H] ⁺

[000671] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile

[000672] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (2.90 g, 7.08 mmol, 1.0 eq,) in DCM (29.0 mL) was added trifluoroacetic acid (29.0 mL, 379 mmol, 53.5 eq,) and the reaction mixture was stirred at RT for 20 min. The reaction mixture was concentrated to dryness before being suspended in DCM (25 mL). To this suspension was added K ₂ CO ₃ (6 g) in water (25 mL) and the resulting mixture was vigorously stirred for 20 min. The phases were separated and aqueous was extracted with further DCM (3 x 25 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.99 g, 6.43 mmol, 91% yield) which was used in the next step without further purification.

[000673] 1H NMR (400 MHz, DMSO-d6) 5 7.80 (d, J = 8.9 Hz, 1H), 7.74 (s, 1H), 7.67 (d, J = 7.7 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.06 (dd, J = 8.9, 2.5 Hz, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.5 Hz, 3H), 3.37 (dd, J = 13.5, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 309.9 for [M+H] ⁺

[000674] Step 3: methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[000675] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (1.00 g, 3.04 mmol, 1.0 eq,) in DMF (10.0 mL) was added triethylamine (0.64 mL, 4.56 mmol, 1.5 eq,) and the reaction mixture was cooled to 0°C. Methyl-3- chlorosulfonylbenzoate (0.86 g, 3.65 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 5 h. The reaction mixture was concentrated to dryness and the residue purified by normal phase column chromatography eluting with 40-70% ethyl acetate in hexane to afford product as a brown oil (0.34 g, 0.674 mmol, 22% yield).

[000676] 1H NMR (400 MHz, DMSO-d6) 5 9.09 (s, 1H), 7.92 (d, J = 7.8 Hz, 1H), 7.87 (d, J = 1.8 Hz, 1H), 7.74 (dd, J = 16.8, 8.4 Hz, 2H), 7.65 - 7.57 (m, 2H), 7.53 - 7.39 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.5 Hz, 1H), 5.01 (d, J = 10.3 Hz, 1H), 3.88 (s, 3H), 3.83 (s, 3H), 3.38 (d, J = 4.4 Hz, OH), 3.00 (dd, J = 13.8, 10.8 Hz, 1H). - 1H obscured by H ₂ O peak. UPLC-MS (basic 2 min) Rt = 1.12 min. m/z = 508.0 for [M+H] ⁺

[000677] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[000678] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (0.560 g, 1.10 mmol, 1.0 eq.) in THF (9.9 mL) was added a solution of lithium hydroxide (0.14 g, 3.31 mmol, 3.0 eq.) in water (3.3 mL) and the resulting mixture stirred at RT for 3 h. The reaction volume was reduced by half and then extracted with ethyl acetate (10 mL). The aqueous phase was acidified to pH 1.0 by the slow addition of cone. HC1, extracted with ethyl acetate (2 x 20 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The initial organic phase was diluted with further ethyl acetate (10 mL) and washed with water (20 mL). The aqueous phase was acidified to pH 1.0 by the slow addition of cone. HC1, extracted with ethyl acetate (2 x 20 mL), dried over anhydrous sodium sulfate and concentrated to dryness. Both batches of residue were then dissolved in ethyl acetate, combined and concentrated to dryness to afford product as an off- white solid (0.260 g, 0.525 mmol, 48% yield).

[000679] 1H NMR (400 MHz, DMSO-d6) 5 13.29 (s, 1H), 9.05 (d, J = 8.5 Hz, 1H), 8.01 - 7.88 (m, 2H), 7.77 (d, J = 8.9 Hz, 1H), 7.67 (d, J = 7.9 Hz, 1H), 7.64 - 7.57 (m, 2H), 7.51 (d, J = 7.9 Hz, 1H), 7.42 (q, J = 7.5 Hz, 2H), 7.23 (t, J = 7.8 Hz, 1H), 7.08 (dd, J = 9.0, 2.5 Hz, 1H), 5.05 - 4.95 (m, 1H), 3.83 (d, J = 1.6 Hz, 3H), 3.37 (dd, J = 13.9, 4.5 Hz, 1H), 3.05 - 2.95 (m, 1H). UPLC-MS (basic 2 mm) Rt = 0.85 mm. m/z = 494.0 for [M+H] ⁺

[000680] Step 5: tert-butyl N-[2-[[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl] sulfamoyl] benzoyl] amino] ethyl] carbamate

[000681] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.260 g, 0.525 mmol, 1.0 eq.) in DMF (3 mL) were added tert-Butyl N-(2-aminoethyl)carbamate (0.10 mL, 0.630 mmol, 1.2 eq.), DIPEA (0.27 mL, 1.57 mmol, 3.0 eq.) and HATU (0.300 g, 0.787 mmol, 1.5 eq.) and the reaction mixture was stirred at RT overnight. The reaction mixture was diluted with ethyl acetate (20 mL), washed with brine (15 mL), saturated sodium hydrogen carbonate solution (15 mL) and brine (15 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was purified by normal phase column chromatography (4 g cartridge) eluting with 40-100 % ethyl acetate in heptane to afford product as an off-white solid (0.200 g, 0.307 mmol, 58% yield).

[000682] 1H NMR (400 MHz, DMSO-d6) 5 8.98 (s, 1H), 8.55 (s, 1H), 7.93 (s, 1H), 7.87 (d, J = 7.8 Hz, 1H), 7.79 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.60 - 7.53 (m, 2H), 7.49 - 7.33 (m, 3H), 7.17 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 6.91 (s, 1H), 5.00 (s, 1H), 3.83 (s, 3H), 3.14 (d, J = 6.3 Hz, 2H), 2.96 (dd, J = 13.8, 10.6 Hz, 1H), 2.68 (s, 2H), 2.07 (s, 2H), 1.37 (s, 9H). - 1H obscured by H ₂ O peak. UPLC-MS (basic 2 min) Rt = 1.12 min. m/z = 636.1 for [M+H] ⁺

[000683] Step 6: tert-butyl N-[2-[[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methox y- 1 ,3 -benzothiazol-2-yl)ethy 1] sulfamoyl] benzoyl] amino] ethyl] carbamate

[000684] To a magnetically stirred solution of tert-butyl N-[2-[[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]amino] ethyl]carbamate (0.200 g, 0.307 mmol, 1.0 eq.) in EtOH (4.0 mb) were added hydroxylamine hydrochloride (0.043 g, 0.613 mmol, 2.0 eq.) and DIPEA (0.16 mL, 0.920 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18.5 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a yellow oil (0.300 g, 0.453 mmol, assumed quantitative yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.02 min. m/z = 669.1 for [M+H] ⁺

[000685] Step 7: [[amino-[3-[2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000686] To a magnetically stirred solution of tert-butyl N-[2-[[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl] -1-(6-methoxy- 1 ,3 -benzothiazol-2- yl)ethyl]sulfamoyl]benzoyl]amino]ethyl]carbamate (0.300 g, 0.453 mmol, 1.0 eq) in acetic acid (6.0 mL) was added acetic anhydride (0.13 mL, 1.36 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 22.5 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-100% ethyl acetate in heptane to afford product as a colorless oil (0.100 g, 0.146 mmol, 32% yield).

[000687] 1H NMR (400 MHz, DMSO-d6) 5 8.95 (s, 1H), 8.54 (s, 1H), 7.95 (s, 1H), 7.80 (d, J = 7.8 Hz, 1H), 7.77 (d, J = 9.0 Hz, 1H), 7.61 (d, J = 2.6 Hz, 1H), 7.55 (d, J = 7.7 Hz, 1H), 7.51 (s, 1H), 7.40 (d, J = 7.9 Hz, 1H), 7.31 (t, J = 7.8 Hz, 1H), 7.22 (d, J = 7.7 Hz, 1H), 7.12 - 7.03 (m, 2H), 6.89 (d, J = 6.0 Hz, 1H), 6.69 (s, 2H), 4.94 (s, 1H), 3.82 (s, 3H), 3.29 (d, J = 6.4 Hz, 3H), 3.14 (t, J = 6.3 Hz, 2H), 2.98 (dd, J = 13.9, 9.8 Hz, 1H), 2.16 (s, 3H), 1.38 (s, 9H). - 3H obscured by H ₂ O peak. UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 711.3 for [M+H] ⁺

[000688] Step 8: tert-butyl N-[2-[[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]amino]ethyl]carbam ate

[000689] To a magnetically stirred solution of [ [amino- [3 - [2- [ [3 - [2-(tert- butoxycarbonylamino)ethylcarbamoyl]phenyl]sulfonylamino]-2-( 6-methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.100 g, 0.146 mmol, 1.0 eq) in acetic acid (2.0 mb) was added zinc (0.100 g, 1.53 mmol, 10.5 eq.). The reaction mixture was stirred at room temperature for 24 h. Further zinc (0.110 g, 1.68 mmol, 11.5 eq.) was added and the reaction stirred for a further 24 h at RT. The reaction mixture was filtered and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 20-100 % H ₂ O:MeCN eluent (0.05 % TFA) to afford product as a colorless oil (0.055 g, 0.0843 mmol, 58% yield). UPLC-MS (acidic 6 min): Rt = 2.57 min; m/z = 653.1 for [M-H] ⁺

[000690] Step 9: N-(2-aminoethyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy- l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide

[000691] To tert-butyl N-[2-[[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzot hiazol- 2-yl)ethyl]sulfamoyl]benzoyl]amino]ethyl]carbamate (0.045 g, 0.0689 mmol, 1.00 eq.) was added 4 N HC1 in 1,4-Dioxane solution (4.5 mL, 18.0 mmol, 261 eq.) and the reaction mixture was stirred at RT for 2.5 h. The reaction mixture was concentrated to dryness to afford crude product, contaminated with ammonium chloride. Purification using reverse phase column chromatography in order to remove the ammonium chloride proved unsuccessful. Achiral purification was performed by Reach Separations, using reverse phase preparative-HPLC, eluting with 5-100% MeCN:H ₂ O (0.2% ammonia), to afford product as an off-white solid. (0.009 g, 0.0163 mmol, 24% yield).

[000692] 1H NMR (400 MHz, DMSO-d6) 5 9.06 (s, 1H), 8.06 (s, 1H), 7.96 (s, OH), 7.83 (d, J = 8.8 Hz, 1H), 7.70 (d, J = 9.9 Hz, 2H), 7.59 (d, J = 9.1 Hz, 2H), 7.52 (d, J = 8.0 Hz, 1H), 7.38 (s, 1H), 7.11 (s, 3H), 7.00 (s, 1H), 5.34 (s, 1H), 4.86 (s, 1H), 3.84 (s, 3H), 3.81 (s, 2H), 2.94 (d, J = 12.3 Hz, 1H), 2.71 (s, 1H), 1.23 (s, 1H) - exchangeable protons not seen. Diagnostic proton appears as two peaks - variable temperature 1HNMR confirms the presence of rotamers. UPLC- MS (acidic 6 min): Rt = 0.92 min; m/z = 553.2 for [M] ⁺ , 100% purity

Example 29: Exemplary synthesis of Compound 218

[000693] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000694] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.880 g, 1.96 mmol, 1.0 eq.) in DCM (20.0 mb) was added tribromoborane (8.0 mL, 800 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness. The residue by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O :MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.301 g, 0.691 mmol, 35% yield).

[000695] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32

(m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 434.0 for [M-H] ⁺

[000696] Step 2: N-[2-(3-cyanophenyl)-l-[6-(3,3-dimethoxypropoxy)-l,3-benzoth iazol-2- yl]ethyl]benzenesulfonamide

[000697] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.611 g, 1.40 mmol, 1.0 eq.) in anhydrous NMP (12 ml) was added sodium hydride 60% in mineral oil (0.150 g, 3.75 mmol, 2.67 eq.) and the reaction mixture was stirred at RT for 15 min. 3 -Bromopropionaldehyde dimethylacetal (0.30 mb, 2.20 mmol, 1.57 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with MeOH (3 mL) and purified by reverse phase column chromatography eluting with 5-95% MeCN:H ₂ O (+0.1% NH ₃ ) to afford product as a pale-brown glass (0.444 g, 0.826 mmol, 59% yield).

[000698] 1H NMR (400 MHz, DMSO-d6) 5 8.90 (s, 1H), 7.79 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.5 Hz, 1H), 7.57 (s, 1H), 7.50 (t, J = 7.3 Hz, 2H), 7.47 - 7.43 (m, 2H), 7.40 (d, J = 7.3 Hz, 1H), 7.28 (td, J = 7.7, 3.7 Hz, 3H), 7.08 (dd, J = 8.9, 2.5 Hz, 1H), 4.93 (s, 1H), 4.61 (t, J = 5.7 Hz, 1H), 4.06 (t, J = 6.4 Hz, 2H), 3.27 (s, 6H), 2.99 (dd, J = 13.8, 10.2 Hz, 1H), 2.02 (q, J = 6.2 Hz, 2H) - 1H obscured by H ₂ O peak. UPLC-MS (acidic 2 min) Rt = 1.21 min. m/z = 538.0 for [M+H] ⁺

[000699] Step 3: N-[2-(3-cyanophenyl)-l-[6-(3-oxopropoxy)-l,3-benzothiazol-2- yl]ethyl]benzenesulfonamide

[000700] To a magnetically stirred suspension of N-[2-(3-cyanophenyl)-l-[6-(3,3- dimethoxypropoxy)-l,3-benzothiazol-2-yl]ethyl]benzenesulfona mide (0.200 g, 0.372 mmol, 1.0 eq.) in diethyl ether (5.0 mL) was added 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 21.5 eq.). The resultant mixture was stirred at RT for 24 h. The precipitate that formed was collected by filtration, washing with copious diethyl ether, and dried in vacuo, to afford product as a brown solid (0.130 g, 0.264 mmol, 71%). The product was obtained as a mixture with the corresponding phenol by-product (due to de-alkylation) and used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.10 min. m/z = 491.9 for [M+H] ⁺

[000701] Step 4: N-[2-(3-cyanophenyl)-l-[6-[2-(lH-imidazol-2-yl)ethoxy]-l,3-b enzothiazol- 2-yl]ethyl]benzenesulfonamide

[000702] A magnetically stirred suspension of N-[2-(3-cyanophenyl)-l-[6-(3-oxopropoxy)- l,3-benzothiazol-2-yl]ethyl]benzenesulfonamide (0.409 g, 0.832 mmol, 1.0 eq.), 40% glyoxal in water (0.30 mL, 2.62 mmol, 3.14 eq.) and cone, ammonia (0.50 mL, 9.00 mmol, 10.8 eq.) in acetonitrile (8 mL) was stirred at RT for 24 h. The reaction mixture was concentrated to dryness and purified by reverse phase column chromatography eluting with 5-95% MeCNALO (+0.1% ammonia) to afford product as a yellow glass (0.135 g, 0.255 mmol, 31% yield). UPLC-MS (acidic 2 min) Rt = 0.96 min. m/z = 530.0 for [M+H] ⁺

[000703] Step 5: 3-[2-(benzenesulfonamido)-2-[6-[2-(lH-imidazol-2-yl)ethoxy]- l,3- benzothiazol-2-yl]ethyl]-N'-hydroxy-benzamidine

[000704] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-[6-[2-(lH-imidazol-2- yl)ethoxy]-l,3-benzothiazol-2-yl]ethyl]benzenesulfonamide (0.135 g, 0.255 mmol, 1.0 eq.) in EtOH (3 mL) were added hydroxylamine hydrochloride (0.048 g, 0.691 mmol, 2.71 eq.) and DIPEA (0.15 mL, 0.861 mmol, 3.38 eq.). The reaction mixture was stirred at reflux for 24 h. Further hydroxylamine hydrochloride (0.025 g, 0.360 mmol, 1.41 eq.) was added and the reaction stirred at reflux for a further 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown glass (0.157 g, 0.279 mmol, 110% yield) which was used in the next step without further purification. UPLC-MS (acidic 2 min) Rt = 0.76 min. m/z = 563.0 for [M+H] ⁺

[000705] Step 6: [[amino-[3-[2-(benzenesulfonamido)-2-[6-[2-(lH-imidazol-2-yl )ethoxy]-l,3- benzothiazol-2-yl]ethyl]phenyl]methylene]amino] acetate

[000706] To a magnetically stirred solution of 3-[2-(benzenesulfonamido)-2-[6-[2-(lH- imidazol-2-yl)ethoxy]-l,3-benzothiazol-2-yl]ethyl]-N'-hydrox y-benzamidine (0.157 g, 0.279 mmol, 1.0 eq) in acetic acid (4.0 mL) was added acetic anhydride (0.10 mL, 1.06 mmol, 3.79 eq.) and the resulting mixture was stirred at RT for 1 h. The reaction mixture was concentrated to dryness and the residue was purified by reverse phase column chromatography eluting with a 5- 95 % MeCN/TbO eluent (0.1 % ammonia) to afford product as an off-white solid (0.040 g, 0.0661 mmol, 24% yield).

[000707] 1H NMR 147562-2 (400 MHz, DMSO-d6) 5 11.80 (s, 1H), 7.75 (d, J = 9.0 Hz, 1H), 7.56 (t, J = 17.9 Hz, 2H), 7.45 (t, J = 7.9 Hz, 3H), 7.35 (s, 1H), 7.29 - 7.15 (m, 3H), 7.12 (t, J = 7.7 Hz, 1H), 7.04 (d, J = 12.6 Hz, 2H), 6.80 (s, 1H), 6.71 (s, 1H), 4.86 (s, 1H), 4.33 (t, J = 6.9 Hz, 2H), 3.24 (s, 1H), 3.10 (t, J = 6.8 Hz, 2H), 2.98 (dd, J = 13.7, 9.0 Hz, 1H), 2.14 (s, 3H) - 2H unobserved. UPLC-MS (basic 2 min): Rt = 0.93 min; m/z = 605.0 for [M+H] ⁺

[000708] Step 7: 3-[2-(benzenesulfonamido)-2-[6-[2-(lH-imidazol-2-yl)ethoxy]- l,3- benzothiazol-2-yl]ethyl]benzamidine

[000709] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-[6-[2- (lH-imidazol-2-yl)ethoxy]-l,3-benzothiazol-2-yl]ethyl]phenyl ]methylene]amino] acetate (0.040 g, 0.0661 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.250 g, 3.82 mmol, 57.8 eq.). The reaction mixture was stirred at room temperature for 24 h. The reaction mixture was filtered through Celite, washing with copious DCM, ethanol and acetonitrile, and then concentrated to dryness. The residue was purified by reverse phase preparative HPLC eluting with 20-100 % MeCN:H ₂ O (0.05 % TFA) to afford the product as an off-white solid (0.0044 g, 0.00805 mmol, 12% yield).

[000710] 1H NMR (400 MHz, DMSO-d6) 5 7.74 (d, J = 8.8 Hz, 1H), 7.61 (d, J = 17.4 Hz, 2H), 7.46 (d, J = 8.0 Hz, 3H), 7.32 (t, J = 7.4 Hz, 1H), 7.27 - 7.11 (m, 4H), 7.03 (d, J = 8.9 Hz, 1H), 6.91 (s, 2H), 4.84 (s, 1H), 4.32 (t, J = 6.8 Hz, 2H), 3.09 (t, J = 6.8 Hz, 2H), 3.03 - 2.95 (m, 1H) - 5H unobserved and 1H obscured by H ₂ O peak. UPLC-MS (acidic 6 min): Rt = 1.58 min; m/z = 547.0 for [M-H] ⁺ , 98% purity. Chiral analysis performed by Reach Separations showed 50.7% chiral purity.

Example 30: Exemplary synthesis of Compound 219

[000711] Step 1 : N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide)

[000712] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.880 g, 1.96 mmol, 1.0 eq.) in DCM (20.0 mb) was added tribromoborane (8.0 mL, 800 mmol, 4.0 eq.) at -78 °C. The resulting slurry was allowed to warm to RT and stirred for 24 h. The reaction mixture was quenched with IPA and then concentrated to dryness. The residue by Reverse Phase column chromatography eluting with a 5-95 % H ₂ O:MeCN eluent (0.1 % ammonia) to afford product as a light brown solid (0.301 g, 0.691 mmol, 35% yield).

[000713] ¹ H NMR (DMSO-d6) 5: 9.76 (br s, 1H), 8.37 - 9.24 (m, 1H), 7.71 (d, J = 8.8 Hz, 1H), 7.57 (s, 1H), 7.47 - 7.54 (m, 2H), 7.40 - 7.47 (m, 3H), 7.33 (d, J = 2.2 Hz, 1H), 7.25 - 7.32 (m, 3H), 6.94 (dd, J = 8.8, 2.4 Hz, 1H), 4.92 (dd, J = 10.4, 4.5 Hz, 1H), 3.32 - 3.38 (m, 1H), 2.97 (dd, J = 13.9, 10.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 434.0 for [M-H] ⁺ .

[000714] Step 2: N-[2-(3-cyanophenyl)-l-[6-(4,4-dimethoxybutoxy)-l,3-benzothi azol-2- yl]ethyl]benzenesulfonamide

[000715] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-hydroxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.414 g, 0.951 mmol, 1.0 eq.) in anhydrous NMP (9 ml) was added sodium hydride 60% in mineral oil (0.100 g, 2.50 mmol, 2.63 eq.) and the reaction mixture was stirred at RT for 15 min. 4-Bromo- 1,1 -dimethoxy-butane (0.250 g, 1.27 mmol, 1.33 eq.) was added and the reaction mixture was stirred at RT for 1 h. The reaction mixture was quenched with MeOH (2 mL) and purified by reverse phase column chromatography eluting with 5-95% MeCN:H ₂ O (+0.1% NH ₃ ) to afford product as a pale-brown glass (0.433 g, 0.785 mmol, 83% yield).

[000716] 1H NMR (400 MHz, DMSO-d6) 5 8.89 (s, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.62 (d, J = 2.5 Hz, 1H), 7.58 (s, 1H), 7.54 - 7.48 (m, 2H), 7.46 - 7.41 (m, 3H), 7.29 (td, J = 7.9, 2.7 Hz, 3H), 7.08 (dd, J = 9.0, 2.5 Hz, 1H), 4.99 - 4.91 (m, 1H), 4.43 (t, J = 5.4 Hz, 1H), 4.04 (t, J = 6.2 Hz, 2H), 3.36 (dd, J = 13.9, 4.7 Hz, 1H), 3.24 (s, 6H), 2.99 (dd, J = 13.9, 10.4 Hz, 1H), 1.81 - 1.72 (m, 2H), 1.72 - 1.62 (m, 2H). UPLC-MS (basic 2 mm) Rt = 1.19 mm. m/z = 552.0 for [M+H] ⁺ .

[000717] Step 3: N-[2-(3-cyanophenyl)-l-[6-(4-oxobutoxy)-l,3-benzothiazol-2- yl]ethyl]benzenesulfonamide

[000718] To a magnetically stirred suspension of N-[2-(3-cyanophenyl)-l-[6-(4,4- dimethoxybutoxy)-l,3-benzothiazol-2-yl]ethyl]benzenesulfonam ide (0.433 g, 0.785 mmol, 1.0 eq.) in acetonitrile (8.0 mL) was added 1 N HC1 (2.0 mL, 2.00 mmol, 2.55 eq.). The resultant mixture was stirred at RT for 1 h. The reaction was concentrated to dryness to afford product as a brown glass (0.355 g, 0.702 mmol, 89%). The product was used in the next step without further purification. UPLC-MS (acidic 2 min) Rt = 1.15 min. m/z = 506.1 for [M+H] ⁺ .

[000719] Step 4: N-[2-(3-cyanophenyl)-l-[6-[3-(lH-imidazol-2-yl)propoxy]-l,3- benzothiazol- 2-yl]ethyl]benzenesulfonamide

[000720] A magnetically stirred suspension of N-[2-(3-cyanophenyl)-l-[6-(4-oxobutoxy)-l,3- benzothiazol-2-yl]ethyl]benzenesulfonamide (0.355 g, 0.702 mmol, 1.0 eq.), 40% glyoxal in water (0.25 mL, 2.18 mmol, 3.1 eq.) and cone, ammonia (0.40 mL, 7.20 mmol, 10.3 eq.) in acetonitrile (7 mL) was stirred at RT for 24 h. The reaction mixture was concentrated to dryness and purified by reverse phase column chromatography eluting with 5-95% MeCN:H ₂ O (+0.1% ammonia) to afford product as an off-white solid (0.150 g, 0.276 mmol, 39% yield). UPLC-MS (basic 2 min) Rt = 1.02 min. m/z = 544.0 for [M+H] ⁺ .

[000721] Step 5: 3-[2-(benzenesulfonamido)-2-[6-[3-(lH-imidazol-2-yl)propoxy] -l,3- benzothiazol-2-yl]ethyl]-N'-hydroxy-benzamidine

[000722] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-[6-[3-(lH-imidazol-2- yl)propoxy]-l,3-benzothiazol-2-yl]ethyl]benzenesulfonamide (0.150 g, 0.276 mmol, 1.0 eq.) in EtOH (4 mL) were added hydroxylamine hydrochloride (0.052 g, 0.748 mmol, 2.71 eq.) and DIPEA (0.15 mL, 0.861 mmol, 3.12 eq.). The reaction mixture was stirred at reflux for 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown glass (0.170 g, 0.295 mmol, assumed quantitative yield) which was used in the next step without further purification. UPLC-MS (acidic 2 min) Rt = 0.78 min. m/z = 577.0 for [M+H] ⁺ .

[000723] Step 6: [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3-(lH-imidazol-2-yl )propoxy]- l,3-benzothiazol-2-yl]ethyl]phenyl]methylene]amino] acetate

[000724] To a magnetically stirred solution of 3-[2-(benzenesulfonamido)-2-[6-[3-(lH- imidazol-2-yl)propoxy]-l,3-benzothiazol-2-yl]ethyl]-N'-hydro xy-benzamidine (0.170 g, 0.295 mmol, 1.0 eq) in acetic acid (4.0 mL) was added acetic anhydride (0.10 mL, 1.06 mmol, 3.59 eq.) and the resulting mixture was stirred at RT for 10 min. The reaction mixture was concentrated to dryness and the residue was purified by reverse phase column chromatography eluting with a 5-95 % MeCN:H ₂ O eluent (0.1 % ammonia) to afford product as an off-white solid (0.138 g, 0.223 mmol, 76% yield). UPLC-MS (basic 2 min): Rt = 0.95 min; m/z = 619.0 for [M+H] ⁺ .

[000725] Step 7: 3-[2-(benzenesulfonamido)-2-[6-[3-(lH-imidazol-2-yl)propoxy] -l,3- benzothiazol-2-yl] ethyl] benzamidine

[000726] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-[6-[3- (lH-imidazol-2-yl)propoxy]-l,3-benzothiazol-2-yl]ethyl]pheny l]methylene]amino] acetate (0.138 g, 0.223 mmol, 1.0 eq) in acetic acid (3.0 mb) was added zinc (0.600 g, 9.18 mmol, 41.1 eq.). The reaction mixture was stirred at room temperature for 24 h. The reaction mixture was filtered through Celite, washing with copious DCM, ethanol and acetonitrile, and then concentrated to dryness. The residue was purified by reverse phase preparative HPLC eluting with 20-100 % MeCN:H ₂ O (0.05 % TFA) to afford the product as an off-white solid (0.032 g, 0.0569 mmol, 26% yield). 1H NMR (400 MHz, DMSO-d6) 5 7.73 (d, J = 8.9 Hz, 1H), 7.63 (s, 1H), 7.53 (d, J = 2.2 Hz, 1H), 7.49 (d, J = 8.0 Hz, 1H), 7.47 - 7.42 (m, 2H), 7.30 (t, J = 7.4 Hz, 1H), 7.26 - 7.19 (m, 3H), 7.15 (t, J = 7.7 Hz, 1H), 7.03 (dd, J = 9.0, 2.3 Hz, 1H), 6.87 (s, 2H), 4.80 (dd, J = 8.6, 5.3 Hz, 1H), 4.06 (t, J = 6.4 Hz, 2H), 3.22 (dd, J = 13.6, 5.1 Hz, 1H), 2.99 (dd, J = 13.5, 8.8 Hz, 1H), 2.77 (t, J = 7.5 Hz, 2H), 2.11 (p, J = 6.7 Hz, 2H) - 5H unobserved. UPLC- MS (acidic 6 min): Rt = 1.66 min; m/z = 561.0 for [M-H] ⁺ , 96% purity. Chiral analysis performed by Reach Separations showed 51.2% chiral purity.

Example 31: Exemplary synthesis of Compound 104

HCI

[000727] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000728] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (0.100 g, 0.344 mmol, 1.0 eq.) in toluene (2.0 mL) were added DIPEA (0.18 mL, 1.03 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (0.059 g, 0.379 mmol, 1.1 eq.) and T3P (0.21 mL, 0.689 mmol, 2.0 eq.). The resulting mixture was stirred at RT for 20 min then at reflux for 2 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (2 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 4 mL), washed with saturated sodium hydrogen carbonate solution (4 mL), washed with brine (4 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography eluting with 0-60% ethyl acetate in heptane to afford product as a brown solid (0.050 g, 0.122 mmol, 35% yield).

[000729] 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 9.0 Hz, 2H), 7.79 (s, 1H), 7.73 - 7.63 (m, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 5.16 - 5.05 (m, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.8, 4.4 Hz, 1H), 3.11 (dd, J = 13.8, 11.0 Hz, 1H), 1.30 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.0 for [M+H] ⁺ .

[000730] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile

[000731] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (2.90 g, 7.08 mmol, 1.0 eq,) in DCM (29.0 mL) was added trifluoroacetic acid (29.0 mL, 379 mmol, 53.5 eq,) and the reaction mixture was stirred at RT for 20 min. The reaction mixture was concentrated to dryness before being suspended in DCM (25 mL). To this suspension was added K ₂ CO ₃ (6 g) in water (25 mL) and the resulting mixture was vigorously stirred for 20 min. The phases were separated and aqueous was extracted with further DCM (3 x 25 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.99 g, 6.43 mmol, 91% yield) which was used in the next step without further purification.

[000732] 1H NMR (400 MHz, DMSO-d6) 5 7.80 (d, J = 8.9 Hz, 1H), 7.74 (s, 1H), 7.67 (d, J = 7.7 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.06 (dd, J = 8.9, 2.5 Hz, 1H), 4.42

(dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.5 Hz, 3H), 3.37 (dd, J = 13.5, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 309.9 for [M+H] ⁺ .

[000733] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000734] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (1.99 g, 6.43 mmol, 1.0 eq,) in DMF (20.0 mL) was added triethylamine (1.3 mL, 9.65 mmol, 1.5 eq,) and the reaction mixture was cooled to 0°C. 3 -nitrobenzene- 1- sulfonyl chloride (1.71 g, 7.72 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 18 h. The reaction mixture was concentrated to dryness and the residue purified by normal phase column chromatography eluting with 10- 100% EtOAc in hexane to afford product (2.00 g, 4.04 mmol, 63% yield).

[000735] 1H NMR (400 MHz, DMSO-d6) 5 9.29 (d, J = 8.5 Hz, 1H), 8.20 (d, J = 8.6 Hz, 1H), 8.09 (s, 1H), 7.88 (d, J = 7.8 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.63 (s, 2H), 7.62 - 7.51 (m, 2H), 7.44 (d, J = 7.8 Hz, 1H), 7.25 (t, J = 7.8 Hz, 1H), 7.11 - 7.04 (m, 1H), 5.17 - 5.07 (m, 1H), 3.82 (s, 3H), 3.39 (dd, J = 14.0, 4.7 Hz, 1H), 3.09 - 2.98 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 min. m/z = 494.5 for [M+H] ⁺ .

[000736] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000737] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (2.00 g, 4.04 mmol, 1.0 eq.) in ethanol (16 mL) and water (8.0 mL) were added iron (2.26 g, 40.4 mmol, 10.0 eq.) and ammonium chloride (1.08 g, 20.2 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH. The filtrate was concentrated to dryness and the residue taken up in DCM (20 mL). The organic layer was washed with aq. saturated NaHCO3 solution (20 mL) and the aqueous was extracted with further DCM (3 x 20 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.61 g, 3.47 mmol, 86% yield) which was used in the next step without further purification.

[000738] 1H NMR (400 MHz, DMSO-d6) 5 8.65 (s, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.5 Hz, 1H), 7.58 - 7.50 (m, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.8, 2.6 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (s, 1H), 6.59 (d, J = 8.0 Hz, 2H), 5.40 (s, 2H), 4.84 (d, J = 9.0 Hz, 1H), 3.83 (d, J = 1.4 Hz, 3H), 3.35 (d, J = 5.3 Hz, 1H), 2.96 (dd, J = 13.8, 9.6 Hz, 1H). - 1H signal obscured by H ₂ O peak, some residual solvent present (10% wt.). UPLC-MS (basic 2 min) Rt = 1.08 min. m/z = 464.9 for [M+H] ⁺ .

[000739] Step 5: tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[000740] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-

1.3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.500 g, 1.08 mmol, 1.0 eq.) in DMF (5 mL) were added N-Boc-beta-alanine (0.240 g, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.23 mmol, 3.0 eq.) and HATU (0.620 g, 1.61 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 23 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography on a 20 g cartridge eluting with 10-100 % ethyl acetate in iso-hexane to afford the product (0.890 g, 1.12 mmol, assumed quantitative yield).

[000741] 1H NMR (400 MHz, DMSO-d6) 5 10.05 (s, 1H), 8.90 (d, J = 8.3 Hz, 1H), 8.75 (d, J = 4.4 Hz, 1H), 8.52 (d, J = 8.4 Hz, 1H), 7.86 - 7.78 (m, 2H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 - 7.40 (m, 3H), 7.22 (q, J = 8.3 Hz, 2H), 7.15 - 7.05 (m, 2H), 6.88 (s, OH), 4.86 (d, J = 13.2 Hz, 1H), 3.83 (s, 3H), 3.25 (q, J = 6.6 Hz, 1H), 3.01 - 2.91 (m, 1H), 2.68 (s, 5H), 1.38 (s, 11H). - 3H extra. 80% purity by weight due to residual solvent. UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 636.1 for [M+H] ⁺

[000742] Step 6: tert-butyl N-[3-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy -

1.3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-prop yl]carbamate

[000743] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo -propyl]carbamate (0.890 g, 1.12 mmol, 1.0 eq.) in EtOH (18.0 mL) were added hydroxylamine hydrochloride (0.160 g, 2.24 mmol, 2.0 eq.) and DIPEA (0.59 mL, 3.36 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 20 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown oil (1.20 g, 1.79 mmol, assumed quantitative yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 669.2 for [M+H] ⁺

[000744] Step 7: [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-(6-meth oxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate

[000745] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-3- oxo-propyl] carbamate (1.20 g, 1.79 mmol, 1.0 eq) in acetic acid (12.0 mL) was added acetic anhydride (0.51 mL, 5.38 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 74 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 60-100% ethyl acetate in heptane to afford product as a yellow oil (0.430 g, 0.601 mmol, 33% yield).

[000746] 1H NMR (400 MHz, DMSO-d6) 5 9.98 (s, 1H), 8.83 (s, 1H), 7.88 (s, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.71 - 7.57 (m, 1H), 7.55 (t, J = 1.7 Hz, 1H), 7.50 (d, J = 8.0 Hz, 1H), 7.43 (dt, J = 7.7, 1.4 Hz, 1H), 7.25 - 7.01 (m, 5H), 6.88 (d, J = 14.6 Hz, 1H), 6.69 (s, 2H), 4.86 (s, 1H), 3.82 (s, 3H), 3.23 (dq, J = 13.1, 5.9 Hz, 2H), 3.04 - 2.91 (m, 1H), 2.69 (s, 2H), 2.14 (s, 3H), 1.38 (s, 10H). UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 711.2 for [M+H] ⁺ .

[000747] Step 8: tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carb amate

[000748] To a magnetically stirred solution of [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-(6-meth oxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate (0.430 g, 0.601 mmol, 1.0 eq) in acetic acid (8.0 mb) was added zinc (0.390 g, 6.01 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 17 h. The reaction mixture was filtered, washing with acetonitrile and methanol, and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 20-100 % MeCN:H ₂ O eluent (0.05 % TFA) to afford product as an off-white solid (0.15 g, 0.224 mmol, 37% yield). UPLC-MS (basic 6 min): Rt = 2.88 min; m/z = 653.2 for [M+H] ⁺ Separation of enantiomers at this point by SFC at Reach separations.

[000749] Step 9: 3-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethyl]sulfamoyl]phenyl]propanamide;hydrochloride

[000750] A mixture of tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carb amate (0.018 g, 0.0251 mmol, 1.00 eq.) and 4 N HC1 in 1,4-Dioxane solution (1.0 mb, 4.00 mmol, 159 eq.) and the reaction mixture was stirred at RT for 2 h. The reaction mixture was concentrated to dryness to afford product as an off-white solid. (0.015 g, 0.0248 mmol, 99% yield).

[000751] 1H NMR (400 MHz, DMSO-d6) 5 10.35 (s, 1H), 9.23 (s, 2H), 9.06 (s, 2H), 8.87 (d, J = 8.1 Hz, 1H), 7.90 (t, J = 2.0 Hz, 2H), 7.79 (d, J = 8.9 Hz, 1H), 7.71 (s, 1H), 7.63 (d, J = 2.6 Hz, 1H), 7.57 (d, J = 7.9 Hz, 1H), 7.53 - 7.42 (m, 2H), 7.26 (t, J = 7.8 Hz, 1H), 7.18 (t, J = 7.9 Hz, 1H), 7.14 - 7.11 (m, 1H), 7.10 (dd, J = 9.0, 2.6 Hz, 1H), 4.96 (td, J = 9.1, 4.9 Hz, 1H), 3.83 (s, 3H), 3.41 - 3.31 (m, 1H), 3.10 (s, 2H), 3.03 (dd, J = 13.8, 10.0 Hz, 1H), 2.76 (t, J = 6.9 Hz, 2H). - CH overlap with H ₂ O peak, NH2 protons not seen UPLC-MS (acidic 6 min): Rt = 1.75 min; m/z = 553.0 for [M] ⁺ , 100% purity.

Example 32: Exemplary synthesis of Compound 104

[000752] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000753] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (0.100 g, 0.344 mmol, 1.0 eq.) in toluene (2.0 mL) were added DIPEA (0.18 mL, 1.03 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (0.059 g, 0.379 mmol,

1.1 eq.) and T3P (0.21 mL, 0.689 mmol, 2.0 eq.). The resulting mixture was stirred at RT for 20 min then at reflux for 2 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (2 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 4 mL), washed with saturated sodium hydrogen carbonate solution (4 mL), washed with brine (4 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography eluting with 0-60% ethyl acetate in heptane to afford product as a brown solid (0.050 g, 0.122 mmol, 35% yield).

[000754] 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 9.0 Hz, 2H), 7.79 (s, 1H), 7.73 - 7.63 (m, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 5.16 - 5.05 (m, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.8, 4.4 Hz, 1H), 3.11 (dd, J = 13.8, 11.0 Hz, 1H), 1.30 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.0 for [M+H] ⁺ .

[000755] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile

[000756] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (2.90 g, 7.08 mmol, 1.0 eq,) in DCM (29.0 mL) was added trifluoroacetic acid (29.0 mL, 379 mmol, 53.5 eq,) and the reaction mixture was stirred at RT for 20 min. The reaction mixture was concentrated to dryness before being suspended in DCM (25 mL). To this suspension was added K ₂ CO ₃ (6 g) in water (25 mL) and the resulting mixture was vigorously stirred for 20 min. The phases were separated and aqueous was extracted with further DCM (3 x 25 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.99 g, 6.43 mmol, 91% yield) which was used in the next step without further purification.

[000757] 1H NMR (400 MHz, DMSO-d6) 5 7.80 (d, J = 8.9 Hz, 1H), 7.74 (s, 1H), 7.67 (d, J = 7.7 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.06 (dd, J = 8.9, 2.5 Hz, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.5 Hz, 3H), 3.37 (dd, J = 13.5, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 309.9 for [M+H] ⁺

[000758] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000759] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (1.99 g, 6.43 mmol, 1.0 eq,) in DMF (20.0 mL) was added triethylamine (1.3 mL, 9.65 mmol, 1.5 eq,) and the reaction mixture was cooled to 0°C. 3 -nitrobenzene- 1- sulfonyl chloride (1.71 g, 7.72 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 18 h. The reaction mixture was concentrated to dryness and the residue purified by normal phase column chromatography eluting with 10- 100% EtOAc in hexane to afford product (2.00 g, 4.04 mmol, 63% yield).

[000760] 1H NMR (400 MHz, DMSO-d6) 5 9.29 (d, J = 8.5 Hz, 1H), 8.20 (d, J = 8.6 Hz, 1H), 8.09 (s, 1H), 7.88 (d, J = 7.8 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.63 (s, 2H), 7.62 - 7.51 (m, 2H), 7.44 (d, J = 7.8 Hz, 1H), 7.25 (t, J = 7.8 Hz, 1H), 7.11 - 7.04 (m, 1H), 5.17 - 5.07 (m, 1H), 3.82 (s, 3H), 3.39 (dd, J = 14.0, 4.7 Hz, 1H), 3.09 - 2.98 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 min. m/z = 494.5 for [M+H] ⁺ .

[000761] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000762] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (2.00 g, 4.04 mmol, 1.0 eq.) in ethanol (16 mL) and water (8.0 mL) were added iron (2.26 g, 40.4 mmol, 10.0 eq.) and ammonium chloride (1.08 g, 20.2 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH. The filtrate was concentrated to dryness and the residue taken up in DCM (20 mL). The organic layer was washed with aq. saturated NaHCO3 solution (20 mL) and the aqueous was extracted with further DCM (3 x 20 mL). The combined organics were then dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a brown oil (1.61 g, 3.47 mmol, 86% yield) which was used in the next step without further purification.

[000763] 1H NMR (400 MHz, DMSO-d6) 5 8.65 (s, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.5 Hz, 1H), 7.58 - 7.50 (m, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.8, 2.6 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (s, 1H), 6.59 (d, J = 8.0 Hz, 2H), 5.40 (s, 2H), 4.84 (d, J = 9.0 Hz, 1H), 3.83 (d, J = 1.4 Hz, 3H), 3.35 (d, J = 5.3 Hz, 1H), 2.96 (dd, J = 13.8, 9.6 Hz, 1H). - 1H signal obscured by H ₂ O peak, some residual solvent present (10% wt.). UPLC- MS (basic 2 min) Rt = 1.08 min. m/z = 464.9 for [M+H] ⁺ .

[000764] Step 5: tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[000765] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-

1.3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.500 g, 1.08 mmol, 1.0 eq.) in DMF (5 mL) were added N-Boc-beta-alanine (0.240 g, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.23 mmol, 3.0 eq.) and HATU (0.620 g, 1.61 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 23 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography on a 20 g cartridge eluting with 10-100 % ethyl acetate in iso-hexane to afford the product (0.890 g, 1.12 mmol, assumed quantitative yield).

[000766] 1H NMR (400 MHz, DMSO-d6) 5 10.05 (s, 1H), 8.90 (d, J = 8.3 Hz, 1H), 8.75 (d, J = 4.4 Hz, 1H), 8.52 (d, J = 8.4 Hz, 1H), 7.86 - 7.78 (m, 2H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 - 7.40 (m, 3H), 7.22 (q, J = 8.3 Hz, 2H), 7.15 - 7.05 (m, 2H), 6.88 (s, OH), 4.86 (d, J = 13.2 Hz, 1H), 3.83 (s, 3H), 3.25 (q, J = 6.6 Hz, 1H), 3.01 - 2.91 (m, 1H), 2.68 (s, 5H), 1.38 (s, 11H). - 3H extra. 80% purity by weight due to residual solvent. UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 636.1 for [M+H] ⁺ .

[000767] Step 6: tert-butyl N-[3-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy -

1.3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-prop yl]carbamate

[000768] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo -propyl]carbamate (0.890 g, 1.12 mmol, 1.0 eq.) in EtOH (18.0 mL) were added hydroxylamine hydrochloride (0.160 g, 2.24 mmol, 2.0 eq.) and DIPEA (0.59 mL, 3.36 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 20 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as a brown oil (1.20 g, 1.79 mmol, assumed quantitative yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 669.2 for [M+H] ⁺ .

[000769] Step 7: [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-(6-meth oxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate

[000770] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-3- oxo-propyl] carbamate (1.20 g, 1.79 mmol, 1.0 eq) in acetic acid (12.0 mL) was added acetic anhydride (0.51 mL, 5.38 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 74 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 60-100% ethyl acetate in heptane to afford product as a yellow oil (0.430 g, 0.601 mmol, 33% yield).

[000771] 1H NMR (400 MHz, DMSO-d6) 5 9.98 (s, 1H), 8.83 (s, 1H), 7.88 (s, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.71 - 7.57 (m, 1H), 7.55 (t, J = 1.7 Hz, 1H), 7.50 (d, J = 8.0 Hz, 1H), 7.43 (dt, J = 7.7, 1.4 Hz, 1H), 7.25 - 7.01 (m, 5H), 6.88 (d, J = 14.6 Hz, 1H), 6.69 (s, 2H), 4.86 (s, 1H), 3.82 (s, 3H), 3.23 (dq, J = 13.1, 5.9 Hz, 2H), 3.04 - 2.91 (m, 1H), 2.69 (s, 2H), 2.14 (s, 3H), 1.38 (s, 10H). UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 711.2 for [M+H] ⁺ .

[000772] Step 8: tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carb amate

[000773] To a magnetically stirred solution of [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-(6-meth oxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate (0.430 g, 0.601 mmol, 1.0 eq) in acetic acid (8.0 mL) was added zinc (0.390 g, 6.01 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 17 h. The reaction mixture was filtered, washing with acetonitrile and methanol, and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 20-100 % MeCN:H ₂ O eluent (0.05 % TFA) to afford product as an off-white solid (0.15 g, 0.224 mmol, 37% yield). UPLC-MS (basic 6 min): Rt = 2.88 min; m/z = 653.2 for [M+H] ⁺ . Separation of enantiomers at this point by SFC at Reach separations.

[000774] Step 9: 3-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethy 1] sulfamoyl] phenyl] propanamide; dihydrochloride

[000775] A mixture of tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carb amate (0.015 g, 0.0226 mmol, 1.00 eq.) and 4 N HC1 in 1,4-Dioxane solution (1.0 mb, 4.00 mmol, 177 eq.) and the reaction mixture was stirred at RT for 2 h. The reaction mixture was concentrated to dryness to afford product as an off-white solid. (0.014 g, 0.0216 mmol, 96% yield).

[000776] 1H NMR (400 MHz, DMSO-d6) 5 10.39 (s, 1H), 9.24 (s, 2H), 9.10 (s, 2H), 8.87 (d, J = 8.1 Hz, 1H), 7.95 (s, 3H), 7.90 (t, J = 2.0 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.71 (d, J = 2.0 Hz, 1H), 7.63 (d, J = 2.6 Hz, 1H), 7.57 (dd, J = 7.8, 1.8 Hz, 1H), 7.54 - 7.42 (m, 2H), 7.25 (t, J =

7.7 Hz, 1H), 7.18 (t, J = 7.9 Hz, 1H), 7.15 - 7.11 (m, 1H), 7.14 - 7.06 (m, 2H), 4.95 (td, J = 8.9,

4.7 Hz, 1H), 3.83 (s, 3H), 3.44 - 3.34 (m, 1H), 3.10 (s, 2H), 3.02 (dd, J = 13.8, 10.0 Hz, 1H), 2.77 (t, J = 6.9 Hz, 2H). - CH overlap with H ₂ O peak. UPLC-MS (acidic 6 min): Rt = 1.74 min; m/z = 553.0 for [M] ⁺ , 99% purity.

Example 33: Exemplary synthesis of Compound 104

[000777] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000778] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.3 g, 42.4 mmol, 1.0 eq.) in toluene (300 mL) were added DIPEA (11.0 mL, 63.6 mmol, 1.5 eq.), 2-amino-5-methoxy-benzenethiol (7.23 g, 46.6 mmol, 1.1 eq.) and T3P (30.0 mL, 50.8 mmol, 1.2 eq.). The resulting mixture was stirred at reflux for 16 h. The reaction mixture was then concentrated to dryness and the residue redissolved in EtOAc (200 mL), washed with saturated sodium hydrogen carbonate solution (2 x 100 mL), washed with brine (100 mL), dried over anhydrous sodium sulfate filtered and concentrated to dryness.

The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in hexane followed by a second purification via normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in hexane to afford product (5.33 g, 13.0 mmol, 31% yield) as a brown solid that was used without further analysis. UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.1 for [M+H] ⁺

[000779] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000780] A magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (5.33 g, 13.0 mmol, 1.0 eq,) in 4 N HC1 in 1,4-dioxane (55.0 mL, 220 mmol, 16.9 eq.) was stirred at RT for 4.5 h. The reaction mixture was concentrated to dryness to afford product (2.24 g, 6.48 mmol, 50% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.04 (s, 3H), 7.92 - 7.85 (m, 1H), 7.80 - 7.75 (m, 1H), 7.73 - 7.65 (m, 2H), 7.57 - 7.51 (m, 1H), 7.46 (q, J = 7.9 Hz, 1H), 7.17 - 7.07 (m, 1H), 5.21 (s, 1H), 3.79 (dd, J = 6.9, 3.0 Hz, 3H), 3.49 (d, J = 6.7 Hz, 1H), 3.33 (dt, J = 13.8, 8.0 Hz, 1H). UPLC- MS (basic 2 min) Rt = 1.03 min. m/z = 311.1 for [M+H] ⁺

[000781] Step 4: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000782] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (2.20 g, 7.11 mmol, 1.0 eq,) in DMF (25.0 mL) was added triethylamine (3.5 mL, 24.9 mmol, 3.5 eq,) and the reaction mixture was cooled to 0°C for 10 min. 3- nitrobenzene-1 -sulfonyl chloride (1.89 g, 8.53 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was stirred at this temperature for a further 10 min before being allowed to warm to RT for 1 h. The reaction was diluted with EtOAc (100 mL), washed with brine (100 mL), aq. saturated Na ₂ CO ₃ (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated to dryness. The residue was triturated with DCM and filtered under vacuum to afford the product (2.09 g, 4.23 mmol, 60% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 9.31 (s, 1H), 8.20 (d, J = 8.4 Hz, 1H), 8.08 (d, J = 2.0 Hz, 1H),

7.87 (d, J = 7.8 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.63 (d, J = 2.5 Hz, 2H), 7.62 - 7.52 (m, 2H), 7.44 (d, J = 7.8 Hz, 1H), 7.25 (t, J = 7.8 Hz, 1H), 7.08 (dd, J = 8.9, 2.5 Hz, 1H), 5.11 (s, 1H), 3.83 (s, 3H), 3.40 (s, 1H), 3.06 - 2.99 (m, 1H). UPLC-MS (basic 2 min) Rt = 1.12 min. m/z = 495.0 for [M+H] ⁺

[000783] Step 5: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000784] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (2.09 g, 4.23 mmol, 1.0 eq.) in ethanol (22.0 mL) and water (11.0 mb) were added iron (2.36 g, 42.3 mmol, 10.0 eq.) and ammonium chloride (1.13 g, 21.2 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 18 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness and the residue taken up in DCM (50 mL). The organic layer was washed with aq. saturated Na ₂ CO ₃ solution (50 mL) and the aqueous was extracted with further DCM (2 x 40 mL). The combined organics were then washed with brine (50 mL), dried over anhydrous sodium sulfate, filtered and concentrated to dryness to afford product (0.650 g, 1.40 mmol, 33% yield) as a beige foam which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 7.80 (dd, J = 12.7, 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.58 - 7.50 (m, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.32 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (s, 1H), 6.58 (d, J = 8.0 Hz, 2H), 5.41 (s, 2H), 4.83 (d, J = 9.7 Hz, 1H), 3.82 (s, 3H), 2.96 (dd, J = 13.7, 9.8 Hz, 1H). - residual DCM (1.97% by weight), CH overlap with H ₂ O peak, NH peak not seen (expected at 8.71 ppm). UPLC-MS (basic 2 min) Rt = 1.07 min. m/z = 465.2 for [M+H] ⁺

[000785] Step 6: tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[000786] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.650 g, 1.40 mmol, 1.0 eq.) in DMF (6 mL) were added N-Boc-beta-alanine (0.318 g, 1.68 mmol, 1.2 eq.), DIPEA (0.73 mL, 4.20 mmol, 3.0 eq.) and HATU (0.798 g, 2.10 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 18 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography on a 20 g cartridge eluting with 0-100 % EtOAc in isohexane. The impure fractions were combined and repurified via normal phase column chromatography on a 20 g cartridge eluting with 0-100% EtOAc in isohexane and combined with the pure fractions of the first column to afford the product (0.908 g, 1.43 mmol, assumed quantitative yield yield) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) 5 10.06 (s, 1H), 8.91 (d, J = 8.3 Hz, 1H), 8.75 (d, J = 4.4 Hz, 1H), 8.52 (d, J = 8.4 Hz, 1H), 7.82 (d, J = 9.4 Hz, 2H), 7.65 (d, J = 2.6 Hz, 1H), 7.54 (s, 1H), 7.52 - 7.42 (m, 3H), 7.22 (q, J = 8.3 Hz, 2H), 7.15 - 7.06 (m, 2H), 6.89 (s, 1H), 4.91 - 4.83 (m, 1H), 3.83 (s, 3H), 3.37 (d, J = 4.6 Hz, 1H), 3.24 (q, J = 6.7 Hz, 2H), 3.00 - 2.92 (m, 1H), 2.69 (s, 1H), 1.38 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.14 mm. m/z = 636.2 for [M+H] ⁺

[000787] Step 7: tert-butyl N-[3-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy - l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl] carbamate

[000788] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo -propyl]carbamate (0.908 g, 1.43 mmol, 1.0 eq.) in EtOH (18.0 mL) were added hydroxylamine hydrochloride (0.198 g, 2.86 mmol, 2.0 eq.) and DIPEA (0.75 mL, 4.28 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 16 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (1.39 g, 2.08 mmol, assumed quantitative yield) as a yellow oil which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 669.2 for [M+H] ⁺

[000789] Step 8: [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-(6-meth oxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate

[000790] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-3- oxo-propyl] carbamate (0.955 g, 1.43 mmol, 1.0 eq) in acetic acid (12.0 mL) was added acetic anhydride (0.41 mL, 4.28 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 16 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (40 g cartridge) eluting with 0-100% EtOAc in DCM to afford product as a yellow oil (0.494 g, 0.695 mmol, 49% yield). 1H NMR (400 MHz, DMSO-d6) 5 9.98 (s, 1H), 8.84 (s, 1H), 7.88 (s, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.62 - 7.46 (m, 3H), 7.43 (d, J = 7.7 Hz, 1H), 7.23 - 7.03 (m, 5H), 6.88 (s, 1H), 6.71 (s, 2H), 4.86 (s, 1H), 3.81 (s, 3H), 3.22 (q, J = 6.8 Hz, 2H), 3.07 - 2.91 (m, 2H), 2.45 (d, J = 7.0 Hz, 2H), 2.14 (s, 3H), 1.38 (s, 9H). - residual EtOAc (9.78% by weight) and DCM (1.49% by weight). UPLC-MS (basic 2 min): Rt = 1.08 min; m/z = 711.3 for [M+H] ⁺

[000791] Step 9: tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carb amate

[000792] To a magnetically stirred solution of [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-(6-meth oxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate (0.494 g, 0.695 mmol, 1.0 eq) in acetic acid (8.0 mL) was added zinc (0.454 g, 6.95 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 18 h. Further zinc (0.454 g, 6.95 mmol, 10.0 eq.) was added and the reaction mixture was stirred for a further 24 h. The reaction mixture was filtered, washing with acetonitrile, ethanol and DCM and concentrated to dryness. The residue was sent to Reach for chiral purification via SFC (Chiralpak IH 20 mm x 250 mm, 5 um) eluting with 25:75 EtOH:CO ₂ (+0.2% v/v NH ₃ ). This afforded the desired product (0.080 g, 0.123 mmol, 15% yield) as an off- white film. UPLC-MS (basic 2 min): Rt = 1.04 min; m/z = 653.1 for [M+H] ⁺ Reach determined the chiral purity (Chiralpak IH) to be 99.8% in favour of the 1 ^st eluting enantiomer (Rt 6.142 min).

[000793] Step 10: 3-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]phenyl]propanamide

[000794] A mixture of tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carb amate (0.080 g, 0.123 mmol, 1.00 eq.) and 4 N HC1 in 1,4-Dioxane solution (2.0 mL, 8.00 mmol, 65.0 eq.) and the reaction mixture was stirred at RT for 2 h. The reaction mixture was concentrated to dryness, suspended in water and redried to afford product (0.069 g, 0.125 mmol, assumed quantitative yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 10.43 (s, 1H), 9.27 (s, 2H), 9.15 (s, 2H), 8.90 (d, J = 8.0 Hz, 1H), 8.00 (s, 2H), 7.89 (q, J = 1.8 Hz, 1H), 7.80 (dd, J = 8.9, 1.5 Hz, 1H), 7.71 (d, J = 2.1 Hz, 1H), 7.64 (dd, J = 2.6, 1.5 Hz, 1H), 7.57 (d, J = 7.8 Hz, 1H), 7.53 - 7.47 (m, 1H), 7.44 (d, J = 7.7 Hz, 1H), 7.20 (dtd, J = 21.8, 7.7, 1.5 Hz, 2H), 7.14 - 7.07 (m, 2H), 4.94 (q, J = 7.8 Hz, 1H), 3.83 (s, 3H), 3.40 - 3.31 (m, 1H), 3.10 (d, J = 6.6 Hz, 2H), 3.05 - 2.96 (m, 1H), 2.79 (t, J = 7.0 Hz, 2H). UPLC-MS (acidic 6 min): Rt = 1.56 min; m/z = 553.1 for [M+H] ⁺ , 96% purity

Example 34: Exemplary synthesis of Compound 104

[000795] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000796] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.3 g, 42.4 mmol, 1.0 eq.) in toluene (300 mL) were added DIPEA (11.0 mL, 63.6 mmol, 1.5 eq.), 2-amino-5-methoxy-benzenethiol (7.23 g, 46.6 mmol, 1.1 eq.) and T3P (30.0 mL, 50.8 mmol, 1.2 eq.). The resulting mixture was stirred at reflux for 16 h. The reaction mixture was then concentrated to dryness and the residue redissolved in EtOAc (200 mL), washed with saturated sodium hydrogen carbonate solution (2 x 100 mL), washed with brine (100 mL), dried over anhydrous sodium sulfate filtered and concentrated to dryness.

The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in hexane followed by a second purification via normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in hexane to afford product (5.33 g, 13.0 mmol, 31% yield) as a brown solid that was used without further analysis. UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.1 for [M+H] ⁺

[000797] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000798] A magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (5.33 g, 13.0 mmol, 1.0 eq,) in 4 N HC1 in 1,4-dioxane (55.0 mL, 220 mmol, 16.9 eq.) was stirred at RT for 4.5 h. The reaction mixture was concentrated to dryness to afford product (2.24 g, 6.48 mmol, 50% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.04 (s, 3H), 7.92 - 7.85 (m, 1H), 7.80 - 7.75 (m, 1H), 7.73 - 7.65 (m, 2H), 7.57 - 7.51 (m, 1H), 7.46 (q, J = 7.9 Hz, 1H), 7.17 - 7.07 (m, 1H), 5.21 (s, 1H), 3.79 (dd, J = 6.9, 3.0 Hz, 3H), 3.49 (d, J = 6.7 Hz, 1H), 3.33 (dt, J = 13.8, 8.0 Hz, 1H). UPLC- MS (basic 2 min) Rt = 1.03 min. m/z = 311.1 for [M+H] ⁺

[000799] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000800] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (2.20 g, 7.11 mmol, 1.0 eq,) in DMF (25.0 mL) was added triethylamine (3.5 mL, 24.9 mmol, 3.5 eq,) and the reaction mixture was cooled to 0°C for 10 min. 3- nitrobenzene-1 -sulfonyl chloride (1.89 g, 8.53 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was stirred at this temperature for a further 10 min before being allowed to warm to RT for 1 h. The reaction was diluted with EtOAc (100 mL), washed with brine (100 mL), aq. saturated Na ₂ CO ₃ (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated to dryness. The residue was triturated with DCM and filtered under vacuum to afford the product (2.09 g, 4.23 mmol, 60% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 9.31 (s, 1H), 8.20 (d, J = 8.4 Hz, 1H), 8.08 (d, J = 2.0 Hz, 1H),

7.87 (d, J = 7.8 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.63 (d, J = 2.5 Hz, 2H), 7.62 - 7.52 (m, 2H), 7.44 (d, J = 7.8 Hz, 1H), 7.25 (t, J = 7.8 Hz, 1H), 7.08 (dd, J = 8.9, 2.5 Hz, 1H), 5.11 (s, 1H), 3.83 (s, 3H), 3.40 (s, 1H), 3.06 - 2.99 (m, 1H). UPLC-MS (basic 2 min) Rt = 1.12 min. m/z = 495.0 for [M+H] ⁺

[000801] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000802] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (2.09 g, 4.23 mmol, 1.0 eq.) in ethanol (22.0 mL) and water (11.0 mb) were added iron (2.36 g, 42.3 mmol, 10.0 eq.) and ammonium chloride (1.13 g, 21.2 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 18 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness and the residue taken up in DCM (50 mL). The organic layer was washed with aq. saturated Na ₂ CO ₃ solution (50 mL) and the aqueous was extracted with further DCM (2 x 40 mL). The combined organics were then washed with brine (50 mL), dried over anhydrous sodium sulfate, filtered and concentrated to dryness to afford product (0.650 g, 1.40 mmol, 33% yield) as a beige foam which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 7.80 (dd, J = 12.7, 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.58 - 7.50 (m, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.32 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (s, 1H), 6.58 (d, J = 8.0 Hz, 2H), 5.41 (s, 2H), 4.83 (d, J = 9.7 Hz, 1H), 3.82 (s, 3H), 2.96 (dd, J = 13.7, 9.8 Hz, 1H). - residual DCM (1.97% by weight), CH overlap with H ₂ O peak, NH peak not seen (expected at 8.71 ppm) UPLC-MS (basic 2 min) Rt = 1.07 min. m/z = 465.2 for [M+H] ⁺

[000803] Step 5: tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[000804] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.650 g, 1.40 mmol, 1.0 eq.) in DMF (6 mL) were added N-Boc-beta-alanine (0.318 g, 1.68 mmol, 1.2 eq.), DIPEA (0.73 mL, 4.20 mmol, 3.0 eq.) and HATU (0.798 g, 2.10 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 18 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography on a 20 g cartridge eluting with 0-100 % EtOAc in isohexane. The impure fractions were combined and repurified via normal phase column chromatography on a 20 g cartridge eluting with 0-100% EtOAc in isohexane and combined with the pure fractions of the first column to afford the product (0.908 g, 1.43 mmol, assumed quantitative yield yield) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) 5 10.06 (s, 1H), 8.91 (d, J = 8.3 Hz, 1H), 8.75 (d, J = 4.4 Hz, 1H), 8.52 (d, J = 8.4 Hz, 1H), 7.82 (d, J = 9.4 Hz, 2H), 7.65 (d, J = 2.6 Hz, 1H), 7.54 (s, 1H), 7.52 - 7.42 (m, 3H), 7.22 (q, J = 8.3 Hz, 2H), 7.15 - 7.06 (m, 2H), 6.89 (s, 1H), 4.91 - 4.83 (m, 1H), 3.83 (s, 3H), 3.37 (d, J = 4.6 Hz, 1H), 3.24 (q, J = 6.7 Hz, 2H), 3.00 - 2.92 (m, 1H), 2.69 (s, 1H), 1.38 (s, 9H). - residual EtOAc (6% by weight), DCM (0.42% by weight) and DMF (15% by weight) with CH ₂ proton missing due to overlap with H ₂ O peak; 2 extra aromatic protons seen. UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 636.2 for [M+H] ⁺

[000805] Step 6: tert-butyl N-[3-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy - l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl] carbamate

[000806] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo -propyl]carbamate (0.908 g, 1.43 mmol, 1.0 eq.) in EtOH (18.0 mL) were added hydroxylamine hydrochloride (0.198 g, 2.86 mmol, 2.0 eq.) and DIPEA (0.75 mL, 4.28 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 16 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (1.39 g, 2.08 mmol, assumed quantitative yield) as a yellow oil which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 669.2 for [M+H] ⁺

[000807] Step 7: [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-(6-meth oxy-l,3-benzothiazol-

2-yl)ethyl]phenyl]methylene]amino] acetate

[000808] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-3- oxo-propyl] carbamate (0.955 g, 1.43 mmol, 1.0 eq) in acetic acid (12.0 mL) was added acetic anhydride (0.41 mL, 4.28 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 16 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (40 g cartridge) eluting with 0-100% EtOAc in DCM to afford product as a yellow oil (0.494 g, 0.695 mmol, 49% yield). 1H NMR (400 MHz, DMSO-d6) 5 9.98 (s, 1H), 8.84 (s, 1H), 7.88 (s, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.62 - 7.46 (m, 3H), 7.43 (d, J = 7.7 Hz, 1H), 7.23 - 7.03 (m, 5H), 6.88 (s, 1H), 6.71 (s, 2H), 4.86 (s, 1H), 3.81 (s, 3H), 3.22 (q, J = 6.8 Hz, 2H), 3.07 - 2.91 (m, 2H), 2.45 (d, J = 7.0 Hz, 2H), 2.14 (s, 3H), 1.38 (s, 9H). - residual EtOAc (9.78% by weight) and DCM (1.49% by weight). UPLC-MS (basic 2 min): Rt = 1.08 min; m/z = 711.3 for [M+H] ⁺

[000809] Step 8: tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carb amate

[000810] To a magnetically stirred solution of [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-(6-meth oxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate (0.494 g, 0.695 mmol, 1.0 eq) in acetic acid (8.0 mL) was added zinc (0.454 g, 6.95 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 18 h. Further zinc (0.454 g, 6.95 mmol, 10.0 eq.) was added and the reaction mixture was stirred for a further 24 h. The reaction mixture was filtered, washing with acetonitrile, ethanol and DCM and concentrated to dryness. The residue was sent to Reach for chiral purification via SFC (Chiralpak IH 20 mm x 250 mm, 5 um) eluting with 25:75 EtOH:CO ₂ (+0.2% v/v NH ₃ ). This afforded the desired product (0.090 g, 0.137 mmol, 17% yield) as an off- white film. UPLC-MS (basic 2 min): Rt = 1.04 min; m/z = 653.2 for [M+H] ⁺

[000811] Step 9: 3-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethyl]sulfamoyl]phenyl]propanamide

[000812] A mixture of tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carb amate (0.090 g, 0.137 mmol, 1.00 eq.) and 4 N HC1 in 1,4-Dioxane solution (2.0 mb, 8.00 mmol, 58.3 eq.) and the reaction mixture was stirred at RT for 2 h. The reaction mixture was concentrated to dryness, suspended in water/acetonitrile and redried to afford product (0.095 g, 0.172 mmol, assumed quantitative yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 10.44 (s, 1H), 9.27 (s, 2H), 9.16 (s, 2H), 8.89 (d, J = 8.0 Hz, 1H), 8.01 (s, 2H), 7.89 (t, J = 2.0 Hz, 1H), 7.81 (d, J = 8.9 Hz, 1H), 7.72 (t, J = 1.8 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.57 (d, J = 7.6 Hz, 1H), 7.51 (dt, J = 7.8, 1.6 Hz, 1H), 7.44 (d, J = 7.6 Hz, 1H), 7.26 - 7.08 (m, 4H), 4.98 - 4.91 (m, 1H), 3.83 (s, 3H), 3.36 (dd, 1H), 3.10 (q, J = 6.4 Hz, 2H), 3.01 (dd, J = 13.8, 10.1 Hz, 1H), 2.79 (t, J = 6.9 Hz, 2H). - amidine peaks (9.16 ppm and 9.27 ppm) integrating to 1.5 protons each, product suggested to be free base. UPLC-MS (acidic 6 min): Rt = 1.44 min; m/z = 553.3 for [M+H] ⁺ , 92% purity

Example 35: Exemplary synthesis of Compound 220

[000813] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-ethoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000814] To a stirred solution of 2-(tert-butoxycarbonylamino)-3-(3-cyanophenyl)propanoic acid (1.09 g, 3.75 mmol, 1.0 eq.) and 2-amino-5-ethoxy-benzenethiol (0.763 g, 4.51 mmol, 1.2 eq.) in toluene (11.0 ml) was added DIPEA (2.0 ml, 11.3 mmol, 3.0 eq) and T3P (50% w/w in EtOAc) (4.5 mL, 7.51 mmol, 2.0 eq.). The reaction mixture was heated to reflux for 17 h. The reaction mixture was cooled to RT and then concentrated to dryness. The residue was dissolved in EtOAc (40 mL), washed with aq. saturated sodium hydrogen carbonate solution (2 x 30 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was purified by normal phase column chromatography eluting with 0-100% EtOAc: isohexane to afford product as a brown solid (0.435 g, 1.03 mmol, 27% yield). UPLC-MS (basic 2 min) Rt = 1.26 min. m/z = 424.1 for [M+H] ⁺

[000815] Step 2 : [2-(3-cyanophenyl)-l-(6-ethoxy-l,3-benzothiazol-2-yl)ethyl]a mmonium chloride

[000816] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-ethoxy-l,3- benzothiazol-2-yl)ethyl] carbamate (0.435 g, 1.03 mmol, 1.0 eq.) and 4 N HC1 in dioxane (5.0 mL, 20.0 mmol, 19.5 eq.) was stirred at RT for 2 h. The reaction mixture was then concentrated to dryness to afford product (0.232 g, 0.645 mmol, 63% yield). UPLC-MS (basic 2 min) Rt = 1.09 min. m/z = 324.0 for [M+H] ⁺

[000817] Step 3: N-[2-(3-cyanophenyl)-l-(6-ethoxy-l,3-benzothiazol-2- yl)ethyl]benzenesulfonamide

[000818] To a magnetically stirred solution of [2-(3-cyanophenyl)-l-(6-ethoxy-l,3- benzothiazol-2-yl)ethyl]ammonium chloride (0.232 g, 0.645 mmol, 1.0 eq.) in DMF (4.0 mL) was added tri ethylamine (0.210 mL, 1.49 mmol, 2.3 eq.) and the resulting solution was cooled to 0 °C. Benzenesulphonyl chloride (0.15 mL, 1.19 mmol, 1.85 eq.) was added and the reaction mixture was allowed to warm to RT and stirred for 23 h. The reaction mixture was diluted with EtOAc (20 ml) and brine (20 ml), the phases separated and the aqueous extracted with further EtOAc (2 x 20 ml). The combined organics were washed with aq. saturated sodium hydrogen carbonate solution (20 mL), dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo. The crude material was purified by normal phase column chromatography eluting with 0-100 % EtOAc:heptane to afford product as a brown solid (0.100 g, 0.216 mmol, 33% yield). 1H NMR

(400 MHz, DMSO) 5 8.90 (s, 1H), 7.80 (d, J = 9.0 Hz, 1H), 7.60 (d, J = 16.2 Hz, 2H), 7.54 - 7.49 (m, 2H), 7.48 - 7.40 (m, 3H), 7.33 - 7.26 (m, 3H), 7.11 - 7.05 (m, 1H), 4.96 (d, J = 10.0 Hz, 1H), 4.10 (q, J = 7.0 Hz, 2H), 3.39 - 3.34 (m, 1H), 3.04 - 2.94 (m, 1H), 1.37 (t, J = 7.0 Hz, 3H). UPLC-MS (basic 2 min) Rt = 1.19 min. m/z = 464.0 for [M+H] ⁺

[000819] Step 4: 3-[2-(benzenesulfonamido)-2-(6-ethoxy-l,3-benzothiazol-2-yl) ethyl]-N'- hydroxy-benzamidine

[000820] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-ethoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.100 g, 0.216 mmol, 1.0 eq.) in EtOH (2.0 mL) were added hydroxylamine hydrochloride (0.030 g, 431 mmol, 2.0 eq.) and DIPEA (0.11 mL, 0.647 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 17 h. Further hydroxylamine hydrochloride (20 mg, 0.284 mmol, 1.3 eq.) and DIPEA (0.07 mL, 0.427 mmol, 2 eq.) were added and the reaction mixture was stirred at 85 °C for a further 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.272 g, 0.548 mmol, assumed quantitative yield) which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.05 min. m/z = 497.0 for [M+H] ⁺

[000821] Step 5: [[amino-[3-[2-(benzenesulfonamido)-2-(6-ethoxy-l,3-benzothia zol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000822] To a magnetically stirred solution of 3-[(2S)-2-(benzenesulfonamido)-2-(6-ethoxy- l,3-benzothiazol-2-yl)ethyl]-N'-hydroxy-benzamidine (0.108 g, 0.217 mmol, 1.0 eq.) in acetic acid (3.0 mL) was added acetic anhydride (0.022 mg, 0.217 mmol, 1.0 eq.) and the resulting mixture was stirred at RT for 2.5 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 0- 100% EtOAc:heptane to afford product as a white solid (0.054 g, 0.100 mmol, 46% yield). UPLC-MS (basic 2 mm): Rt = 1.10 mm; m/z = 539.0 for [M+H] ⁺ H NMR analysis: 1H NMR (400 MHz, DMSO) 5 7.77 (d, J = 8.9 Hz, 1H), 7.61 - 7.56 (m, 2H), 7.49 - 7.44 (m, 2H), 7.38 (t, J = 7.4 Hz, 1H), 7.26 (t, J = 7.6 Hz, 2H), 7.21 (d, J = 7.6 Hz, 1H), 7.13 (t, J = 7.6 Hz, 1H), 7.06

(dd, J = 8.9, 2.6 Hz, 1H), 6.72 (s, 1H), 4.91 (q, J = 7.5 Hz, 1H), 4.09 (q, J = 7.0 Hz, 2H), 3.27 (d, J = 5.4 Hz, 1H), 2.99 (dd, J = 13.8, 9.3 Hz, 1H), 2.15 (s, 3H), 1.37 (t, J = 7.0 Hz, 3H).

[000823] Step 6: 3-[2-(benzenesulfonamido)-2-(6-ethoxy-l,3-benzothiazol-2- yl)ethyl]benzamidine

[000824] To a magnetically stirred solution of [[amino-[3-[2-(benzenesulfonamido)-2-(6- ethoxy-l,3-benzothiazol-2-yl)ethyl]phenyl]methylene]amino] acetate (0.054 g, 0.100 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.066 g, 1.00 mmol, 10.0 eq.). The reaction mixture was stirred at room temperature for 20 h. Further zinc (70 mg, 1.06 mmol, 10.6 eq.) and acetic acid (2 mL) were added and the reaction was stirred at RT for a further 7 h. The reaction mixture was filtered through a plug of celite and then concentrated to dryness. The residue was purified by reverse phase prep-HPLC (0.05% TFA) to afford the product (6.2 mg). UPLC-MS (basic 2 min): Rt = 1.04 min; m/z = 481.1 for [M+H] ⁺ , 88% purity. 1H NMR analysis (sample reference 149876-4): 1H NMR (400 MHz, DMSO) 5 7.78 (d, J = 9.1 Hz, 1H), 7.70 (s, 1H), 7.61 (s, 1H), 7.57 (d, J = 8.2 Hz, 1H), 7.47 (d, J = 7.8 Hz, 1H), 6.55 (s, 2H), 6.30 (s, 2H), 4.09 (q, J = 6.9 Hz, 1H), 2.55 (s, 2H), 1.37 (t, J = 6.8 Hz, 1H), 1.24 (s, 2H) (several peaks obscured by solvent peaks and impurity at 7.2 ppm)

Example 36: Exemplary synthesis of Compound 221

[000825] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000826] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 100 mL), washed with saturated sodium hydrogen carbonate solution (50 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford product as a brown solid (4.30 g, 10.5 mmol, 51% yield). 1H NMR (400 MHz, DMSO) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[000827] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000828] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq.) and 4 N HC1 in dioxane (50.0 mb, 200.0 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product as a brown solid (3.97 g, 11.5 mmol, assumed quantitative yield) which was used in the next step without further purification. 1H NMR (400 MHz, DMSO) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.02 min. m/z = 310.0 for [M+H] ⁺

[000829] Step 3: Methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[000830] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.00 g, 2.89 mmol, 1.0 eq.) in DMF (10.0 mL) was added triethylamine (1.21 mL, 8.67 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C. Methyl- 3 -chlorosulfonylbenzoate (0.81 g, 3.47 mmol, 1.2 eq.) was added portion wise at 0°C over 10 min and the reaction mixture was allowed to warm to RT for 4 h. The reaction was quenched via the addition of water (50 mL) and extracted with ethyl acetate (100 mL followed by 50 mL). The combined organics were then washed with brine (2 x 100 mL) and concentrated to dryness. The residue was suspended in DCM (10 mL) and filtered, washing with further DCM (5 mL) afford product as a white solid (0.980 g, 1.93 mmol, 67% yield). 1H NMR (400 MHz, DMSO) 5 9.09

(s, 1H), 7.94 - 7.84 (m, 2H), 7.74 (dd, J = 17.0, 8.3 Hz, 2H), 7.61 (d, J = 12.3 Hz, 2H), 7.53 - 7.38 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.88 (s, 3H), 3.83 (s, 3H), 3.35 (d, J = 14.6 Hz, 1H), 3.05 - 2.94 (m, 1H). UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 508.0 for [M+H] ⁺

[000831] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[000832] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (1.96 g, 3.85 mmol, 1.0 eq.) in THF (40.0 mL) was added a solution of lithium hydroxide (0.48 g, 11.6 mmol, 3.0 eq.) in water (12.0 mL) and the resulting mixture stirred at RT for 5 h. The reaction volume was reduced by half, diluted with water (100 mL) and then extracted with ethyl acetate (2 x 100 mL). The aqueous phase was acidified to pH 1.0 by the slow addition of 1 M HC1, extracted with ethyl acetate (2 x 100 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a white solid (1.82 g, 3.70 mmol, 96% yield). 1H NMR (400 MHz, DMSO) 5 13.30 (s, 1H), 9.06 (d, J = 8.5 Hz, 1H), 7.92 (d, J = 9.0 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 16.4 Hz, 2H), 7.59 (s, 1H), 7.50 (d, J = 7.9 Hz, 1H), 7.41 (q, J = 8.0 Hz, 2H), 7.23 (t, J = 7.8 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.83 (s, 3H), 3.39 - 3.34 (m, 1H), 2.99 (t, J = 12.3 Hz, 1H). UPLC- MS (basic 2 min) Rt = 0.84 min. m/z = 494.0 for [M+H] ⁺

[000833] Step 5: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]-N-[2-(dimethylamino)ethyl]benzamide

[000834] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.280 g, 0.567 mmol, 1.0 eq.) in DMF (3.2 mL) were added N,N-Dimethylethylenediamine (0.10 mL, 0.681 mmol, 1.2 eq.), DIPEA (0.30 mL, 1.70 mmol, 3.0 eq.) and HATU (0.320 g, 0.851 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 24 h. Further N,N-Dimethylethylenediamine (30 mg, 0.340 mmol, 0.6 eq.) and HATU (0.162 g, 0.425 mmol, 0.75 eq.) were added and the reaction was stirred at RT for a further 3 h. The reaction mixture was diluted with ethyl acetate (100 mL), washed with brine

(100 mL), saturated sodium hydrogen carbonate solution (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-100 % ethyl acetate in heptane followed by 0-15% methanol in ethyl acetate to afford product as a white solid (0.136 g, 0.241 mmol, 43% yield). 1H NMR (400 MHz, DMSO) 5 9.03 (d, J = 8.2 Hz, 1H), 8.51 (s, 1H), 7.94 - 7.85 (m, 2H), 7.83 - 7.78 (m, 1H), 7.65 (s, 1H), 7.57 (d, J = 10.4 Hz, 2H), 7.46 (d, J = 8.1 Hz, 1H), 7.39 (q, J = 7.6 Hz, 1H), 7.18 (t, J = 7.7 Hz, 1H), 7.09 (d, J = 8.9 Hz, 1H), 5.02 (s, 1H), 4.02 (q, J = 7.0 Hz, 1H), 3.83 (d, J = 1.8 Hz, 3H), 3.38 (d, J = 6.6 Hz, 2H), 2.95 (t, J = 12.3 Hz, 1H), 2.44 (t, J = 7.0 Hz, 2H), 2.21 (s, 4H), 1.99 (s, 2H). UPLC-MS (basic 2 mm) Rt = 1.04 mm. m/z = 564.0 for [M+H] ⁺

[000835] Step 6: N-[2-(dimethylamino)ethyl]-3-[[2-[3-(N'-hydroxycarbamimidoyl )phenyl]-l- (6-methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzamide

[000836] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]-N-[2-(dimethylamino)ethyl ]benzamide (0.136 g, 0.241 mmol, 1.0 eq.) in EtOH (4.0 mL) were added hydroxylamine hydrochloride (0.034 g, 0.483 mmol, 2.0 eq.) and DIPEA (0.13 mL, 0.724 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 20 h. Further hydroxylamine hydrochloride (0.017 g, 0.241 mmol, 1.0 eq.) and DIPEA (0.065 mL, 0.362 mmol, 1.5 eq.) were added and the reaction was stirred at 85 °C for a further 6 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product as an off-white oil (0.14 g, 0.241 mmol) UPLC-MS (basic 2 min) Rt = 0.94 min. m/z = 597.0 for [M+H] ⁺

[000837] Step 7: [ [amino- [3- [2- [[3- [2-

(dimethylamino)ethylcarbamoyl]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000838] To a magnetically stirred solution of N-[2-(dimethylamino)ethyl]-3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-1-(6-methoxy- 1 ,3 -benzothiazol-2-yl)ethyl] sulfamoyl]benzamide (0.14 g, 0.241 mmol, 1.0 eq) in acetic acid (1.5 mL) was added acetic anhydride (0.068 mL,

0.724 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 24 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-100% ethyl acetate in heptane followed by 0- 25% methanol in ethyl acetate to afford product as a white solid (0.045 g, 0.0704 mmol, 29% yield). 1H NMR (400 MHz, DMSO) 5 9.46 (s, 1H), 9.00 (d, J = 8.1 Hz, 1H), 8.74 (s, 1H), 7.94 (s, 1H), 7.83 (d, J = 7.9 Hz, 1H), 7.77 (d, J = 8.8 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.51 (s, 1H), 7.43 - 7.31 (m, 2H), 7.22 (d, J = 7.5 Hz, 1H), 7.07 (d, J = 8.2 Hz, 2H), 6.71 (s, 2H), 4.93 (s, 1H), 3.82 (s, 3H), 3.58 (s, 2H), 3.05 - 2.95 (m, 1H), 2.78 (s, 4H), 2.16 (s, 2H). UPLC-MS (basic 2 mm): Rt = 0.98 min; m/z = 639.2 for [M+H] ⁺

[000839] Step 8: 3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiazol- 2- yl)ethyl]sulfamoyl]-N-[2-(dimethylamino)ethyl]benzamide

[000840] To a magnetically stirred solution of [ [amino- [3 - [2- [ [3 - [2- (dimethylamino)ethylcarbamoyl]phenyl]sulfonylamino]-2-(6-met hoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.045 g, 0.0704 mmol, 1.0 eq) in acetic acid (1.5 mL) was added zinc (0.092 g, 1.41 mmol, 20 eq.). The reaction mixture was stirred at room temperature for 24 h. Further zinc (0.092 g, 1.41 mmol, 20 eq.) was added and the reaction stirred for a further 24 h at RT. The reaction mixture was filtered, washing with copious acetonitrile, ethanol and DCM and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 20-100 % MeCN:H ₂ O eluent (0.05 % TFA) followed by a second purification by reverse phase preparative-HPLC eluting with a 5-100% MeCN:H ₂ O eluent (0.1% NH ₃ ) to afford product as a white solid (0.015 g, 0.0248 mmol, 35% yield). UPLC- MS (acidic 6 min): Rt = 1.56 min; m/z = 581.2 for [M+H] ⁺ , 96% purity. 1H NMR (400 MHz, DMSO) 5 8.46 (s, 1H), 7.94 (s, 1H), 7.73 (d, J = 8.6 Hz, 2H), 7.61 (s, 1H), 7.57 - 7.50 (m, 2H), 7.44 (d, J = 7.8 Hz, 1H), 7.27 (d, J = 7.9 Hz, 2H), 7.15 (t, J = 7.6 Hz, 1H), 7.03 (dd, J = 9.0, 2.6 Hz, 1H), 4.82 (s, 1H), 3.81 (s, 3H), 2.97 (t, J = 11.4 Hz, 1H), 2.41 (t, J = 6.9 Hz, 2H), 2.19 (s, 6H)

Example 37: Exemplary synthesis of Compound 222

[000841] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000842] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 100 mL), washed with saturated sodium hydrogen carbonate solution (50 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford product (4.30 g, 10.5 mmol, 51% yield) as a brown solid. 1H NMR (400 MHz, DMSO) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[000843] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000844] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq.) and 4 N HC1 in dioxane (50.0 mb, 200.0 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product (3.97 g, 11.5 mmol, assumed quantitative yield), as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.02 min. m/z = 310.0 for [M+H] ⁺

[000845] Step 3: Methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[000846] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.00 g, 2.89 mmol, 1.0 eq.) in DMF (10.0 mL) was added triethylamine (1.21 mL, 8.67 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C. Methyl- 3 -chlorosulfonylbenzoate (0.81 g, 3.47 mmol, 1.2 eq.) was added portion wise at 0°C over 10 min and the reaction mixture was allowed to warm to RT for 4 h. The reaction was quenched via the addition of water (50 mL) and extracted with ethyl acetate (100 mL followed by 50 mL). The combined organics were then washed with brine (2 x 100 mL) and concentrated to dryness. The residue was suspended in DCM (10 mL) and filtered, washing with further DCM (5 mL) afford product (0.980 g, 1.93 mmol, 67% yield) as a white solid. 1H NMR (400 MHz, DMSO) 5 9.09 (s, 1H), 7.94 - 7.84 (m, 2H), 7.74 (dd, J = 17.0, 8.3 Hz, 2H), 7.61 (d, J = 12.3 Hz, 2H), 7.53 - 7.38 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.88 (s, 3H), 3.83 (s, 3H), 3.35 (d, J = 14.6 Hz, 1H), 3.05 - 2.94 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.13 mm. m/z = 508.0 for [M+H] ⁺

[000847] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[000848] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (1.96 g, 3.85 mmol, 1.0 eq.) in THF (40.0 mL) was added a solution of lithium hydroxide (0.48 g, 11.6 mmol, 3.0 eq.) in water (12.0 mL) and the resulting mixture stirred at RT for 5 h. The reaction volume was reduced by half, diluted with water (100 mL) and then extracted with ethyl acetate (2 x 100 mL). The aqueous phase was acidified to pH 1.0 by the slow addition of 1 M HC1, extracted with ethyl acetate (2 x 100 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (1.82 g, 3.70 mmol, 96% yield) as a white solid. 1H NMR (400 MHz, DMSO) 5 13.30 (s, 1H), 9.06 (d, J = 8.5 Hz, 1H), 7.92 (d, J = 9.0 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 16.4 Hz, 2H), 7.59 (s, 1H), 7.50 (d, J = 7.9 Hz, 1H), 7.41 (q, J = 8.0 Hz, 2H), 7.23 (t, J = 7.8 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.83 (s, 3H), 3.39 - 3.34 (m, 1H), 2.99 (t, J = 12.3 Hz, 1H). Contains ca. 1 eq. of ethyl acetate. UPLC-MS (basic 2 min) Rt = 0.84 min. m/z = 494.0 for [M+H] ⁺

[000849] Step 5: tert-butyl N-[3-[[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]sulfamoyl]benzoyl]amino]propyl]carbamate

[000850] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.300 g, 0.608 mmol, 1.0 eq.) in DMF (3.4 mL) were added N-Boc-l,3-propanediamine (0.130 g, 0.729 mmol, 1.2 eq.), DIPEA (0.32 mL, 1.82 mmol, 3.0 eq.) and HATU (0.350 g, 0.912 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 22 h. Further N-Boc- 1,3 -propanediamine (64 mg, 0.365 mmol, 0.6 eq.) and HATU (0.173 g, 0.456 mmol, 0.75 eq.) were added and the reaction was stirred at RT for a further 3 h. The reaction mixture was diluted with ethyl acetate (100 mL), washed with brine (100 mL), saturated sodium hydrogen carbonate solution (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was purified by normal phase column chromatography (20 g cartridge) eluting with 20-100% EtO Ac: heptane to afford product (0.343 g, 0.528 mmol, 87% yield) as a colorless glass. 1H NMR (400 MHz, DMSO) 5 9.02 (s, 1H), 8.54 (s, 1H), 7.93 (s, 1H), 7.87 (d, J = 7.7 Hz, 1H), 7.80 (d, J = 9.1 Hz, 1H), 7.64 (s, 1H), 7.57 (d, J = 9.0 Hz, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.43 - 7.33 (m, 2H), 7.18 (t, J = 7.8 Hz, 1H), 7.08 (d, J =

9.1 Hz, 1H), 6.86 (s, 1H), 5.01 (s, 1H), 3.83 (s, 3H), 3.27 (d, J = 6.5 Hz, 1H), 2.98 (t, J = 8.4 Hz, 3H), 1.72 - 1.62 (m, 2H), 1.38 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.13 mm. m/z = 650.1 for [M+H] ⁺

[000851] Step 6: tert-butyl N-[3-[[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methox y- l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]amino]propyl]c arbamate

[000852] To a magnetically stirred solution of tert-butyl N-[3-[[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]amino] propyl]carbamate (0.343 g, 0.528 mmol, 1.0 eq.) in EtOH (10.0 mL) were added hydroxylamine hydrochloride (0.073 g, 1.06 mmol, 2.0 eq.) and DIPEA (0.28 mL, 1.58 mmol, 3.0 eq.). The reaction mixture was stirred at reflux for 18 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.36 g, 0.527 mmol, assumed quantitative yield), as a colorless oil, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z =

683.1 for [M+H] ⁺

[000853] Step 7: [[amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propylcarbamoyl]phenyl]sulfonylamino]-2-(6-met hoxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate

[000854] To a magnetically stirred solution of tert-butyl N-[3-[[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl] -1-(6-methoxy- 1 ,3 -benzothiazol-2- yl)ethyl]sulfamoyl]benzoyl]amino]propyl]carbamate (0.360 g, 0.527 mmol, 1.0 eq) in acetic acid

(4.0 mL) was added acetic anhydride (0.150 mL, 1.58 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 24 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 40-100% EtO Ac: isohexane to afford product (0.228 g, 0.317 mmol, 60% yield) as a white solid. 1H NMR (400 MHz, DMSO) 5 8.95 (s, 1H), 8.52 (s, 1H), 7.93 (s, 1H), 7.82 - 7.72 (m, 2H), 7.67 - 7.46 (m, 3H), 7.39 (d, J = 7.8 Hz, 1H), 7.30 (t, J = 7.9 Hz, 1H), 7.21 (t, J = 8.5 Hz, 1H), 7.09 (d, J = 8.8 Hz, 2H), 6.82 (s, 1H), 6.69 (s, 2H), 4.94 (s, 1H), 3.82 (s, 3H), 3.29 - 3.24 (m, 3H), 2.99 (d, J = 8.0 Hz, 4H), 2.15 (s, 3H), 1.73 - 1.59 (m, 2H), 1.38 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.07 min; m/z = 725.2 for [M+H] ⁺

[000855] Step 8: tert-butyl N-[3-[[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]amino]propyl]carba mate

[000856] To a magnetically stirred solution of [ [amino- [3 - [2- [ [3 - [3 -(tert- butoxy carbonylamino)propylcarbamoyl]phenyl]sulfonylamino]-2-(6-met hoxy-l,3-benzothiazol- 2-yl)ethyl]phenyl]methylene]amino] acetate (0.230 g, 0.315 mmol, 1.0 eq) in acetic acid (5.0 mL) was added zinc (0.410 g, 6.29 mmol, 20 eq.). The reaction mixture was stirred at room temperature for 20 h. Further zinc (0.411 g, 6.29 mmol, 20 eq.) was added and the reaction stirred for a further 24 h at RT. The reaction mixture was filtered, washing with copious acetonitrile, ethanol and DCM and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 5-70 % MeCN:H ₂ O eluent (0.2 % TFA) followed by a second purification by reverse phase preparative-HPLC eluting with a 5-100% MeCN:H ₂ O eluent (0.1% NH ₃ ) to afford product (0.057 g, 0.0850 mmol, 27% yield) as a white solid. UPLC- MS (acidic 6 min): Rt = 2.61 min; m/z = 667.2 for [M+H] ⁺ , 99% purity

[000857] Step 9: N-(3-aminopropyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy -l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide

[000858] A magnetically stirred mixture of tert-butyl N-[3-[[3-[[2-(3-carbamimidoylphenyl)- l-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]a mino]propyl]carbamate (0.057 g, 0.0855 mmol, 1.0 eq.) and 4 N HC1 in dioxane (0.85 mL, 3.42 mmol, 40 eq.) was stirred at RT for 3 h before being concentrated in vacuo. The residue was then re-suspended in 4 N HC1 in dioxane (0.85 mL, 3.42 mmol, 40 eq.) and stirred at RT for a further 4 h before being concentrated in vacuo and dried in a vacuum oven to afford product (0.040 g, 0.0706 mmol, 83% yield) as a grey solid. UPLC-MS (acidic 6 min): Rt = 1.58 min; m/z = 567.1 for [M+H] ⁺ , 98% purity. 1H NMR (400 MHz, DMSO) 5 9.24 (s, 2H), 9.09 (s, 2H), 9.00 (d, J = 8.2 Hz, 1H), 8.83 (t, J = 5.7 Hz, 1H), 8.00 - 7.94 (m, 4H), 7.89 (dt, J = 8.0, 1.3 Hz, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.72 (d, J = 1.8 Hz, 1H), 7.64 (d, J = 2.5 Hz, 1H), 7.58 - 7.50 (m, 2H), 7.45 (d, J = 7.7 Hz, 1H), 7.32 (t, J = 7.8 Hz, 1H), 7.19 (t, J = 7.8 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.10 - 4.99 (m, 1H), 3.83 (s, 3H), 3.42 - 3.30 (m, 3H), 3.03 (dd, J = 13.8, 10.2 Hz, 1H), 2.86 (q, J = 6.6 Hz, 2H), 1.86 (p, J = 6.9 Hz, 2H)

Example 38: Exemplary synthesis of Compound 223

[000859] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000860] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 100 mL), washed with saturated sodium hydrogen carbonate solution (50 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford product (4.30 g, 10.5 mmol, 51% yield) as a brown solid. 1H NMR (400 MHz, DMSO) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[000861] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000862] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq.) and 4 N HC1 in dioxane (50.0 mL, 200.0 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product (3.97 g, 11.5 mmol, assumed quantitative yield), as a brown solid. 1H NMR (400 MHz, DMSO) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 310.0 for [M+H] ⁺

[000863] Step 3: Methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[000864] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.00 g, 2.89 mmol, 1.0 eq.) in DMF (10.0 mL) was added triethylamine (1.21 mL, 8.67 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C. Methyl- 3 -chlorosulfonylbenzoate (0.81 g, 3.47 mmol, 1.2 eq.) was added portion wise at 0°C over 10 min and the reaction mixture was allowed to warm to RT for 4 h. The reaction was quenched via the addition of water (50 mL) and extracted with ethyl acetate (100 mL followed by 50 mL). The combined organics were then washed with brine (2 x 100 mL) and concentrated to dryness. The residue was suspended in DCM (10 mL) and filtered, washing with further DCM (5 mL) afford product (0.980 g, 1.93 mmol, 67% yield) as a white solid. 1H NMR (400 MHz, DMSO) 5 9.09 (s, 1H), 7.94 - 7.84 (m, 2H), 7.74 (dd, J = 17.0, 8.3 Hz, 2H), 7.61 (d, J = 12.3 Hz, 2H), 7.53 - 7.38 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.88 (s, 3H), 3.83 (s, 3H), 3.35 (d, J = 14.6 Hz, 1H), 3.05 - 2.94 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.13 mm. m/z = 508.0 for [M+H] ⁺

[000865] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[000866] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (1.96 g, 3.85 mmol, 1.0 eq.) in THF (40.0 mL) was added a solution of lithium hydroxide (0.48 g, 11.6 mmol, 3.0 eq.) in water (12.0 mL) and the resulting mixture stirred at RT for 5 h. The reaction volume was reduced by half, diluted with water (100 mL) and then extracted with ethyl acetate (2 x 100 mL). The aqueous phase was acidified to pH 1.0 by the slow addition of 1 M HC1, extracted with ethyl acetate (2 x 100 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (1.82 g, 3.70 mmol, 96% yield) as a white solid. 1H NMR (400 MHz, DMSO) 5 13.30 (s, 1H), 9.06 (d, J = 8.5 Hz, 1H), 7.92 (d, J = 9.0 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 16.4 Hz, 2H), 7.59 (s, 1H), 7.50 (d, J = 7.9 Hz, 1H), 7.41 (q, J = 8.0 Hz, 2H), 7.23 (t, J = 7.8 Hz, 1H), 7.08

(d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.83 (s, 3H), 3.39 - 3.34 (m, 1H), 2.99 (t, J = 12.3 Hz, 1H). UPLC-MS (basic 2 min) Rt = 0.84 min. m/z = 494.0 for [M+H] ⁺

[000867] Step 5: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[000868] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.300 g, 0.608 mmol, 1.0 eq.) in DMF (3.2 mL) were added 2-methoxyethylamine (0.046 g, 0.608 mmol, 1.2 eq.), DIPEA (0.32 mL, 1.82 mmol, 3.0 eq.) and HATU (0.350 g, 0.912 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 6 h. Further 2-methoxyethylamine (0.23 mg, 0.304 mmol, 0.5 eq.) and HATU (0.173 g, 0.456 mmol, 0.75 eq.) were added and the reaction was stirred at RT for a further 18 h. The reaction mixture was diluted with ethyl acetate (100 mL), washed with brine (100 mL), saturated sodium hydrogen carbonate solution (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was dissolved in DCM, leaving behind insoluble material that was dried to afford product (0.154 g, 0.280 mmol, 46% yield) as a white solid. The dissolved material was purified by normal phase column chromatography (20 g cartridge) eluting with 40-100% EtO Ac: heptane to afford product (0.024 g, 0.0436 mmol, 7% yield) as a white solid. 1H NMR (400 MHz, DMSO) 5 8.99 (d, J = 8.4 Hz, 1H), 8.63 (s, 1H), 7.96 - 7.87 (m, 2H), 7.81 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 2.5 Hz, 1H), 7.61 - 7.52 (m, 2H), 7.46 (d, J = 7.9 Hz, 1H), 7.39 (t, J = 8.4 Hz, 2H), 7.17 (t, J = 7.8 Hz, 1H), 7.09 (dd, J = 8.6, 2.4 Hz, 1H), 5.09 - 4.99 (m, 1H), 3.84 (d, J = 1.8 Hz, 3H), 3.54 - 3.42 (m, 3H), 3.37 (dd, J = 13.9, 4.3 Hz, 1H), 3.04 - 2.90 (m, 1H). UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 551.0 for [M+H] ⁺

[000869] Step 6: 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-b enzothiazol- 2-yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[000870] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzami de (0.178 g, 0.323 mmol, 1.0 eq.) in EtOH (6.0 mL) were added hydroxylamine hydrochloride (0.045 g, 0.647 mmol, 2.0 eq.) and DIPEA (0.17 mL, 0.970 mmol, 3.0 eq.). The reaction mixture was stirred at reflux for 20 h.

Further hydroxylamine hydrochloride (0.022 g, 0.323 mmol, 1.0 eq.) and DIPEA (0.084 mL, 0.485 mmol, 1.5 eq.) were added and the reaction mixture was stirred at reflux for a further 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.19 g, 0.324 mmol, assumed quantitative yield). UPLC-MS (basic 2 min) Rt = 0.93 min. m/z = 584.0 for [M+H] ⁺

[000871] Step 7: [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[[3-(2- methoxyethylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]meth ylene]amino] acetate

[000872] To a magnetically stirred solution of 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l- (6-methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]-N-(2-metho xyethyl)benzamide (0.190 g, 0.324 mmol, 1.0 eq) in acetic acid (3.0 mL) was added acetic anhydride (0.092 mL, 0.971 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 20 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 20-100% EtO Ac: isohexane to afford product (0.107 g, 0.171 mmol, 53% yield) as a white solid. 1H NMR (400 MHz, DMSO) 5 8.98 (d, J = 8.2 Hz, 1H), 8.65 (t, J = 5.5 Hz, 1H), 7.92 (t, J = 1.9 Hz, 1H), 7.84 - 7.71 (m, 2H), 7.62 (d, J = 2.6 Hz, 1H), 7.54 (dt, J = 7.9, 1.4 Hz, 1H), 7.49 (s, 1H), 7.39 (d, J = 7.8 Hz, 1H), 7.30 (t, J = 7.8 Hz, 1H), 7.22 (d, J = 7.7 Hz, 1H), 7.10 - 7.01 (m, 2H), 6.71 (s, 2H), 4.94 (td, J = 9.3, 5.0 Hz, 1H), 3.82 (s, 3H), 3.46 (dt, J = 19.1, 5.5 Hz, 4H), 3.33 - 3.24 (m, 5H), 2.96 (dd, J = 13.8, 10.1 Hz, 1H), 2.16 (s, 3H). UPLC- MS (basic 2 min): Rt = 0.99 min; m/z = 626.1 for [M+H] ⁺

[000873] Step 8: 3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiazol- 2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[000874] To a magnetically stirred solution [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)- 2-[[3-(2-methoxyethylcarbamoyl)phenyl]sulfonylamino]ethyl]ph enyl]methylene]amino] acetate (0.110 g, 0.171 mmol, 1.0 eq) in acetic acid (3.0 mL) was added zinc (0.220 g, 3.42 mmol, 20 eq.). The reaction mixture was stirred at RT for 20 h. Further zinc (0.220 g, 3.42 mmol, 20 eq.) was added and the reaction stirred for a further 24 h at RT. Further zinc (0.220 g, 3.42 mmol, 20 eq.) was added and the reaction mixture was stirred at RT for a further 24 h. The reaction mixture was filtered, washing with copious acetonitrile, ethanol and DCM and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 15-100% MeCN/TbO eluent (0.05 % TFA) followed by a second purification by reverse phase preparative-HPLC eluting with a 30-100% MeCN:H ₂ O eluent (0.1% NH ₃ ) to afford product (0.040 g, 0.0705 mmol, 41% yield) as a white solid. UPLC-MS (basic 6 min): Rt = 2.05 min; m/z = 568.1 for [M+H] ⁺ , 98% purity. 1H NMR (400 MHz, DMSO) 5 8.60 (s, 1H), 7.96 (d, J = 1.8 Hz, 1H), 7.72 (dd, J = 8.5, 5.7 Hz, 2H), 7.59 (s, 1H), 7.53 (q, J = 2.9 Hz, 2H), 7.43 (d, J = 7.7 Hz, 1H), 7.30 - 7.20 (m, 2H), 7.12 (t, J = 7.7 Hz, 1H), 7.02 (dd, J = 8.9, 2.6 Hz, 1H), 4.77 (dd, J = 8.8, 4.8 Hz, 1H), 3.80 (s, 3H), 3.47 (dd, J = 6.3, 4.0 Hz, 2H), 3.43 (t, J = 4.7 Hz, 2H), 3.28 (s, 3H), 3.20 (dd, J = 13.4, 4.8 Hz, 1H), 2.96 (dd, J = 13.4, 8.9 Hz, 1H). Chiral analysis by Reach found 50.4% 1 ^st eluting isomer (rt 3.15 min) and 49.6% 2 ^nd eluting isomer (rt 5.14 min).

Example 39: Exemplary synthesis of Compound 103

[000875] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000876] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 100 mL), washed with saturated sodium hydrogen carbonate solution (50 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford product (4.30 g, 10.5 mmol, 51% yield) as a brown solid. 1H NMR (400 MHz, DMSO) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[000877] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000878] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq.) and 4 N HC1 in dioxane (50.0 mL, 200.0 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product (3.97 g, 11.5 mmol, assumed quantitative yield), as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.02 min. m/z = 310.0 for [M+H] ⁺

[000879] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000880] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.00 g, 2.89 mmol, 1.0 eq.) in DMF (10.0 mL) was added triethylamine (1.4 mL, 10.1 mmol, 3.5 eq.) and the reaction mixture was cooled to 0°C. 3- nitrobenzene-1 -sulfonyl chloride (0.77 g, 3.47 mmol, 1.2 eq.) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 1 h. The reaction mixture was diluted with EtOAc (60 mL), washed with brine (60 mL), aq. saturated sodium hydrogen carbonate solution (60 mL) and brine (60 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue purified by reverse phase column chromatography eluting with 40-60% acetonitrile: H ₂ O (0.1% NH ₃ ) to afford product (1.05 g, 2.12 mmol, 73% yield) in two batches. 1H NMR (400 MHz, DMSO-d6) 5 9.31 (s, 1H), 8.20 (d, J = 8.4 Hz, 1H), 8.08 (s, 1H), 7.87 (d, J = 8.0 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.67 - 7.50 (m, 3H), 7.44 (d, J = 7.8 Hz, 1H), 7.24 (t, J = 8.0 Hz, 1H), 7.08 (d, J = 9.1 Hz, 1H), 5.12 (s, 1H), 3.82 (s, 3H), 3.39 (s, OH), 3.08 - 2.97 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 mm. m/z = 495.0 for [M+H] ⁺

[000881] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000882] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (1.05 g, 2.12 mmol, 1.0 eq.) in ethanol (8 mL) and water (4.0 mL) were added iron (1.18 g, 21.2 mmol, 10.0 eq.) and ammonium chloride (0.570 g, 10.6 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 2 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness and the residue taken up in DCM (20 mL). The organic layer was washed with aq. saturated NaHCO3 solution (20 mL) and the aqueous was re-extracted with DCM (2 x 20 mL). The combined organics were then washed with brine (20 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (0.57 g, 1.22 mmol, 58% yield). 1H NMR (400 MHz, DMSO-d6) 5 8.67 (s, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (s, 1H), 7.58 - 7.50 (m, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.32 (t, J = 7.7 Hz, 1H), 7.13 - 7.02 (m, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.72 (s, 1H), 6.58 (t, J = 5.7 Hz, 2H), 5.42 (s, 2H), 4.82 (d, J = 7.5 Hz, 1H), 3.82 (d, J = 1.5 Hz, 3H), 3.32 (d, J = 5.0 Hz, 1H), 2.95 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.06 mm. m/z = 465.0 for [M+H] ⁺

[000883] Step 5: tert-butyl N-[2-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate

[000884] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.190 g, 0.411 mmol, 1.0 eq.) in DMF (2.0 mL ) were added N-alpha-t-BOC-glycine (0.086 g, 0.493 mmol, 1.2 eq.), DIPEA (0.21 mL, 1.23 mmol, 3.0 eq.) and HATU (0.240 g, 0.617 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 5 h. The reaction mixture was diluted with EtOAc (10 mL), washed with brine (10 mL), aq. saturated sodium hydrogen carbonate solution (10 mL) and brine (10 mL) before drying over anhydrous sodium sulfate and being concentrated to dryness to afford the product (0.230 g, 0.365 mmol, 89% yield). 1H NMR (400 MHz, DMSO-d6) 5 10.07 (s, 1H), 8.94 (d, J = 8.4 Hz, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.80 (t, J = 2.0 Hz, 1H), 7.66 (d, J = 2.6 Hz, 1H), 7.53 (s, 2H), 7.51 - 7.41 (m, 2H), 7.32 - 7.18 (m, 2H), 7.16 - 7.11 (m, 2H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 4.87 (td, J = 9.4, 4.4 Hz, 1H), 3.83 (s, 3H), 3.74 (d, J = 6.1 Hz, 2H), 3.37 (d, J = 4.5 Hz, OH), 2.95 (dd, J = 13.9, 10.7 Hz, 1H), 2.69 (s, 2H), 1.41 (s, 8H), 1.24 (d, J = 8.1 Hz, 1H). - 3 wt.% tetramethyl urea, residual EtOAc present, CH overlap with water peak. UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 622.1 for [M+H] ⁺

[000885] Step 6: tert-butyl N-[2-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy - 1 ,3 -benzothiazol-2-yl)ethy 1] sulfamoyl] anilino] -2-oxo-ethyl] carbamate

[000886] To a magnetically stirred solution of tert-butyl N-[2-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo -ethyl]carbamate (0.230 g, 0.365 mmol, 1.0 eq.) in EtOH (5.0 mL) were added hydroxylamine hydrochloride (0.051 g, 0.730 mmol, 2.0 eq.) and DIPEA (0.19 mL, 1.10 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 6 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.360 g, 0.556 mmol, assumed quantitative yield) as an off-white gum which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 655.1 for [M+H] ⁺

[000887] Step 7: [[amino-[3-[2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000888] To a magnetically stirred solution of tert-butyl N-[2-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-2- oxo-ethyl] carbamate (0.360 g, 0.556 mmol, 1.0 eq) in acetic acid (4.0 mb) was added acetic anhydride (0.16 mL, 1.67 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 2 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-100% ethyl acetate: isohexane to afford product (0.140 g, 0.199 mmol, 36% yield). 1H NMR (400 MHz, DMSO-d6) 5 9.99 (s, 1H), 8.85 (s, 1H), 7.89 (s, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.60 (d, J = 2.6 Hz, 1H), 7.54 (s, 1H), 7.48 (d, J = 7.9 Hz, 1H), 7.43 (d, J = 7.7 Hz, 1H), 7.18 (dd, J = 12.7, 7.8 Hz, 2H), 7.15 - 7.02 (m, 4H), 6.68 (s, 2H), 4.86 (s, 1H), 3.82 (s, 3H), 3.72 (d, J = 6.1 Hz, 2H), 3.26 (dd, J = 8.0, 5.8 Hz, 1H), 2.98 (dd, J = 13.8, 9.4 Hz, 1H), 2.69 (s, 2H), 2.15 (s, 3H), 1.41 (s, 8H). - 2 wt.% tetramethyl urea, residual EtOAc present. UPLC-MS (basic 2 min): Rt = 1.08 min; m/z = 697.1 for [M+H] ⁺

[000889] Step 8: tert-butyl N-[2-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carba mate

[000890] To a magnetically stirred solution of [[amino-[3-[2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.140 g, 0.199 mmol, 1.0 eq) in acetic acid (3.0 mL) was added zinc (0.260 g, 3.99 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 17 h. Further zinc (0.081 g, 1.24 mmol, 6.2 eq.) was added and the reaction was stirred at RT for a further 3.5 h. The reaction mixture was filtered and the residue was submitted to Reach for purification and chiral separation. Purification was performed via SFC on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 MeOH:CO ₂ (0.1% v/v NH ₃ ) to afford product (0.029 g, 0.0456 mmol, 16% yield) as a white solid. Reach found the chiral purity to be 100% in favor of the 2 ^nd eluting enantiomer (Rt 6.02 min). UPLC-MS (acidic 2.5 min): rt 1.17 min, m/z = 639.3 [M+H] ⁺

[000891] Step 9: 2-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethyl]sulfamoyl]phenyl]acetamide; dihydrochloride

[000892] To tert-butyl N-[2-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzoth iazol- 2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate (0.029 g, 0.0456 mmol, 1.00 eq.) was added 4 N HC1 in 1,4-Dioxane solution (1.0 mL, 4.00 mmol, 87.7 eq.) and the reaction mixture was stirred at RT for 3.5 h. The reaction mixture was concentrated to dryness to afford product (0.021 g, 0.0343 mmol, 75% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.80 (d, J = 1.7 Hz, 1H), 9.22 (s, 2H), 9.09 (s, 2H), 8.94 (d, J = 8.1 Hz, 1H), 8.26 (s, 3H), 7.90 (t, J = 1.9 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.70 (d, J = 1.8 Hz, 1H), 7.65 (d, J = 2.6 Hz, 1H), 7.58 (dd, J = 7.9, 1.8 Hz, 1H), 7.51 (dt, J = 8.1, 1.6 Hz, 1H), 7.47 (d, J = 7.9 Hz, 1H), 7.29 (t, J = 7.8 Hz, 1H), 7.18 (t, J = 7.8 Hz, 1H), 7.13 (dt, J = 7.9, 1.5 Hz, 1H), 7.10 (dd, J = 8.9, 2.6 Hz, 1H), 4.97 (ddd, J = 10.2, 8.1, 4.8 Hz, 1H), 3.83 (s, 5H), 3.41 - 3.37 (m, 1H), 3.02 (dd, J = 13.8, 10.1 Hz, 1H). UPLC-MS (acidic 6 min): Rt = 1.56 min; m/z = 539.0 for [M+H] ⁺ , 100% purity

Example 40: Exemplary synthesis of Compound 105

[000893] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000894] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 100 mL), washed with saturated sodium hydrogen carbonate solution (50 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford (4.30 g, 10.5 mmol, 51% yield) product as a brown solid. 1H NMR (400 MHz, DMSO) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[000895] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000896] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq.) and 4 N HC1 in dioxane (50.0 mb, 200.0 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product (3.97 g, 11.5 mmol, assumed quantitative yield) as a brown solid which was used in the next step without further purification. 1H NMR (400 MHz, DMSO) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.02 min. m/z = 310.0 for [M+H] ⁺

[000897] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000898] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.00 g, 2.89 mmol, 1.0 eq.) in DMF (10.0 mL) was added triethylamine (1.4 mL, 10.1 mmol, 3.5 eq.) and the reaction mixture was cooled to 0°C. 3- nitrobenzene-1 -sulfonyl chloride (0.77 g, 3.47 mmol, 1.2 eq.) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 1 h. The reaction mixture was diluted with EtOAc (60 mL), washed with brine (60 mL), aq. saturated sodium hydrogen carbonate solution (60 mL) and brine (60 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue purified by reverse phase column chromatography eluting with 40-60% acetonitrile: H ₂ O (0.1% NH ₃ ) to afford product (1.05 g, 2.12 mmol, 73% yield) in two batches. 1H NMR (400 MHz, DMSO-d6) 5 9.31 (s, 1H), 8.20 (d, J = 8.4 Hz, 1H), 8.08 (s, 1H), 7.87 (d, J = 8.0 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.67 - 7.50 (m, 3H), 7.44 (d, J = 7.8 Hz, 1H), 7.24 (t, J = 8.0 Hz, 1H), 7.08 (d, J = 9.1 Hz, 1H), 5.12 (s, 1H), 3.82 (s, 3H), 3.39 (s, OH), 3.08 - 2.97 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 mm. m/z = 495.0 for [M+H] ⁺

[000899] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000900] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (1.05 g, 2.12 mmol, 1.0 eq.) in ethanol (8 mb) and water (4.0 mL) were added iron (1.18 g, 21.2 mmol, 10.0 eq.) and ammonium chloride (0.570 g, 10.6 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 2 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness and the residue taken up in DCM (20 mL). The organic layer was washed with aq. saturated NaHCO3 solution (20 mL) and the aqueous was re-extracted with DCM (2 x 20 mL). The combined organics were then washed with brine (20 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (0.57 g, 1.22 mmol, 58% yield) as an off-white solid which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.67 (s, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (s, 1H), 7.58 - 7.50 (m, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.32 (t, J = 7.7 Hz, 1H), 7.13 - 7.02 (m, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.72 (s, 1H), 6.58 (t, J = 5.7 Hz, 2H), 5.42 (s, 2H), 4.82 (d, J = 7.5 Hz, 1H), 3.82 (d, J = 1.5 Hz, 3H), 3.32 (d, J = 5.0 Hz, 1H), 2.95 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.06 mm. m/z = 465.0 for [M+H] ⁺

[000901] Step 5: tert-butyl N-[4-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl] sulfamoyl] anilino] -4-oxo-butyl] carbamate

[000902] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.190 g, 0.411 mmol, 1.0 eq.) in DMF (2 mL) were added 4-(tert-butoxycarbonylamino)butanoic acid (0.100 g, 0.493 mmol, 1.2 eq.), DIPEA (0.21 mL, 1.23 mmol, 3.0 eq.) and HATU (0.240 g, 0.617 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 6 h. The reaction mixture was concentrated to dryness and the residue was dissolved in EtOAc (10 mL), washed with brine (10 mL), aq. saturated sodium hydrogen carbonate solution (10 mL) and brine (10 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (0.220 g, 0.345 mmol, 84% yield) as a brown foam.lH NMR (400 MHz, DMSO-d6) 5 10.02 (s, 1H), 8.92 (d, J = 8.3 Hz, 1H), 7.85 - 7.78 (m, 2H), 7.65 (d, J = 2.6 Hz, 1H), 7.57 - 7.50 (m, 2H), 7.50 - 7.40 (m, 2H), 7.21 (q, J = 7.9 Hz, 2H), 7.14 - 7.05 (m, 2H), 6.88 (t, J = 5.8 Hz, 1H), 4.87 (td, J = 9.4, 4.4 Hz, 1H), 3.83 (s, 3H), 3.43 - 3.36 (m, 1H), 3.03 - 2.83 (m, 4H), 2.69 (s, 2H), 2.32 (t, J = 7.4 Hz, 2H), 1.71 (p, J = 7.2 Hz, 2H), 1.38 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.15 mm. m/z = 650.1 for [M+H] ⁺

[000903] Step 6: tert-butyl N-[4-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy - l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo-butyl]c arbamate

[000904] To a magnetically stirred solution of tert-butyl N-[4-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo -butyl]carbamate (0.220 g, 0.345 mmol, 1.0 eq.) in EtOH (5.0 mL) were added hydroxylamine hydrochloride (0.048 g, 0.689 mmol, 2.0 eq.) and DIPEA (0.18 mL, 1.03 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 6 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.360 g, 0.523 mmol, assumed quantitative yield) as a brown gum. UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 683.1 for [M+H] ⁺

[000905] Step 7: [[amino- [3-[2-[[3-[4-(tert- butoxy carbonylamino)butanoylamino]phenyl]sulfonylamino]-2-(6-metho xy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000906] To a magnetically stirred solution of tert-butyl N-[4-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-4- oxo-butyl] carbamate (0.360 g, 0.523 mmol, 1.0 eq.) in acetic acid (4.0 mL) was added acetic anhydride (0.15 mL, 1.57 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 2 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-80% ethyl acetate: isohexane to afford product (0.490 g, 0.682 mmol, 38% yield) as a colorless glass. 1H NMR (400 MHz, DMSO-d6) 5 9.92 (s, 1H), 8.82 (s, 1H), 7.86 (d, J = 2.0 Hz, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.61 - 7.48 (m, 3H), 7.47 - 7.39 (m, 1H), 7.23 - 7.02 (m, 5H), 6.84 (s, 1H), 6.69 (s, 2H), 4.86 (s, 1H), 3.81 (s, 3H), 3.31 - 3.20 (m, 1H), 3.04 - 2.89 (m, 3H), 2.69 (s, 2H), 2.29 (q, J = 7.3 Hz, 2H), 2.14 (s, 3H), 1.69 (p, J = 7.3 Hz, 2H), 1.38 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.08 mm; m/z = 725.1 for [M+H] ⁺

[000907] Step 8: tert-butyl N-[4-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo-butyl]carba mate

[000908] To a magnetically stirred solution of [[amino- [3-[2-[[3-[4-(tert- butoxy carbonylamino)butanoylamino]phenyl]sulfonylamino]-2-(6-metho xy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.120 g, 0.164 mmol, 1.0 eq) in acetic acid (3.0 mL) was added zinc (0.210 g, 3.28 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 17 h. The reaction mixture was filtered and concentrated to dryness. The residue was sent to Reach for purification and chiral separation. Purification was performed via SFC using a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 MeOH:CO ₂ (0.1% v/v NH ₃ ). This afforded product (0.016 g, 0.0240 mmol, 14% yield) as a white solid. Reach found the chiral purity to be 100% in favor of the 1 ^st eluting enantiomer (Rt 2.84 min). UPLC-MS (acidic 2.5 min): Rt = 1.20 min; m/z = 667.3 for [M+H] ⁺

[000909] Step 9: 4-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethy 1] sulfamoyl] phenyl] butanamide; dihydrochloride

[000910] To a mixture of tert-butyl N-[4-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo-butyl]carba mate (0.016 g, 0.0240 mmol, 1.00 eq.) in dioxane (1.0 mL) was added 4 N HC1 in 1,4-Dioxane solution (1.0 mL, 4.00 mmol, 166.7 eq.) was stirred at RT for 2 h. The reaction mixture was concentrated to dryness to afford product (0.014 g, 0.0208 mmol, 87% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5

10.25 (s, 1H), 9.25 (s, 2H), 9.11 (s, 2H), 8.87 (d, J = 8.1 Hz, 1H), 7.96 (s, 3H), 7.89 (t, J = 1.9 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.71 (t, J = 1.8 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 (dd, J = 7.9, 1.7 Hz, 1H), 7.52 (dt, J = 8.1, 1.6 Hz, 1H), 7.45 (d, J = 7.7 Hz, 1H), 7.23 (t, J = 7.8 Hz, 1H), 7.17 (t, J = 7.8 Hz, 1H), 7.14 - 7.07 (m, 2H), 5.00 - 4.90 (m, 1H), 3.83 (s, 3H), 3.41 - 3.31 (m, 1H), 3.02 (dd, J = 13.8, 10.0 Hz, 1H), 2.87 (q, J = 6.6 Hz, 2H), 2.46 (d, J = 7.3 Hz, 2H), 1.95 - 1.83 (m, 2H). UPLC-MS (acidic 6 min): Rt = 1.63 min; m/z = 567.1 for [M] ⁺ , 95% purity

Example 41: Exemplary synthesis of Compound 105

[000911] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000912] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 100 mL), washed with saturated sodium hydrogen carbonate solution (50 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford (4.30 g, 10.5 mmol, 51% yield) product as a brown solid. 1H NMR (400 MHz, DMSO) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[000913] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000914] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq.) and 4 N HC1 in dioxane (50.0 mL, 200.0 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product (3.97 g, 11.5 mmol, assumed quantitative yield) as a brown solid which was used in the next step without further purification. 1H NMR (400 MHz, DMSO) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.02 min. m/z = 310.0 for [M+H] ⁺

[000915] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000916] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.00 g, 2.89 mmol, 1.0 eq.) in DMF (10.0 mL) was added triethylamine (1.4 mL, 10.1 mmol, 3.5 eq.) and the reaction mixture was cooled to 0°C. 3- nitrobenzene-1 -sulfonyl chloride (0.77 g, 3.47 mmol, 1.2 eq.) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 1 h. The reaction mixture was diluted with EtOAc (60 mL), washed with brine (60 mL), aq. saturated sodium hydrogen carbonate solution (60 mL) and brine (60 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue purified by reverse phase column chromatography eluting with 40-60% acetonitrile: H ₂ O (0.1% NH ₃ ) to afford product (1.05 g, 2.12 mmol, 73% yield) in two batches. 1H NMR (400 MHz, DMSO-d6) 5 9.31 (s, 1H), 8.20 (d, J = 8.4 Hz, 1H), 8.08 (s, 1H), 7.87 (d, J = 8.0 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.67 - 7.50 (m, 3H), 7.44 (d, J = 7.8 Hz, 1H), 7.24 (t, J = 8.0 Hz, 1H), 7.08 (d, J = 9.1 Hz, 1H), 5.12 (s, 1H), 3.82 (s, 3H), 3.39 (s, OH), 3.08 - 2.97 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 mm. m/z = 495.0 for [M+H] ⁺

[000917] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000918] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (1.05 g, 2.12 mmol, 1.0 eq.) in ethanol (8 mL) and water (4.0 mL) were added iron (1.18 g, 21.2 mmol, 10.0 eq.) and ammonium chloride (0.570 g, 10.6 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 2 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness and the residue taken up in DCM (20 mL). The organic layer was washed with aq. saturated NaHCO3 solution (20 mL) and the aqueous was re-extracted with DCM (2 x 20 mL). The combined organics were then washed with brine (20 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (0.57 g, 1.22 mmol, 58% yield) as an off-white solid which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.67 (s, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (s, 1H), 7.58 - 7.50 (m, 2H), 7.47 (d, J = 7.9 Hz, 1H), 7.32 (t, J = 7.7 Hz, 1H), 7.13 - 7.02 (m, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.72 (s, 1H), 6.58 (t, J = 5.7 Hz, 2H), 5.42 (s, 2H), 4.82 (d, J = 7.5 Hz, 1H), 3.82 (d, J = 1.5 Hz, 3H), 3.32 (d, J = 5.0 Hz, 1H), 2.95 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.06 min. m/z = 465.0 for [M+H] ⁺

[000919] Step 5: tert-butyl N-[4-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl] sulfamoyl] anilino] -4-oxo-butyl] carbamate

[000920] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-

1.3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.190 g, 0.411 mmol, 1.0 eq.) in DMF (2 mL) were added 4-(tert-butoxycarbonylamino)butanoic acid (0.100 g, 0.493 mmol, 1.2 eq.), DIPEA (0.21 mL, 1.23 mmol, 3.0 eq.) and HATU (0.240 g, 0.617 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 6 h. The reaction mixture was concentrated to dryness and the residue was dissolved in EtOAc (10 mL), washed with brine (10 mL), aq. saturated sodium hydrogen carbonate solution (10 mL) and brine (10 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (0.220 g, 0.345 mmol, 84% yield) as a brown foam. 1H NMR (400 MHz, DMSO-d6) 5 10.02 (s, 1H), 8.92 (d, J = 8.3 Hz, 1H), 7.85 - 7.78 (m, 2H), 7.65 (d, J = 2.6 Hz, 1H), 7.57 - 7.50 (m, 2H), 7.50 - 7.40 (m, 2H), 7.21 (q, J = 7.9 Hz, 2H), 7.14 - 7.05 (m, 2H), 6.88 (t, J = 5.8 Hz, 1H), 4.87 (td, J = 9.4, 4.4 Hz, 1H), 3.83 (s, 3H), 3.43 - 3.36 (m, 1H), 3.03 - 2.83 (m, 4H), 2.69 (s, 2H), 2.32 (t, J = 7.4 Hz, 2H), 1.71 (p, J = 7.2 Hz, 2H), 1.38 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.15 mm. m/z = 650.1 for [M+H] ⁺

[000921] Step 6: tert-butyl N-[4-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy -

1.3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo-buty l]carbamate

[000922] To a magnetically stirred solution of tert-butyl N-[4-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo -butyl]carbamate (0.220 g, 0.345 mmol, 1.0 eq.) in EtOH (5.0 mL) were added hydroxylamine hydrochloride (0.048 g, 0.689 mmol, 2.0 eq.) and DIPEA (0.18 mL, 1.03 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 6 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.360 g, 0.523 mmol, assumed quantitative yield) as a brown gum which was used in the next step without further analysis or purification. UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 683.1 for [M+H] ⁺

[000923] Step 7: [[amino- [3-[2-[[3-[4-(tert- butoxy carbonylamino)butanoylamino]phenyl]sulfonylamino]-2-(6-metho xy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[000924] To a magnetically stirred solution of tert-butyl N-[4-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-4- oxo-butyl] carbamate (0.360 g, 0.523 mmol, 1.0 eq.) in acetic acid (4.0 mb) was added acetic anhydride (0.15 mL, 1.57 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 2 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-80% ethyl acetate: isohexane to afford product (0.490 g, 0.682 mmol, 38% yield) as a colorless glass. 1H NMR (400 MHz, DMSO-d6) 5 9.92 (s, 1H), 8.82 (s, 1H), 7.86 (d, J = 2.0 Hz, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.61 - 7.48 (m, 3H), 7.47 - 7.39 (m, 1H), 7.23 - 7.02 (m, 5H), 6.84 (s, 1H), 6.69 (s, 2H), 4.86 (s, 1H), 3.81 (s, 3H), 3.31 - 3.20 (m, 1H), 3.04 - 2.89 (m, 3H), 2.69 (s, 2H), 2.29 (q, J = 7.3 Hz, 2H), 2.14 (s, 3H), 1.69 (p, J = 7.3 Hz, 2H), 1.38 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.08 mm; m/z = 725.1 for [M+H] ⁺

[000925] Step 8: tert-butyl N-[4-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo-butyl]carba mate

[000926] To a magnetically stirred solution of [ [amino- [3 - [2- [ [3 - [4-(tert- butoxycarbonylamino)butanoylamino]phenyl]sulfonylamino]-2-(6 -methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.120 g, 0.164 mmol, 1.0 eq) in acetic acid (3.0 mL) was added zinc (0.210 g, 3.28 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 17 h. The reaction mixture was filtered and concentrated to dryness. The residue was sent to Reach for purification and chiral separation. Purification was performed via SFC using a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 MeOHUCh (0.1% v/v NH ₃ ). This afforded product (0.016 g, 0.0246 mmol, 15% yield) as a white solid. UPLC-MS (acidic 2.5 min): Rt = 1.20 min; m/z = 667.3 for [M+H] ⁺

[000927] Step 9: 4-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethy 1] sulfamoyl] phenyl] butanamide; dihydrochloride

[000928] To a mixture of tert-butyl N-[4-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo-butyl]carba mate (0.016 g, 0.0240 mmol, 1.00 eq.) in dioxane (1.0 mb) was added 4 N HC1 in 1,4-Dioxane solution (1.0 mL, 4.00 mmol, 166.7 eq.) was stirred at RT for 2 h. The reaction mixture was concentrated to dryness to afford product (0.014 g, 0.0217 mmol, 88% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.22 (s, 1H), 9.24 (s, 2H), 9.08 (s, 2H), 8.86 (d, J = 8.1 Hz, 1H), 7.92 (s, 3H), 7.89 (t, J = 2.0 Hz, 1H), 7.79 (d, J = 8.9 Hz, 1H), 7.71 (d, J = 1.9 Hz, 1H), 7.63 (d, J = 2.6 Hz, 1H), 7.59 - 7.54 (m, 1H), 7.52 (dt, J = 8.0, 1.6 Hz, 1H), 7.45 (d, J = 7.6 Hz, 1H), 7.24 (t, J = 7.8 Hz, 1H), 7.16 (t, J = 7.9 Hz, 1H), 7.14 - 7.07 (m, 2H), 5.00 - 4.90 (m, 1H), 3.83 (s, 3H), 3.41 - 3.31 (m, 1H), 3.02 (dd, J = 13.8, 10.0 Hz, 1H), 2.87 (q, J = 6.8 Hz, 2H), 2.46 (s, 2H), 1.89 (p, J = 7.3 Hz, 2H).

UPLC-MS (acidic 6 min): Rt = 1.62 min; m/z = 567.1 for [M] ⁺ , 99% purity

Example 42: Exemplary synthesis of Compound 224

[000929] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000930] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (17.8 g, 61.3 mmol, 1.0 eq.) in toluene (250.0 mL) were added DIPEA (35.0 mL, 201 mmol, 3.3 eq.), 2-amino-5-methoxy-benzenethiol (10.77 g, 69.4 mmol, 1.1 eq.) and T3P (80.0 mL, 134 mmol, 2.2 eq.). The resulting mixture was stirred at reflux for 18 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (200 mL). The organics were then extracted with EtOAc (3 x 250 mL), washed with brine (250 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 220 g cartridge eluting with 0-100% ethyl acetate in isohexane to afford product as a beige solid (7.56 g, 18.4 mmol, 30% yield). Lurther purification of other mixed fractions via normal phase chromatography on a 40 g cartridge eluting with 0-100% EtOAc in isohexane afforded product (1.72 g, 4.20 mmol, 7% yield) as an orange solid. 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.7, 5.1 Hz, 3H), 7.52 (t, J = 7.8 Hz, 1H), 7.10 (dd, J = 9.0, 2.4 Hz, 1H), 5.16 - 5.05 (m, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.7, 4.3 Hz, 1H), 3.11 (t, J = 12.4 Hz, 1H), 1.30 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[000931] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000932] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (7.56 g, 18.4 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (145 mL, 580 mmol, 31.4 eq.) was stirred at RT for 3 h. The reaction mixture was diluted with excess diethyl ether and the precipitate that formed was collected by filtration, washing with copious diethyl ether, and dried in a vacuum oven to afford the product as a grey solid (7.00 g, 20.2 mmol, assumed quantitative yield) which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.25 (d, J = 5.7 Hz, 3H), 7.89 (d, J = 8.9 Hz, 1H), 7.79 (s, 1H), 7.73 - 7.66 (m, 2H), 7.56 (d, J = 7.8 Hz, 1H), 7.46 (t, J = 7.7 Hz, 1H), 7.12 (dd, J = 8.9, 2.5 Hz, 1H), 5.20 (s, 1H), 3.81 (s, 3H), 3.61 (dd, J = 13.7, 5.5 Hz, 1H), 3.38 (dd, J = 13.7, 8.9 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 310.0 for [M+H] ⁺

[000933] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-4-nitro- benzenesulfonamide

[000934] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.50 g, 4.34 mmol, 1.0 eq.) in DMF (30.0 mL) was added triethylamine (1.80 mL, 13.0 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C. 4- Nitrobenzene-1 -sulfonyl chloride (1.15 g, 5.20 mmol, 1.2 eq.) was added portion wise at 0°C over 10 min and the reaction mixture was allowed to warm to RT for 1.5 h. The reaction was quenched via the addition of water (1 mL) before being purified via reverse phase chromatography on a 140 g C18 cartridge eluting with 5-95% MeCN:H ₂ O (+0.1% NH ₃ ) to afford product (1.92 g, 3.89 mmol, 90% yield) as an orange solid. 1H NMR (400 MHz, DMSO- d6) 5 8.20 (s, 1H), 8.04 (d, J = 8.4 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.69 - 7.61 (m, 3H), 7.59 (s, 1H), 7.55 (d, J = 7.9 Hz, 1H), 7.47 (d, J = 7.7 Hz, 1H), 7.30 (t, J = 7.7 Hz, 1H), 7.11 - 7.04 (m, 1H), 5.06 (dd, J = 10.7, 4.4 Hz, 1H), 3.82 (s, 3H), 3.41 (d, J = 4.5 Hz, 1H), 3.08 - 2.97 (m, 1H). UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 495.0 for [M+H] ⁺

[000935] Step 4: 4-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000936] To a stirred suspension of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]-4-nitro-benzenesulfonamide (0.100 g, 0.202 mmol, 1.0 eq.) in ethanol (4.0 mL) and water (2.0 mL) was added ammonium chloride (0.108 g, 2.02 mmol, 10.0 eq.) and iron (0.226 g, 4.04 mmol, 20.0 eq.) and the resulting mixture was stirred at 85 °C, under a balloon of nitrogen, for 36 h. The reaction was then cooled to RT and filtered over Celite, washing with copious ethanol. The filtrate was concentrated to dryness and the residue re-dissolved in DCM (20 mL) and washed with saturated Na ₂ CO ₃ solution (20 mL). After separation of the phases, the aqueous was extracted with DCM (3 x 10 mL) and the combined organics were dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (0.082 g, 0.177 mmol, 87%) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 8.38 (s, 1H), 7.81 (d, J = 8.8 Hz, 1H), 7.64 (s, 1H), 7.61 - 7.53 (m, 2H), 7.46 (d, J = 7.8 Hz, 1H), 7.31 (t, J = 7.8 Hz, 1H), 7.09 (t, J = 8.9 Hz, 3H), 6.34 (d, J = 8.3 Hz, 2H), 5.85 (s, 2H), 5.76 (s, 1H), 4.77 (s, 1H), 3.82 (s, 3H), 3.00 - 2.90 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.05 mm. m/z = 465.0 for [M+H] ⁺

[000937] Step 5: N-[4-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] sulfamoyl] phenyl] acetamide

[000938] To a magnetically stirred solution of 4-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.160 g, 0.344 mmol, 1.0 eq.) in ethyl acetate (1.0 mL) was slowly added acetic anhydride (40.0 pL, 0.423 mmol, 1.2 eq.) over 10 min. The reaction mixture was then washed with saturated Na ₂ CO ₃ solution, dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (0.170 g, 0.336 mmol, 97% yield) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) 5 10.16 (s, 1H), 8.75 (t, J = 8.1 Hz, 1H), 7.80 (d, J = 8.8 Hz, 1H), 7.71 - 7.62 (m, 2H), 7.57 (s, 1H), 7.47 (dd, J = 15.4, 8.2 Hz, 4H), 7.34 (d, J = 8.5 Hz, 2H), 7.27 (t, J = 7.7 Hz, 1H), 7.14 - 7.05 (m, 1H), 4.88 (s, 1H), 3.83 (s, 4H), 3.36 (d, J = 4.9 Hz, 1H), 2.97 (dd, J = 13.9, 10.3 Hz, 1H), 2.08 (s, 3H).150940-l; residual EtOAc present, CH overlap with water peak, extra protons seen as large integral at 3.83 ppm. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 507.0 for [M+H] ⁺

[000939] Step 6: N-[4-[[2-[3-[(E)-N'-hydroxycarbamimidoyl]phenyl]-l-(6-methox y-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]phenyl]acetamide

[000940] To a magnetically stirred solution of N-[4-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]phenyl]acetamide (0.150 g, 0.298 mmol, 1.0 eq.) in EtOH (3.0 mL) were added hydroxylamine hydrochloride (0.041 g, 0.596 mmol, 2.0 eq.) and DIPEA (0.16 mL, 0.894 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.180 g, 0.332 mmol, assumed quantitative yield) as a yellow solid which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.92 min. m/z = 540.1 for [M+H] ⁺

[000941] Step 7: [(E)-[[3-[2-[(4-acetamidophenyl)sulfonylamino]-2-(6-methoxy- l,3- benzothiazol-2-yl)ethyl]phenyl]-amino-methylene]amino] acetate

[000942] To a magnetically stirred solution of N-[4-[[2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]-1-(6-methoxy- 1 ,3 -benzothiazol-2- yl)ethyl]sulfamoyl]phenyl]acetamide (0.180 g, 0.332 mmol, 1.0 eq) in acetic acid (4.0 mL) was added acetic anhydride (0.090 mL, 0.952 mmol, 2.9 eq.) and the resulting mixture was stirred at RT for 18 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (4 g cartridge) eluting with 40-100% ethyl acetate in isohexane to afford product (0.043 g, 0.0739 mmol, 22% yield) as a beige foam. 1H NMR analysis (400 MHz, DMSO-d6) 5 10.09 - 9.98 (m, 1H), 8.69 (s, 1H), 7.82 - 7.70 (m, 2H), 7.60 - 7.55 (m, 1H), 7.46 - 7.25 (m, 5H), 7.19 (d, J = 7.6 Hz, 1H), 7.15 - 7.02 (m, 2H), 6.71 (s, 1H),

4.86 (s, 1H), 3.82 (d, J = 4.5 Hz, 3H), 3.04 - 2.95 (m, 1H), 2.33 (p, J = 1.9 Hz, 3H), 2.15 (s, 2H), 2.05 (d, J = 3.6 Hz, 3H). UPLC-MS (basic 2 min): Rt = 0.97 min; m/z = 582.1 for [M+H] ⁺

[000943] Step 8: N-[4-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiaz ol-2- y 1) ethyl] sulfamoyl] phenyl] acetamide

[000944] To a magnetically stirred solution of [(E)- [[3- [2- [(4- acetamidophenyl)sulfonylamino]-2-(6-methoxy-l,3-benzothiazol -2-yl)ethyl]phenyl]-amino- methylene]amino] acetate (0.043 g, 0.0739 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.097 g, 1.48 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 24 h. Further zinc (0.048 g, 0.739 mmol, 10.0 eq.) was added and the reaction stirred for a further 24 h at RT. The reaction mixture was filtered and the filtrate was concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 60-100% MeOH:H ₂ O eluent (0.1% NH ₃ ) to afford product as a white solid (0.006 g, 0.0115 mmol, 16% yield). UPLC-MS (acidic 6 min): Rt = 2.01 min; m/z = 524.1 for [M+H] ⁺ , 100% purity. 1H NMR analysis (400 MHz, DMSO-d6) 5 10.10 (s, 1H), 7.73 (d, J = 8.9 Hz, 1H), 7.58 (d, J = 13.9 Hz, 2H), 7.46 (d, J = 7.8 Hz, 1H), 7.43 - 7.33 (m, 4H), 7.17 (d, J = 7.4 Hz, 1H), 7.11 (t, J = 7.6 Hz, 1H), 7.03 (dd, J = 9.0, 2.6 Hz, 1H), 4.78 (s, 1H), 3.80 (s, 3H), 2.98 (dd, J = 13.5, 8.7 Hz, 2H), 2.05 (s, 3H).

Example 43: Exemplary synthesis of Compound 225

[000945] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000946] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 100 mL), washed with saturated Na ₂ CO ₃ solution (50 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford product as a brown solid (4.30 g, 10.5 mmol, 51% yield). 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[000947] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000948] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (50.0 mL, 200.0 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product as a brown solid (3.97 g, 11.5 mmol, assumed quantitative yield) which was used in the next step without further purification.1H NMR (400 MHz, DMSO-d6) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 310.0 for [M+H] ⁺

[000949] Step 3: methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[000950] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.00 g, 2.89 mmol, 1.0 eq.) in DMF (10.0 mL) was added triethylamine (1.21 mL, 8.67 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C. Methyl- 3 -chlorosulfonylbenzoate (0.81 g, 3.47 mmol, 1.2 eq.) was added portion wise at 0°C over 10 min and the reaction mixture was allowed to warm to RT for 4 h. The reaction was quenched via the addition of water (50 mL) and extracted with ethyl acetate (100 mL followed by 50 mL). The combined organics were then washed with brine (2 x 100 mL) and concentrated to dryness. The residue was suspended in DCM (10 mL) and filtered. The residue was washed with further DCM

(5 mL) to afford the product (0.980 g, 1.93 mmol, 67% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.09 (s, 1H), 7.94 - 7.84 (m, 2H), 7.74 (dd, J = 17.0, 8.3 Hz, 2H), 7.61 (d, J = 12.3 Hz, 2H), 7.53 - 7.38 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.88 (s, 3H), 3.83 (s, 3H), 3.35 (d, J = 14.6 Hz, 1H), 3.05 - 2.94 (m, 1H). UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 508.0 for [M+H] ⁺

[000951] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[000952] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (1.96 g, 3.85 mmol, 1.0 eq.) in THF (40.0 mL) was added a solution of lithium hydroxide (0.48 g, 11.6 mmol, 3.0 eq.) in water (12.0 mL) and the resulting mixture stirred at RT for 5 h. The reaction volume was reduced by half, diluted with water (100 mL) and then extracted with ethyl acetate (2 x 100 mL). The aqueous phase was acidified to pH 1.0 by the slow addition of 1 M HC1, extracted with ethyl acetate (2 x 100 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product as a white solid (1.82 g, 3.70 mmol, 96% yield). 1H NMR (400 MHz, DMSO-d6) 5 13.30 (s, 1H), 9.06 (d, J = 8.5 Hz, 1H), 7.92 (d, J = 9.0 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 16.4 Hz, 2H), 7.59 (s, 1H), 7.50 (d, J = 7.9 Hz, 1H), 7.41 (q, J = 8.0 Hz, 2H), 7.23 (t, J = 7.8 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.83 (s, 3H), 3.39 - 3.34 (m, 1H), 2.99 (t, J = 12.3 Hz, 1H).

UPLC-MS (basic 2 min) Rt = 0.84 min. m/z = 494.0 for [M+H] ⁺

[000953] Step 5: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzamide

[000954] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.300 g, 0.608 mmol, 1.0 eq.) in DMF (3.0 mL) were added ammonium chloride (0.075 g, 1.40 mmol, 2.3 eq.), DIPEA (0.32 mL, 1.82 mmol, 3.0 eq.) and HATU (0.350 g, 0.912 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 1 h. The reaction mixture was diluted with ethyl acetate (30 mL), washed with brine (30 mL), saturated Na ₂ CO ₃ solution (30 mL) and brine (30 mL), dried over anhydrous sodium sulfate and concentrated to dryness. This afforded the product (0.270 g, 0.548 mmol, 90% yield) as an off- white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.98 (d, J = 8.3 Hz, 1H), 8.06 (s, 1H), 8.00 (s, 1H), 7.91 (d, J = 7.8 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.5 Hz, 1H), 7.56 (d, J = 6.7 Hz, 2H), 7.53 - 7.40 (m, 3H), 7.37 (t, J = 7.8 Hz, 1H), 7.20 (t, J = 7.8 Hz, 1H), 7.09 (dd, J = 8.9, 2.4 Hz, 1H), 5.04 (s, 1H), 3.83 (d, J = 1.6 Hz, 3H), 3.37 (dd, J = 13.7, 4.5 Hz, 1H), 3.03 - 2.92 (m, 1H), 2.69 (d, J = 1.6 Hz, 2H). - 3 wt.% tetramethylurea present, residual DMF and EtOAc peaks. UPLC-MS (basic 2 min) Rt = 0.98 min. m/z = 493.0 for [M+H] ⁺

[000955] Step 6: 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-b enzothiazol- 2-yl)ethyl]sulfamoyl]benzamide

[000956] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide (0.270 g, 0.548 mmol, 1.0 eq.) in EtOH (6.0 mL) were added hydroxylamine hydrochloride (0.076 g, 1.10 mmol, 2.0 eq.) and DIPEA (0.29 mL, 1.64 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 21.5 h. Further hydroxylamine hydrochloride (0.038 g, 0.548 mmol, 1.0 eq.) was added and the reaction was stirred at 85 °C for a further 5 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.530 g, 0.999 mmol, assumed quantitative yield) as a brown oil which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.88 mm. m/z = 526.0 for [M+H] ⁺

[000957] Step 7: [[amino-[3-[2-[(3-carbamoylphenyl)sulfonylamino]-2-(6-methox y-l,3- benzothiazol-2-yl)ethyl]phenyl]methylene]amino] acetate

[000958] To a magnetically stirred solution of 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l- (6-methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzamide (0.53 g, 0.999 mmol, 1.0 eq) in acetic acid (5.0 mL) was added acetic anhydride (0.28 mL, 3.00 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 4.5 h. The reaction mixture was concentrated to dryness and the residue was purified by reverse phase column chromatography (C18, 90 g cartridge) eluting with 5-95% MeCN:H ₂ O (+0.1% NH ₃ ). The residue was resubmitted to the reaction conditions and stirred for 6 h before being concentrated to dryness to afford the product (0.160 g, 0.104 mmol, 10% yield) as a colorless film. UPLC-MS (basic 2 min): Rt = 0.93 min; m/z = 568.0 for [M+H] ⁺

[000959] Step 8: 3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiazol- 2- yl)ethyl]sulfamoyl]benzamide

[000960] To a magnetically stirred solution of [[amino- [3 -[2- [(3- carbamoylphenyl)sulfony lamino] -2-(6-methoxy- 1 ,3 -benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.140 g, 0.0901 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.120 g, 1.80 mmol, 20 eq.). The reaction mixture was stirred at room temperature for 19.5 h. The reaction mixture was filtered, washing with copious acetonitrile, and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with 60-100 % MeOH:H ₂ O (0.1% NH ₃ ). The residue was triturated with diethyl ether (3 x 1 mL), sonicated in water, filtered and dried in vacuo to afford product (0.011 g, 0.0205 mmol, 23% yield) as an off-white solid. UPLC-MS (acidic 6 min): Rt = 1.78 min; m/z = 510.1 for [M+H] ⁺ , 95% purity. 1H NMR (400 MHz, DMSO-d6) 5 8.05 (s, 1H), 8.01 (s, 1H), 7.76 (d, J = 7.8 Hz, 1H), 7.71 (d, J = 8.9 Hz, 1H), 7.60 (s, 1H), 7.56 - 7.50 (m, 2H), 7.47 - 7.39 (m, 2H), 7.25 (t, J = 7.6 Hz, 2H), 7.13 (t, J = 7.7 Hz, 1H), 7.01 (dd, J = 9.1, 2.6 Hz, 1H), 4.78 (s, 1H), 3.80 (s, 3H), 3.20 (d, J = 13.4 Hz,lH), 2.97 (dd, J = 13.4, 8.7 Hz, 1H).

Example 44: Exemplary synthesis of Compound 226

[000961] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000962] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (10.0 g, 34.4 mmol, 1.0 eq.) in toluene (200.0 mL) were added DIPEA (9.0 mL, 51.7 mmol, 1.5 eq.), 2-amino-5-methoxy-benzenethiol (5.88 g, 37.9 mmol, 1.1 eq.) and T3P (25.0 mL, 41.3 mmol, 1.2 eq.). The resulting mixture was stirred at reflux for 2.5 h followed by 17 h at RT. The reaction was concentrated to dryness and the residue was diluted with ethyl acetate (200 mL), washed with brine (200 mL), saturated Na ₂ CO ₃ solution (2 x 100 mL), brine (100 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 50 g high-capacity cartridge eluting with 0-100% ethyl acetate in hexane to afford product (3.35 g, 8.19 mmol, 24% yield) as a green solid. 1H NMR (400 MHz, DMSO-d6) 5 7.86 (d, J = 8.9 Hz, 2H), 7.80 (s, 1H), 7.73 - 7.68 (m, 2H), 7.66 (d, J = 2.6 Hz, 1H), 7.53 (t, J = 7.7 Hz, 1H), 7.11 (dd, J = 8.9, 2.6 Hz, 1H), 5.17 - 5.05 (m, 1H), 3.84 (s, 3H), 3.53 (dd, J = 13.8, 4.4 Hz, 1H), 3.12 (dd, J = 13.8, 11.0 Hz, 1H), 1.31 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.2 for [M+H] ⁺

[000963] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000964] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (3.35 g, 8.19 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (40.0 mL, 160.0 mmol, 19.5 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product (2.76 g, 6.07 mmol, 74% yield), as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.13 (d, J = 4.9 Hz, 3H), 7.92 (d, J = 9.0 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.75 - 7.71 (m, 2H), 7.58 (dt, J = 7.9, 1.5 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.15 (dd, J = 9.0, 2.6 Hz, 1H), 5.29 - 5.20 (m, 1H), 3.83 (s, 3H), 3.54 (d, J = 5.9 Hz, 1H), 3.37 (dd, J = 13.8, 8.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 310.1 for [M+H] ⁺

[000965] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000966] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (2.76 g, 7.98 mmol, 1.0 eq.) in DMF (30.0 mL) was added triethylamine (3.9 mL, 27.9 mmol, 3.5 eq.) and the reaction mixture was cooled to 0°C. 3- nitrobenzene-1 -sulfonyl chloride (2.12 g, 9.58 mmol, 1.2 eq.) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 1 h. The reaction mixture was diluted with EtOAc (150 mL), washed with brine (150 mL), aq. saturated Na ₂ CO ₃ solution

(150 mL) and brine (150 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was then triturated with DCM (15 mL) and filtered under vacuum to afford product (2.15 g, 4.35 mmol, 54% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 9.29 (s, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.09 (t, J = 2.0 Hz, 1H), 7.87 (ddd, J = 7.8, 1.8, 1.0 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.62 (t, J = 2.0 Hz, 2H), 7.59 (t, J = 8.0 Hz, 1H), 7.54 (dt, J = 7.8, 1.5 Hz, 1H), 7.44 (dt, J = 7.8, 1.4 Hz, 1H), 7.25 (t, J = 7.7 Hz, 1H), 7.07 (dd, J = 8.9, 2.6 Hz, 1H), 5.11 (dd, J = 10.7, 4.6 Hz, 1H), 3.82 (s, 3H), 3.38 (dd, J = 13.9, 4.6 Hz, 1H), 3.03 (dd, J = 13.9, 10.7 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 mm. m/z = 495.0 for [M+H] ⁺

[000967] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000968] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (2.15 g, 4.35 mmol, 1.0 eq.) in ethanol (22.0 mL) and water (11.0 mL) were added iron (2.43 g, 43.5 mmol, 10.0 eq.) and ammonium chloride (1.16 g, 21.7 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3.5 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness and the residue taken up in DCM (50 mL). The organic layer was washed with aq. saturated NaHCO ₃ solution (50 mL) and the aqueous was re-extracted with DCM (2 x 50 mL). The combined organics were then washed with brine (50 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (1.71 g, 3.68 mmol, 85% yield), as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.65 (d, J = 6.6 Hz, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.58 - 7.51 (m, 2H), 7.47 (d, J = 7.8 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.1 Hz, 1H), 6.59 (dt, J = 7.8, 2.2 Hz, 2H), 5.40 (s, 2H), 4.83 (s, 1H), 3.83 (s, 3H), 3.35 (d, J = 5.2 Hz, 1H), 2.96 (dd, J = 13.8, 9.7 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.07 min. m/z = 465.1 for [M+H] ⁺

[000969] Step 5: tert-butyl N-[2-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate

[000970] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]benzenesulfonamide (1.71 g, 3.68 mmol, 1.0 eq.) in DMF (17.0 mL) were added N-alpha-t-BOC-glycine (0.770 g, 4.42 mmol, 1.2 eq.), DIPEA (1.9 mL, 11.0 mmol, 3.0 eq. ) and HATU (2.10 g, 5.52 mmol, 1.5 eq. ) and the reaction mixture was stirred at RT for 3 h. The reaction mixture was diluted with EtOAc (170 mL), washed with brine (170 mL), aq. saturated Na ₂ CO ₃ solution (170 mL) and brine (170 mL) before drying over anhydrous sodium sulfate and being concentrated to dryness to afford the product (2.55 g, 3.81 mmol). 1H NMR (400 MHz, DMSO-d6) 5 10.05 (s, 1H), 8.91 (d, J = 8.4 Hz, 1H), 7.82 (d, J = 8.8 Hz, 2H), 7.65 (d, J = 2.6 Hz, 1H), 7.54 (d, J = 6.4 Hz, 2H), 7.51 - 7.41 (m, 2H), 7.28 (t, J = 7.7 Hz, 1H), 7.22 (t, J = 8.0 Hz, 1H), 7.13 (dt, J = 8.0, 1.4 Hz, 1H), 7.11 - 7.05 (m, 2H), 4.93 - 4.82 (m, 1H), 3.83 (s, 3H), 3.74 (d, J = 6.2 Hz, 2H), 3.35 (dd, J = 13.9, 4.6 Hz, 1H), 2.96 (dd, J = 13.8, 10.6 Hz, 1H), 1.42 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.14 mm. m/z = 622.2 for [M+H] ⁺

[000971] Step 6: tert-butyl N-[2-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy - 1 ,3 -benzothiazol-2-yl)ethy 1] sulfamoyl] anilino] -2-oxo-ethyl] carbamate

[000972] To a magnetically stirred solution of tert-butyl N-[2-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo -ethyl]carbamate (2.55 g, 3.81 mmol, 1.0 eq.) in EtOH (50.0 mL) were added hydroxylamine hydrochloride (0.530 g, 7.63 mmol, 2.0 eq.) and DIPEA (2.0 mL, 11.4 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 4 h. The reaction mixture was cooled down to RT and stirred for a further 16.5 h before being concentrated to dryness to afford product (3.73 g, 5.47 mmol, assumed quantitative yield) as a beige foam. 0.500 g of the residue was submitted to Reach for purification and chiral separation.Purification was performed via SEC on a Chiralpak IG (21 mm x 250 mm, 5 um) eluting with 30:70 hexane: ethanol (0.2% v/v NH ₃ ) to afford product (0.120 g, 0.181 mmol, 25% yield) as an off-white solid. UPLC-MS (acidic 2.5 min): rt 1.19 min, m/z = 655.3 [M+H] ⁺

[000973] Step 7: 2-amino-N-[3-[[rac-(lR)-2-[3-(N'-hydroxycarbamimidoyl)phenyl ]-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]phenyl]acetami de hydrochloride

[000974] To tert-butyl N-[2-oxo-2-[3-[[rac-(lR)-2-[3-(N'-hydroxycarbamimidoyl)pheny l]-l- (6-methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]eth yl]carbamate (0.110 g, 0.165 mmol, 1.0 eq.) was added 4 N HC1 in 1,4-dioxane solution (1.0 mL, 4.0 mmol, 24.2 eq.) and the reaction mixture was stirred at RT for 1 h. Further 4 N HC1 in 1,4-dioxane solution (1.0 mL, 4.0 mmol, 24.2 eq.) was added and the resulting mixture was stirred at RT for 1 h. The reaction mixture was concentrated to dryness, before being triturated with diethyl ether, suspended in water and re-dried, to afford product (0.092 g, 0.165 mmol, 100% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 12.83 (s, 1H), 11.25 (s, 1H), 10.86 (s, 1H), 9.22 (s, 1H), 8.95 (d, J = 8.2 Hz, 1H), 8.26 (s, 3H), 7.94 (t, J = 1.9 Hz, 1H), 7.79 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.5 Hz, 1H), 7.61 (s, 1H), 7.49 (dt, J = 7.9, 1.7 Hz, 2H), 7.43 (d, J = 7.7 Hz, 1H), 7.27 (t, J = 7.7 Hz, 1H), 7.19 (t, J = 7.8 Hz, 1H), 7.15 (dt, J = 7.9, 1.5 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 4.99 - 4.89 (m, 1H), 3.83 (s, 3H), 3.41 - 3.30 (m, 1H), 3.02 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (acidic 6 min): Rt = 1.66 min; m/z = 555.2 for [M+H] ⁺ , 99% purity

Example 45: Exemplary synthesis of Compound 226

[000975] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000976] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (10.0 g, 34.4 mmol, 1.0 eq.) in toluene (200.0 mL) were added DIPEA (9.0 mL, 51.7 mmol, 1.5 eq.), 2-amino-5-methoxy-benzenethiol (5.88 g, 37.9 mmol, 1.1 eq.) and T3P (25.0 mL, 41.3 mmol, 1.2 eq.). The resulting mixture was stirred at reflux for 2.5 h followed by 17 h at RT. The reaction was concentrated to dryness and the residue was diluted with ethyl acetate (200 mL), washed with brine (200 mL), saturated Na ₂ CO ₃ solution (2 x 100 mL), brine (100 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 50 g high-capacity cartridge eluting with 0-100% ethyl acetate in hexane to afford product (3.35 g, 8.19 mmol, 24% yield) as a green solid. 1H NMR (400 MHz, DMSO-d6) 5 7.86 (d, J = 8.9 Hz, 2H), 7.80 (s, 1H), 7.73 - 7.68 (m, 2H), 7.66 (d, J = 2.6 Hz, 1H), 7.53 (t, J = 7.7 Hz, 1H), 7.11 (dd, J = 8.9, 2.6 Hz, 1H), 5.17 - 5.05 (m, 1H), 3.84 (s, 3H), 3.53 (dd, J = 13.8, 4.4 Hz, 1H), 3.12 (dd, J = 13.8, 11.0 Hz, 1H), 1.31 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.2 for [M+H] ⁺

[000977] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000978] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (3.35 g, 8.19 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (40.0 mL, 160.0 mmol, 19.5 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product (2.76 g, 6.07 mmol, 74% yield), as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.13 (d, J = 4.9 Hz, 3H), 7.92 (d, J = 9.0 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.75 - 7.71 (m, 2H), 7.58 (dt, J = 7.9, 1.5 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.15 (dd, J = 9.0, 2.6 Hz, 1H), 5.29 - 5.20 (m, 1H), 3.83 (s, 3H), 3.54 (d, J = 5.9 Hz, 1H), 3.37 (dd, J = 13.8, 8.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 310.1 for [M+H] ⁺

[000979] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[000980] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (2.76 g, 7.98 mmol, 1.0 eq.) in DMF (30.0 mL) was added triethylamine (3.9 mL, 27.9 mmol, 3.5 eq.) and the reaction mixture was cooled to 0°C. 3- nitrobenzene-1 -sulfonyl chloride (2.12 g, 9.58 mmol, 1.2 eq.) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 1 h. The reaction mixture was diluted with EtOAc (150 mL), washed with brine (150 mL), aq. saturated Na ₂ CO ₃ solution

(150 mL) and brine (150 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was then triturated with DCM (15 mL) and filtered under vacuum to afford product (2.15 g, 4.35 mmol, 54% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 9.29 (s, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.09 (t, J = 2.0 Hz, 1H), 7.87 (ddd, J = 7.8, 1.8, 1.0 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.62 (t, J = 2.0 Hz, 2H), 7.59 (t, J = 8.0 Hz, 1H), 7.54 (dt, J = 7.8, 1.5 Hz, 1H), 7.44 (dt, J = 7.8, 1.4 Hz, 1H), 7.25 (t, J = 7.7 Hz, 1H), 7.07 (dd, J = 8.9, 2.6 Hz, 1H), 5.11 (dd, J = 10.7, 4.6 Hz, 1H), 3.82 (s, 3H), 3.38 (dd, J = 13.9, 4.6 Hz, 1H), 3.03 (dd, J = 13.9, 10.7 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 mm. m/z = 495.0 for [M+H] ⁺

[000981] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[000982] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (2.15 g, 4.35 mmol, 1.0 eq.) in ethanol (22.0 mL) and water (11.0 mL) were added iron (2.43 g, 43.5 mmol, 10.0 eq.) and ammonium chloride (1.16 g, 21.7 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3.5 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness and the residue taken up in DCM (50 mL). The organic layer was washed with aq. saturated NaHCO ₃ solution (50 mL) and the aqueous was re-extracted with DCM (2 x 50 mL). The combined organics were then washed with brine (50 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (1.71 g, 3.68 mmol, 85% yield), as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.65 (d, J = 6.6 Hz, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.58 - 7.51 (m, 2H), 7.47 (d, J = 7.8 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.1 Hz, 1H), 6.59 (dt, J = 7.8, 2.2 Hz, 2H), 5.40 (s, 2H), 4.83 (s, 1H), 3.83 (s, 3H), 3.35 (d, J = 5.2 Hz, 1H), 2.96 (dd, J = 13.8, 9.7 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.07 min. m/z = 465.1 for [M+H] ⁺

[000983] Step 5: tert-butyl N-[2-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate

[000984] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]benzenesulfonamide (1.71 g, 3.68 mmol, 1.0 eq.) in DMF (17.0 mL) were added N-alpha-t-BOC-glycine (0.770 g, 4.42 mmol, 1.2 eq.), DIPEA (1.9 mL, 11.0 mmol, 3.0 eq. ) and HATU (2.10 g, 5.52 mmol, 1.5 eq. ) and the reaction mixture was stirred at RT for 3 h. The reaction mixture was diluted with EtOAc (170 mL), washed with brine (170 mL), aq. saturated Na ₂ CO ₃ solution (170 mL) and brine (170 mL) before drying over anhydrous sodium sulfate and being concentrated to dryness to afford the product (2.55 g, 3.81 mmol, assumed quantitative yield) as a beige foam. 1H NMR (400 MHz, DMSO-d6) 5 10.05 (s, 1H), 8.91 (d, J = 8.4 Hz, 1H), 7.82 (d, J = 8.8 Hz, 2H), 7.65 (d, J = 2.6 Hz, 1H), 7.54 (d, J = 6.4 Hz, 2H), 7.51 - 7.41 (m, 2H), 7.28 (t, J = 7.7 Hz, 1H), 7.22 (t, J = 8.0 Hz, 1H), 7.13 (dt, J = 8.0, 1.4 Hz, 1H), 7.11 - 7.05 (m, 2H), 4.93 - 4.82 (m, 1H), 3.83 (s, 3H), 3.74 (d, J = 6.2 Hz, 2H), 3.35 (dd, J = 13.9, 4.6 Hz, 1H), 2.96 (dd, J = 13.8, 10.6 Hz, 1H), 1.42 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.14 min. m/z = 622.2 for [M+H] ⁺

[000985] Step 6: tert-butyl N-[2-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy - 1 ,3 -benzothiazol-2-yl)ethy 1] sulfamoyl] anilino] -2-oxo-ethyl] carbamate

[000986] To a magnetically stirred solution of tert-butyl N-[2-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo -ethyl]carbamate (2.55 g, 3.81 mmol, 1.0 eq.) in EtOH (50.0 mL) were added hydroxylamine hydrochloride (0.530 g, 7.63 mmol, 2.0 eq.) and DIPEA (2.0 mL, 11.4 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 4 h. The reaction mixture was cooled down to RT and stirred for a further 16.5 h before being concentrated to dryness to afford product (3.73 g, 5.47 mmol, assumed quantitative yield) as a beige foam. 0.500 g of the residue was submitted to Reach for purification and chiral separation.Purification was performed via SEC on a Chiralpak IG (21 mm x 250 mm, 5 um) eluting with 30:70 hexane: ethanol (0.2% v/v NH ₃ ) to afford product (0.130 g, 0.190 mmol, 26% yield) as an off-white solid. UPLC-MS (acidic 2.5 min): rt 1.19 min, m/z = 655.3 [M+H] ⁺

[000987] Step 7: 2-amino-N-[3-[[rac-(lR)-2-[3-(N'-hydroxycarbamimidoyl)phenyl ]-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]phenyl]acetami de hydrochloride

[000988] To tert-butyl N-[2-oxo-2-[3-[[rac-(lR)-2-[3-(N'-hydroxycarbamimidoyl)pheny l]-l- (6-methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]eth yl]carbamate (0.130 g, 0.190 mmol, 1.0 eq.) was added 4 N HC1 in 1,4-dioxane solution (1.0 mL, 4.0 mmol, 21.1 eq.) and the reaction mixture was stirred at RT for 1 h. Further 4 N HC1 in 1,4-dioxane solution (1.0 mL, 4.0 mmol, 21.1 eq.) was added and the resulting mixture was stirred at RT for 1 h. The reaction mixture was concentrated to dryness, before being triturated with diethyl ether, suspended in water and re-dried, to afford product (0.100 g, 0.176 mmol, 92% yield) as a beige solid.1H NMR (400 MHz, DMSO-d6) 5 12.84 (s, 1H), 11.28 (s, 1H), 10.89 (s, 1H), 9.21 (s, 1H), 8.96 (d, J = 8.2 Hz, 1H), 8.28 (t, J = 5.9 Hz, 3H), 7.94 (t, J = 1.9 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.61 (s, 1H), 7.49 (dt, J = 7.9, 1.7 Hz, 2H), 7.43 (d, J = 7.8 Hz, 1H), 7.27 (t, J = 7.8 Hz, 1H), 7.19 (t, J = 7.8 Hz, 1H), 7.14 (dt, J = 7.9, 1.5 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 4.99 - 4.89 (m, 1H), 3.83 (s, 4H), 3.40 - 3.30 (m, 1H), 3.01 (dd, J = 13.8, 10.0 Hz, 1H). UPLC- MS (acidic 6 min): Rt = 1.64 min; m/z = 555.2 for [M+H] ⁺ , 97% purity

Example 46: Exemplary synthesis of Compound 228

[000989] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[000990] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 100 mL), washed with saturated Na ₂ CO ₃ solution (50 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford product as a brown solid (4.30 g, 10.5 mmol, 51% yield). 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[000991] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[000992] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (50.0 mL, 200.0 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product as a brown solid (3.97 g, 11.5 mmol, assumed quantitative yield) which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 310.0 for [M+H] ⁺

[000993] Step 3: Methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[000994] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.00 g, 2.89 mmol, 1.0 eq.) in DMF (10.0 mL) was added triethylamine (1.21 mL, 8.67 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C. Methyl- 3 -chlorosulfonylbenzoate (0.81 g, 3.47 mmol, 1.2 eq.) was added portion wise at 0°C over 10 min and the reaction mixture was allowed to warm to RT for 4 h. The reaction was quenched via the addition of water (50 mL) and extracted with ethyl acetate (100 mL followed by 50 mL). The combined organics were then washed with brine (2 x 100 mL) and concentrated to dryness. The residue was suspended in DCM (10 mL) and filtered, washing with further DCM (5 mL) afford product (0.980 g, 1.93 mmol, 67% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5

9.09 (s, 1H), 7.94 - 7.84 (m, 2H), 7.74 (dd, J = 17.0, 8.3 Hz, 2H), 7.61 (d, J = 12.3 Hz, 2H), 7.53 - 7.38 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.88 (s, 3H), 3.83 (s, 3H), 3.35 (d, J = 14.6 Hz, 1H), 3.05 - 2.94 (m, 1H). UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 508.0 for [M+H] ⁺

[000995] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[000996] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (1.96 g, 3.85 mmol, 1.0 eq.) in THF (40.0 mL) was added a solution of lithium hydroxide (0.48 g, 11.6 mmol, 3.0 eq.) in water (12.0 mL) and the resulting mixture stirred at RT for 5 h. The reaction volume was reduced by half, diluted with water (100 mL) and then extracted with ethyl acetate (2 x 100 mL). The aqueous phase was acidified to pH 1.0 by the slow addition of 1 M HC1, extracted with ethyl acetate (2 x 100 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (1.82 g, 3.70 mmol, 96% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 13.30 (s, 1H), 9.06 (d, J = 8.5 Hz, 1H), 7.92 (d, J = 9.0 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 16.4 Hz, 2H), 7.59 (s, 1H), 7.50 (d, J = 7.9 Hz, 1H), 7.41 (q, J = 8.0 Hz, 2H), 7.23 (t, J = 7.8 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.83 (s, 3H), 3.39 - 3.34 (m, 1H), 2.99 (t, J = 12.3 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 0.84 mm. m/z = 494.0 for [M+H] ⁺

[000997] Step 5: tert-butyl N-[2-[[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]sulfamoyl]benzoyl]-methyl-amino]ethyl]carbamate

[000998] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.400 g, 0.810 mmol, 1.0 eq.) in DMF (4.0 mL) were added N-boc-2-methylamino-ethylamine (0.170 g, 0.973 mmol, 1.2 eq.), DIPEA (0.42 mL, 2.43 mmol, 3.0 eq.) and HATU (0.460 g, 1.22 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 1 h 40 min. The reaction mixture was diluted with ethyl acetate (40 mL), washed with brine (40 mL), saturated Na ₂ CO ₃ solution (40 mL) and brine (40 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was then purified via normal phase column chromatography on a 12 g cartridge eluting with 40-80% ethyl acetate in isohexane to afford the product (0.450 g, 0.691 mmol, 85% yield) as a colourless gum. 1H NMR (400 MHz, DMSO-d6) 5 8.64 (d, J = 8.5 Hz, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.64 (dt, J = 12.2, 1.8 Hz, 2H), 7.61 - 7.56 (m, 1H), 7.54 (tt, J = 4.9, 1.5 Hz, 2H), 7.51 - 7.45 (m, 2H), 7.36 (td, J = 7.8, 5.9 Hz, 2H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 6.51 (s, 1H), 5.03 (td, J = 8.9, 5.7 Hz, 1H), 3.84 (s, 3H), 3.38 (dd, J = 14.0, 5.7 Hz, 2H), 3.23 - 3.09 (m, 3H), 2.85 (s, 3H), 2.72 (s, 2H), 1.39 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 650.2 for [M+H] ⁺

[000999] Step 6: tert-butyl N-[2-[[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methox y- 1 ,3 -benzothiazol-2-yl)ethy 1] sulfamoyl] benzoyl] -methyl-amino] ethyl] carbamate

[0001000] To a magnetically stirred solution of tert-butyl N-[2-[[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]-methy l-amino]ethyl]carbamate (0.370 g, 0.568 mmol, 1.0 eq.) in EtOH (8.0 mL) were added hydroxylamine hydrochloride (0.079 g, 1.14 mmol, 2.0 eq.) and DIPEA (0.30 mL, 1.70 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 6 h and then at RT for a further 16 h. The reaction was then concentrated to dryness to afford product (0.540 g, 0.795 mmol) UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 683.2 for [M+H] ⁺

[0001001] Step 7: [[amino-[3-[2-[[3-[2-(tert-butoxycarbonylamino)ethyl-methyl- carbamoyl]phenyl]sulfonylamino]-2-(6-methoxy-l,3-benzothiazo l-2- yl)ethyl]phenyl]methylene]amino] acetate

[0001002] To a magnetically stirred solution of tert-butyl N-[2-[[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]benzoyl]- methyl-amino] ethyl] carbamate (0.540 g, 0.795 mmol, 1.0 eq) in acetic acid (5.0 mL) was added acetic anhydride (0.23 mL, 2.39 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 4.5 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-100% ethyl acetate in isohexane to afford the product (0.300 g, 0.411 mmol, 52% yield) as a colourless glass. ¹ H NMR (400 MHz, DMSO-d6) 5 8.58 (s, 1H), 7.76 (d, J = 8.9 Hz, 1H), 7.67 (t, J = 1.7 Hz, 1H), 7.63 - 7.55

(m, 2H), 7.54 - 7.47 (m, 2H), 7.44 (dt, J = 7.7, 1.4 Hz, 1H), 7.34 (t, J = 7.7 Hz, 1H), 7.25 (dt, J = 7.7, 1.6 Hz, 1H), 7.19 (t, J = 7.6 Hz, 1H), 7.06 (dd, J = 8.9, 2.6 Hz, 1H), 6.46 (s, 1H), 6.36 (s, 2H), 5.02 (dd, J = 8.5, 6.1 Hz, 1H), 3.84 (s, 3H), 3.34 (dd, J = 14.1, 6.1 Hz, 3H), 3.14 (dd, J = 14.0, 8.2 Hz, 3H), 2.84 (s, 3H), 2.15 (s, 3H), 1.40 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 725.2 for [M+H] ⁺

[0001003] Step 8: tert-butyl N-[2-[[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]-methyl-amino]ethy l]carbamate

[0001004] To a magnetically stirred solution of [[amino-[3-[2-[[3-[2-(tert- butoxycarbonylamino)ethyl-methyl-carbamoyl]phenyl]sulfonylam ino]-2-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]phenyl]methylene]amino] acetate (0.300 g, 0.411 mmol, 1.0 eq) in acetic acid (3.0 mL) was added zinc (0.540 g, 8.22 mmol, 20 eq.). The reaction mixture was stirred at room temperature for 20.5 h. Further zinc (0.270 g, 4.19 mmol, 10.2 eq.) was added and the reaction stirred for a further 71 h. The reaction mixture was filtered, washing with copious acetonitrile, and concentrated to dryness. The residue was purified by reverse phase preparative- HPLC eluting with 25-100% MeCN:H ₂ O (0.05% TFA) followed by a second purification eluting with 50-100% MeOH:H ₂ O (0.1% NH ₃ ) to afford product (0.026 g, 0.0390 mmol, 9% yield) as an off-white solid and as a mixture of desired product and boc-deprotected material. UPLC-MS (acidic 6 min): Rt = 1.47 min; m/z = 567.2 for [M-boc+H] ⁺ , 39% purity; Rt = 2.50 min, m/z = 667.3 for [M+H] ⁺ , 53% purity.

[0001005] Step 9: N-(2-aminoethyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy- l,3- benzothiazol-2-yl)ethyl]sulfamoyl]-N-methyl-benzamide

[0001006] A suspension of tert-butyl N-[2-[[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]-methyl-amino]ethy l]carbamate (0.026 g, 0.0207 mmol, 1.0 eq.) in 4 N HC1 in 1,4-di oxane (1.0 mL, 4.00 mmol, 194 eq.) was stirred at RT for 5 min before being concentrated to dryness. This process was repeated once more. The residue was then triturated with diethyl ether (2 x 1 mL) and dried in vacuo. The residue was re-suspended in 4 N HC1 in 1,4-di oxane as before and stirred for a further 3.5 h before frying. The residue was then suspended in acetonitrile/water before concentrating to dryness, triturating again with diethyl ether and drying in a vacuum oven to afford product (0.016 g, 0.0262 mmol, assumed quantitative yield) as an off-white solid.1H NMR (400 MHz, DMSO-d6) 5 9.28 (s, 2H), 9.04 (d, J = 9.6 Hz, 3H), 7.97 (s, 3H), 7.81 - 7.69 (m, 3H), 7.60 (d, J = 2.5 Hz, 1H), 7.59 - 7.54 (m, 1H), 7.54 - 7.47 (m, 3H), 7.36 - 7.25 (m, 2H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 5.11 - 5.00 (m, 1H), 3.81 (s, 3H), 3.66 (s, 2H), 3.07 (s, 3H), 2.75 (s, 3H). UPLCMS (acidic 6 mm): Rt = 1.46 mm, m/z = 567.2 for [M+H] ⁺ , 94% purity.

Example 47: Exemplary synthesis of Compound 229

[0001007] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001008] To a magnetically stirred solution of (S)-N-Boc-2-cyanophenylalanine (2.50 g, 8.61 mmol, 1.0 eq.) in toluene (50.0 mb) were added DIPEA (3.7 mL, 21.5 mmol, 2.5 eq.), 2-amino- 5-methoxy-benzenethiol (1.47 g, 9.47 mmol, 1.1 eq.) and T3P (3.8 mL, 12.9 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 4 h. Further 2-amino-5-methoxy- benzenethiol (0.600 g, 3.87 mmol, 0.45 eq.) and the resultant mixture was stirred at reflux for a further 1 h before cooling to RT and stirring for 16 h. The reaction was then quenched via the addition of 10% (w/v) aqueous citric acid solution (50 mL) and stirring for 10 min. The organics were then extracted with DCM (3 x 50 mL), washed with saturated Na ₂ CO ₃ solution (2 x 50 mL), washed with brine (50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 50 g cartridge eluting with 0-40% ethyl acetate in isohexane to afford product (1.25 g, 3.05 mmol, 35% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 7.93 (d, J = 8.9 Hz, 1H), 7.89 - 7.78 (m, 2H), 7.65 (d, J = 8.5 Hz, 2H), 7.54 (d, J = 7.8 Hz, 1H), 7.44 (t, J = 7.6 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.22 (s, 1H), 3.83 (s, 3H), 3.71 (dd, J = 14.5, 4.9 Hz, 1H), 3.26 (d, J = 12.9 Hz, 1H), 1.30 (s, 7H). UPLC-MS (basic 2 mm) Rt = 1.22 min. m/z = 410.2 for [M+H] ⁺

[0001009] Step 2: 2-[rac-(2S)-2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride

[0001010] To a magnetically stirred mixture of tert-butyl N-[rac-(lS)-2-(2-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]carbamate (1.25 g, 3.05 mmol, 1.0 eq.) in 1,4-dioxane (2.5 mL) was added 4 N HC1 in 1 ,4-dioxane (13.0 mL, 50.0 mmol, 16.4 eq.) was stirred at RT for 18 h. The reaction mixture was concentrated to dryness to afford product (1.12 g, 3.24 mmol, assumed quantitative yield) as a brown solid which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.03 (s, 3H), 7.93 (d, J = 9.0 Hz, 1H), 7.78 (d, J = 7.7 Hz, 1H), 7.72 - 7.64 (m, 2H), 7.58 (d, J = 7.8 Hz, 1H), 7.47 (t, J = 7.6 Hz, 1H), 7.19 - 7.12 (m, 1H), 5.26 (s, 1H), 3.82 (s, 3H), 3.63 (dd, J = 14.1, 5.6 Hz, 1H), 3.52 (d, J = 13.5 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 310.0 for [M+H] ⁺

[0001011] Step 3: N-[rac-(lS)-2-(2-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol- 2- yl)ethyl]benzenesulfonamide

[0001012] To a magnetically stirred solution of 2-[rac-(2S)-2-amino-2-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzonitrile;hydrochloride (1.12 g, 3.24 mmol, 1.0 eq.) in DMF (12.0 mL) was added triethylamine (1.6 mL, 11.3 mmol, 3.5 eq.) and the reaction mixture was cooled to 0°C and stirred for 15 min. Benzenesulfonyl chloride (0.50 mL, 3.89 mmol, 1.2 eq.) was added dropwise at 0°C and the reaction mixture was allowed to warm to RT for 1.5 h. The reaction mixture was then purified via reverse phase column chromatography (C18, 375 g cartridge) eluting with 40-60% MeCN:H ₂ O (+0.1% NH ₃ ) to afford product (0.470 g, 1.05 mmol, 32% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 9.07 (d, J = 8.5 Hz, 1H), 7.78 (d, J = 9.0 Hz, 1H), 7.65 - 7.59 (m, 2H), 7.50 (d, J = 8.0 Hz, 2H), 7.47 - 7.42 (m, 1H), 7.40 (t, J = 7.9 Hz, 1H), 7.31 (t, J = 7.0 Hz, 3H), 7.07 (dd, J = 8.8, 2.4 Hz, 1H), 5.06 - 4.98 (m, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 14.2, 5.7 Hz, 1H), 3.17 (dd, J = 14.2, 9.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.15 min. m/z = 450.0 for [M+H] ⁺

[0001013] Step 4: N'-hydroxy-2-[rac-(2S)-2-(benzenesulfonamido)-2-(6-methoxy-l ,3- benzothiazol-2-yl)ethyl]benzamidine

[0001014] To a magnetically stirred solution of N-[2-(2-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]benzenesulfonamide (0.471 g, 1.05 mmol, 1.0 eq.) in EtOH (15.0 mL) were added hydroxylamine hydrochloride (0.146 g, 2.10 mmol, 2.0 eq.) and DIPEA (0.55 mL, 3.14 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 20 h. The reaction was then concentrated to dryness to afford product (0.510 g, 1.05 mmol, assumed quantitative yield) as an orange oil which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.09 min. m/z = 483.0 for [M+H] ⁺

[0001015] Step 5: [[(Z)-[amino-[2-[rac-(2S)-2-(benzenesulfonamido)-2-(6-methox y-l,3- benzothiazol-2-yl)ethyl]phenyl]methylene]amino] acetate

[0001016] To a magnetically stirred solution of tert- butyl N'-hydroxy-2-[rac-(2S)-2- (benzenesulfonamido)-2-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]benzamidine (0.510 g, 1.05 mmol, 1.0 eq) in acetic acid (8.0 mL) was added acetic anhydride (0.30 mL, 3.15 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 2 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 20-100% ethyl acetate in isohexane to afford the product (0.398 g, 0.759 mmol, 72% yield) as an off-white oily solid. 1H NMR (400 MHz, DMSO-d6) 5 9.57 (d, J = 5.9 Hz, 1H), 9.10 (d, J = 7.0 Hz, 1H), 8.10 (s, 1H), 7.79 (d, J = 9.5 Hz, 2H), 7.64 (dd, J = 4.8, 2.5 Hz,

2H), 7.42 - 7.29 (m, 8H), 7.26 - 7.12 (m, 7H), 7.13 - 7.05 (m, 5H), 7.00 (s, 3H), 4.95 (s, 2H), 4.84 (s, OH), 3.83 (d, J = 3.2 Hz, 7H), 3.24 (d, J = 11.0 Hz, 1H), 3.08 - 2.97 (m, 1H), 2.60 (s, 1H), 2.18 (s, 4H). UPLC-MS (basic 2 min): Rt = 1.09 min; m/z = 525.0 for [M+H] ⁺

[0001017] Step 6: 2-[rac-(2S)-2-(benzenesulfonamido)-2-(6-methoxy-l,3-benzothi azol-2- yl)ethyl]benzamidine

[0001018] To a magnetically stirred solution of [(Z)-[amino-[2-[rac-(2S)-2- (benzenesulfonamido)-2-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]phenyl]methylene]amino] acetate (0.390 g, 0.740 mmol, 1.0 eq) in acetic acid (10.0 mL) was added zinc (0.970 g, 14.8 mmol, 20 eq.). The reaction mixture was stirred at room temperature for 72 h. The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with 5-100% MeCN:H ₂ O (0.05% TFA) before resalting the product by suspending in 4 N HC1 in 1,4-dioxane (1.0 mL, 4.00 mmol) and concentrating four times. A second purification via the same method and subsequent resalting afforded the product (0.008 g, 0.0171 mmol, 2% yield) as an off-white solid. UPLC-MS (acidic 6 min): Rt = 2.14 min; m/z = 467.2 for [M+H] ⁺ , 100% purity. 1H NMR (400 MHz, DMSO-d6) 5 9.32 (s, 2H), 9.14 (s, 2H), 8.92 (d, J = 8.7 Hz, 1H), 7.74 (d, J = 8.9 Hz, 1H), 7.68 - 7.58 (m, 2H), 7.56 (d, J = 2.6 Hz, 1H), 7.48 - 7.41 (m, 2H), 7.38 - 7.29 (m, 4H), 7.26 (d, J = 6.5 Hz, 1H), 7.06 (dd, J = 9.0, 2.6 Hz, 1H), 5.02 (q, J = 7.7 Hz, 1H), 3.80 (s, 3H), 3.74 - 3.64 (m, 1H), 3.17 (dd, J = 14.7, 7.8 Hz, 1H). Mono-HCl salt.

Example 48: Exemplary synthesis of Compound 223

[0001019] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001020] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 100 mL), washed with saturated Na ₂ CO ₃ solution (50 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford product (4.30 g, 10.5 mmol, 51% yield) as a brown solid. 1H NMR (400 MHz, DMSO) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[0001021] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[0001022] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (50.0 mL, 200.0 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product (3.97 g, 11.5 mmol, assumed quantitative yield), as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.02 min. m/z = 310.0 for [M+H] ⁺

[0001023] Step 3: Methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[0001024] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.00 g, 2.89 mmol, 1.0 eq.) in DMF (10.0 mL) was added triethylamine (1.21 mL, 8.67 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C. Methyl- 3 -chlorosulfonylbenzoate (0.81 g, 3.47 mmol, 1.2 eq.) was added portion wise at 0°C over 10 min and the reaction mixture was allowed to warm to RT for 4 h. The reaction was quenched via the addition of water (50 mL) and extracted with ethyl acetate (100 mL followed by 50 mL). The combined organics were then washed with brine (2 x 100 mL) and concentrated to dryness. The residue was suspended in DCM (10 mL) and filtered, washing with further DCM (5 mL) afford product (0.980 g, 1.93 mmol, 67% yield) as a white solid. 1H NMR (400 MHz, DMSO) 5 9.09 (s, 1H), 7.94 - 7.84 (m, 2H), 7.74 (dd, J = 17.0, 8.3 Hz, 2H), 7.61 (d, J = 12.3 Hz, 2H), 7.53 - 7.38 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.88 (s, 3H), 3.83 (s, 3H), 3.35 (d, J = 14.6 Hz, 1H), 3.05 - 2.94 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.13 mm. m/z = 508.0 for [M+H] ⁺

[0001025] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[0001026] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (1.96 g, 3.85 mmol, 1.0 eq.) in THF (40.0 mL) was added a solution of lithium hydroxide (0.48 g, 11.6 mmol, 3.0 eq.) in water (12.0 mL) and the resulting mixture stirred at RT for 5 h. The reaction volume was reduced by half, diluted with water (100 mL) and then extracted with ethyl acetate (2 x 100 mL). The aqueous phase was acidified to pH 1.0 by the slow addition of 1 M HC1, extracted with ethyl acetate (2 x 100 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (1.82 g, 3.70 mmol, 96% yield) as a white solid. 1H NMR (400 MHz, DMSO) 5 13.30 (s, 1H), 9.06 (d, J = 8.5 Hz, 1H), 7.92 (d, J = 9.0 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 16.4 Hz, 2H), 7.59 (s, 1H), 7.50 (d, J = 7.9 Hz, 1H), 7.41 (q, J = 8.0 Hz, 2H), 7.23 (t, J = 7.8 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.83 (s, 3H), 3.39 - 3.34 (m, 1H), 2.99 (t, J = 12.3 Hz, 1H).

UPLC-MS (basic 2 min) Rt = 0.84 min. m/z = 494.0 for [M+H] ⁺

[0001027] Step 5: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001028] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.300 g, 0.608 mmol, 1.0 eq.) in DMF (3.2 mL) were added 2-methoxyethylamine (0.046 g, 0.608 mmol, 1.2 eq.), DIPEA (0.32 mL, 1.82 mmol,

3.0 eq.) and HATU (0.350 g, 0.912 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 6 h. Further 2-methoxyethylamine (0.23 mg, 0.304 mmol, 0.5 eq.) and HATU (0.173 g, 0.456 mmol, 0.75 eq.) were added and the reaction was stirred at RT for a further 18 h. The reaction mixture was diluted with ethyl acetate (100 mL), washed with brine (100 mL), saturated Na ₂ CO ₃ solution (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was dissolved in DCM, leaving behind insoluble material that was dried to afford product (0.154 g, 0.280 mmol, 46% yield) as a white solid. The dissolved material was purified by normal phase column chromatography (20 g cartridge) eluting with 40- 100% EtOAc:heptane to afford product (0.024 g, 0.0436 mmol, 7% yield) as a white solid.1H NMR (400 MHz, DMSO) 5 8.99 (d, J = 8.4 Hz, 1H), 8.63 (s, 1H), 7.96 - 7.87 (m, 2H), 7.81 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 2.5 Hz, 1H), 7.61 - 7.52 (m, 2H), 7.46 (d, J = 7.9 Hz, 1H), 7.39 (t, J = 8.4 Hz, 2H), 7.17 (t, J = 7.8 Hz, 1H), 7.09 (dd, J = 8.6, 2.4 Hz, 1H), 5.09 - 4.99 (m, 1H), 3.84 (d, J = 1.8 Hz, 3H), 3.54 - 3.42 (m, 3H), 3.37 (dd, J = 13.9, 4.3 Hz, 1H), 3.04 - 2.90 (m, 1H). UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 551.0 for [M+H] ⁺

[0001029] Step 6: 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-b enzothiazol- 2-yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001030] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzami de (0.178 g, 0.323 mmol, 1.0 eq.) in EtOH (6.0 mL) were added hydroxylamine hydrochloride (0.045 g, 0.647 mmol, 2.0 eq.) and DIPEA (0.17 mL, 0.970 mmol, 3.0 eq.). The reaction mixture was stirred at reflux for 20 h. Further hydroxylamine hydrochloride (0.022 g, 0.323 mmol, 1.0 eq.) and DIPEA (0.084 mL, 0.485 mmol, 1.5 eq.) were added and the reaction mixture was stirred at reflux for a further 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.19 g, 0.324 mmol, assumed quantitative yield), as a colorless oil, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.93 min. m/z = 584.0 for [M+H] ⁺

[0001031] Step 7: [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[[3-(2- methoxyethylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]meth ylene]amino] acetate

[0001032] To a magnetically stirred solution of 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l- (6-methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]-N-(2-metho xyethyl)benzamide (0.190 g, 0.324 mmol, 1.0 eq) in acetic acid (3.0 mL) was added acetic anhydride (0.092 mL, 0.971 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 20 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 20-100% EtO Ac: isohexane to afford product (0.107 g, 0.171 mmol, 53% yield) as a white solid. 1H NMR (400 MHz, DMSO) 5 8.98 (d, J = 8.2 Hz, 1H), 8.65 (t, J = 5.5 Hz, 1H), 7.92 (t, J = 1.9 Hz, 1H), 7.84 - 7.71 (m, 2H), 7.62 (d, J = 2.6 Hz, 1H), 7.54 (dt, J = 7.9, 1.4 Hz, 1H), 7.49 (s, 1H), 7.39 (d, J = 7.8 Hz, 1H), 7.30 (t, J = 7.8 Hz, 1H), 7.22 (d, J = 7.7 Hz, 1H), 7.10 - 7.01 (m, 2H), 6.71 (s, 2H), 4.94 (td, J = 9.3, 5.0 Hz, 1H), 3.82 (s, 3H), 3.46 (dt, J = 19.1, 5.5 Hz, 4H), 3.33 - 3.24 (m, 5H), 2.96 (dd, J = 13.8, 10.1 Hz, 1H), 2.16 (s, 3H). UPLC- MS (basic 2 min): Rt = 0.99 min; m/z = 626.1 for [M+H] ⁺

[0001033] Step 8: 3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiazol- 2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001034] To a magnetically stirred solution [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)- 2-[[3-(2-methoxyethylcarbamoyl)phenyl]sulfonylamino]ethyl]ph enyl]methylene]amino] acetate (0.110 g, 0.171 mmol, 1.0 eq) in acetic acid (3.0 mL) was added zinc (0.220 g, 3.42 mmol, 20 eq.). The reaction mixture was stirred at RT for 20 h. Further zinc (0.220 g, 3.42 mmol, 20 eq.) was added and the reaction stirred for a further 24 h at RT. Further zinc (0.220 g, 3.42 mmol, 20 eq.) was added and the reaction mixture was stirred at RT for a further 24 h. The reaction mixture was filtered, washing with copious acetonitrile, ethanol and DCM and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 15-100% MeCN:H ₂ O eluent (0.05 % TFA) followed by a second purification by reverse phase preparative-HPLC eluting with a 30-100% MeCN:H ₂ O eluent (0.1% NH ₃ ) to afford product (0.040 g, 0.0705 mmol, 41% yield) as a white solid. UPLC-MS (basic 6 min): Rt = 2.05 min; m/z

= 568.1 for [M+H] ⁺ , 98% purity. 1H NMR (400 MHz, DMSO) 5 8.60 (s, 1H), 7.96 (d, J = 1.8 Hz, 1H), 7.72 (dd, J = 8.5, 5.7 Hz, 2H), 7.59 (s, 1H), 7.53 (q, J = 2.9 Hz, 2H), 7.43 (d, J = 7.7 Hz, 1H), 7.30 - 7.20 (m, 2H), 7.12 (t, J = 7.7 Hz, 1H), 7.02 (dd, J = 8.9, 2.6 Hz, 1H), 4.77 (dd, J = 8.8, 4.8 Hz, 1H), 3.80 (s, 3H), 3.47 (dd, J = 6.3, 4.0 Hz, 2H), 3.43 (t, J = 4.7 Hz, 2H), 3.28 (s, 3H), 3.20 (dd, J = 13.4, 4.8 Hz, 1H), 2.96 (dd, J = 13.4, 8.9 Hz, 1H). Chiral analysis by Reach found 50.4% 1 ^st eluting isomer (rt 3.15 min) and 49.6% 2 ^nd eluting isomer (rt 5.14 min).

[0001035] Step 9: 3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiazol- 2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001036] 3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiazol- 2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide (34 mg, 0.0599 mmol) was submitted to Reach for chiral purification. Purification was achieved using SFC on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 MeOH:CO ₂ (0.2% v/v NH ₃ ) to afford the 1 ^st eluting enantiomer of the product (10 mg, 0.0176 mmol). This was then suspended in 4 N HC1 in 1,4-dioxane (1 mL, 4.00 mmol), mixed for 1 min and concentrated to dryness. This process was repeated a further two times before dissolving the residue in water, concentrating and drying in a vacuum oven to afford product (0.010 g, 0.0176 mmol, 29% yield) as an off-white solid. 1H NMR (400 MHz, DMSO) 5 9.14 (s, 2H), 8.97 (d, J = 8.3 Hz, 1H), 8.91 (s, 2H), 8.66 (d, J = 5.7 Hz, 1H), 7.94 (t, J = 1.8 Hz, 1H), 7.84 (dt, J = 7.9, 1.4 Hz, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.68 (d, J = 2.0 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.56 (dt, J = 8.0, 1.3 Hz, 1H), 7.51 - 7.45 (m, 1H), 7.44 (d, J = 7.7 Hz, 1H), 7.31 (t, J = 7.8 Hz, 1H), 7.19 (t, J = 7.8 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.04 (td, J = 9.4, 4.6 Hz, 1H), 3.83 (s, 3H), 3.74 - 3.65 (m, 1H), 3.37 (dd, J = 13.7, 4.8 Hz, 1H), 3.30 (s, 3H), 3.00 (dd, J = 13.8, 10.3 Hz, 1H). UPLC-MS (acidic 6 mm): Rt = 1.98 mm; m/z = 568.2 for [M+H] ⁺ , 99% purity

Example 49: Exemplary synthesis of Compound 223

[0001037] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001038] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (9.30 g, 27.6 mmol, 1.0 eq.) in toluene (162 mL) were added and T3P (16.0 mL, 27.6 mmol, 1.0 eq.), 2-amino-5-methoxy-benzenethiol (4.71 g, 30.3 mmol, 1.1 eq.) and DIPEA (14.0 mL, 82.7 mmol, 3.0 eq.). The resulting mixture was stirred at RT for 30 min then at reflux for 2 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The phases were separated, and the organics were washed with aq. saturated Na ₂ CO ₃ (200 mL), brine (200 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in heptane to afford the product (5.25 g, 12.8 mmol, 47% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.0 for [M+H]+

[0001039] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[0001040] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (5.25 g, 12.8 mmol, 1.0 eq.) in DCM (50 mL) was slowly added trifluoracetic acid (50.0 mL, 653 mmol, 51.0 eq.) and the reaction mixture was stirred at RT for 1 h. The reaction mixture was concentrated to dryness and the residue was suspended in DCM (50 mL), to which a solution of K ₂ CO ₃ (12.3 g) in water (50 mL) was added over a 10 min period. The resultant mixture was stirred at RT for 30 min. The phases were separated, and the organics were extracted with DCM (3 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrated to dryness. The residue was re-dissolved in DCM (20 mL) and a solution of K ₂ CO ₃ (7.8 g) in water (20 mL) was added. The resulting mixture was stirred for 2 h. The phases were separated and the organics were extracted with DCM (3 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrated to dryness to afford 3-[2-amino- 2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonitrile (3.97 g, 12.1 mmol, 94% yield) as a brown oil, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 7.83 - 7.72 (m, 2H), 7.67 (d, J = 7.8 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.09 - 7.02 (m, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.2 Hz, 3H), 3.37 (dd, J

= 13.6, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). - 6% DCM by weight. UPLC- MS (basic 2 min) Rt = 1.03 min. m/z = 309.9 for [M+H]+

[0001041] 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile (2.49 g, 7.57 mmol, 1.0 eq.) was suspended in 4 N HC1 in 1,4-dioxane (10.0 mL, 40.0 mmol, 5.3 eq.) and stirred at RT for 2 h. The reaction mixture was then triturated with diethyl ether (30 mL), filtered, and rinsed with copious diethyl ether to afford the product (2.11 g, 5.19 mmol, 69% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.01 (s, 3H), 7.93 (d, J = 9.0 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.75 (dt, J = 7.6, 1.4 Hz, 1H), 7.72 (d, J = 2.6 Hz, 1H), 7.58 (dt, J = 8.0, 1.5 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 7.15 (dd, J = 9.0, 2.6 Hz, 1H), 5.27 (s, 1H), 3.83 (s, 3H),

3.50 (dd, J = 13.9, 6.1 Hz, 1H), 3.43 - 3.30 (m, 1H). - residual Et20 and DCM present, small aliphatic impurity at 1.4 ppm. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 310.0 for [M+H]+

[0001042] Step 3: Methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[0001043] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (750 mg, 1.84 mmol, 1.0 eq.) in DMF (6 mL) was added triethylamine (0.8 mL, 5.53 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C and stirred for 10 min. Methyl-3-chlorosulfonylbenzoate (519 mg, 2.21 mmol, 1.2 eq.) was added portionwise over 10 min and the reaction mixture was allowed to warm to RT and stir for 3 h. The reaction was quenched via the addition of water (50 mL) and extracted with ethyl acetate (100 mL). The combined organics were then washed with water (3 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM and filtered to afford product (485 mg, 0.956 mmol, 52% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.10 (s, 1H), 7.92 (dt, J = 7.8, 1.4 Hz, 1H), 7.87 (t, J = 1.7 Hz, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.72 (ddd, J = 7.8, 2.0, 1.2 Hz, 1H), 7.66 - 7.57 (m, 2H),

7.50 (d, J = 7.8 Hz, 1H), 7.47 - 7.39 (m, 2H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 5.01 (s,lH), 3.88 (s, 3H), 3.83 (s, 3H), 3.40 - 3.34 (m, 1H), 3.00 (dd, J = 13.9, 10.7 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.29 mm. m/z = 508.0 for [M+H]+

[0001044] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[0001045] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (485 mg, 0.956 mmol, 1.0 eq.) in THF (10 mb) was added a solution of lithium hydroxide (120 mg, 2.87 mmol, 3.0 eq.) in water (3 mL) and the resulting mixture was stirred at RT for 4 h. The reaction volume was reduced by half, diluted with water (50 mL) and then extracted with ethyl acetate (50 mL). The aqueous phase was acidified to pH 2.0 via the slow addition of 1 M HC1 (ca. 5 mL) and left to stand for 5 min before filtering off the precipitate and allowing to air-dry to afford product (462 mg, 0.936 mmol, 98% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 13.32 (s, 1H), 9.06 (d, J = 8.5 Hz, 1H), 7.92 (ddd, J = 9.1, 1.7, 1.1 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.69 - 7.61 (m, 2H), 7.59 (t, J = 1.7 Hz, 1H), 7.51 (dt, J = 8.0, 1.5 Hz, 1H), 7.46 - 7.35 (m, 2H), 7.23 (t, J = 7.8 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 5.00 (ddd, J = 10.7, 8.5, 4.5 Hz, 1H), 3.83 (s, 3H), 3.37 (dd, J = 14.0, 4.5 Hz, 1H), 3.00 (dd, J = 13.9, 10.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 0.99 mm. m/z = 494.0 for [M+H]+

[0001046] Step 5: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001047] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.462 g, 0.936 mmol, 1.0 eq.) in DMF (6 mL) were added 2-methoxyethylamine (84.0 mg, 1.12 mmol, 1.2 eq.), DIPEA (0.5 mL, 2.81 mmol, 3.0 eq.) and HATU (537 mg, 1.40 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 18 h. The reaction mixture was diluted with ethyl acetate (30 mL), washed with aq. saturated Na ₂ CO ₃ (30 mL) and brine (2 x 30 mL). The organics were dried over anhydrous sodium sulfate and concentrated to dryness to afford product (272 mg, 0.494 mmol, 53% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.02 (d, J = 8.4 Hz, 1H), 8.68 - 8.61 (m, 1H), 7.97 - 7.87 (m, 2H), 7.81 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 2.6 Hz, 1H), 7.62 - 7.57 (m, 1H), 7.56 (d, J = 1.8 Hz, 1H), 7.46 (d, J = 8.0 Hz, 1H), 7.43 - 7.35 (m, 2H), 7.17 (t, J = 7.7 Hz, 1H), 7.09 (dd, J =

8.9, 2.6 Hz, 1H), 5.06 - 4.97 (m, 1H), 3.83 (s, 3H), 3.49 (ddt, J = 11.8, 9.1, 4.1 Hz, 4H), 3.41 - 3.34 (m, 1H), 3.30 (s, 3H), 3.04 - 2.91 (m, 1H). - residual EtOAc and DMF present, TMU impurities present. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 551.3 for [M+H]+

[0001048] Step 6: 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-b enzothiazol- 2-yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001049] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzami de (272 mg, 0.494 mmol, 1.0 eq.) in EtOH (6 mL) were added hydroxylamine hydrochloride (68.7 mg, 0.988 mmol, 2.0 eq.) and DIPEA (0.3 mL, 1.48 mmol, 3.0 eq.). The reaction mixture was stirred at reflux for 1.5 h, then cooled to RT and stirred for 40.5 h before concentrating to dryness to afford product (288 mg, 0.493 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.93 min. m/z = 584.3 for [M+H]+

[0001050] Step 7: [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[[3-(2- methoxyethylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]meth ylene]amino] acetate

[0001051] To a magnetically stirred solution of 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l- (6-methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]-N-(2-metho xyethyl)benzamide (288 mg, 0.493 mmol, 1.0 eq.) in acetic acid (3 mL) was added acetic anhydride (0.1 mL, 1.48 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in DCM to afford product (148 mg, 0.218 mmol, 44% yield) as a colourless glass. 1H NMR (400 MHz, DMSO-d6) 5 8.96 (s, 1H), 8.63 (t, J = 5.4 Hz, 1H), 7.93 (t, J = 1.8 Hz, 1H), 7.84 - 7.79 (m, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.61 (d, J = 2.6 Hz, 1H), 7.55 (dt, J = 8.1, 1.3 Hz, 1H), 7.49 (s, 1H), 7.39 (d, J = 7.8 Hz, 1H), 7.30 (t, J = 7.8 Hz, 1H), 7.22 (d, J = 7.7 Hz, 1H), 7.10 - 7.02 (m, 2H), 6.69 (s, 2H), 4.94 (s, 1H), 3.82 (s, 3H), 3.51 - 3.42 (m, 4H), 3.29 (s, 4H), 2.96 (dd, J = 13.9, 10.0 Hz, 1H), 2.16 (s, 3H). UPLC-MS (basic 2 mm): Rt = 0.96 min; m/z = 626.4 for [M+H]+

[0001052] Step 8: N-(2-methoxyethyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methox y-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide

[0001053] To a magnetically stirred solution of [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2- yl)-2-[[3-(2-methoxyethylcarbamoyl)phenyl]sulfonylamino]ethy l]phenyl]methylene]amino] acetate (148 mg, 0.218 mmol, 1.0 eq.) in acetic acid (3.0 mL) was added zinc (285 mg, 4.35 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 18 h. Further zinc (285 mg, 4.35 mmol, 20.0 eq.) was added and the reaction mixture was stirred for a further 26 h at RT. The reaction mixture was filtered over Celite, washing with copious acetonitrile and DCM, and concentrated to dryness. The residue was purified by SFC (Lux C4, 21.2mm x 250mm, 5um) eluting with 50:50 MeOH:CO ₂ (0.2% v/v NH ₃ ) to afford product (41.0 mg, 0.0653 mmol, 30% yield) as a yellow solid. UPLC-MS (basic 6 min): Rt = 1.96 min; m/z = 568.3 for [M+H]+

[0001054] Step 9: N-(2-methoxyethyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methox y-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide

[0001055] N-(2-methoxyethyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methox y-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide (41.0 mg, 0.0653 mmol, 1.0 eq.) was suspended in 4 N HC1 in 1,4-dioxane (1.0 mL, 4.00 mmol, 61.2 eq.) and stirred at RT for 2.5 h. The reaction mixture was then concentrated to dryness. The residue was re-suspended in 4 N HC1 in 1,4- dioxane (1.0 mL, 4.00 mmol, 61.2 eq.) and stirred at RT for 30 min. The reaction mixture was diluted with water (ca. 2 mL), concentrated to dryness and dried in a vacuum oven to afford the product (33.0 mg, 0.0500 mmol, 77% yield) as an off-white solid. 1H NMR (400 MHz, DMSO- d6) 5 9.14 (s, 2H), 8.96 (d, J = 8.2 Hz, 1H), 8.91 (s, 2H), 8.64 (s, 1H), 7.94 (s, 1H), 7.85 (d, J = 7.8 Hz, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.68 (s, 1H), 7.63 (d, J = 2.6 Hz, 1H), 7.56 (d, J = 7.9 Hz, 1H), 7.48 (d, J = 7.9 Hz, 1H), 7.44 (d, J = 7.7 Hz, 1H), 7.32 (t, J = 7.8 Hz, 1H), 7.20 (t, J = 7.7 Hz, 1H), 7.09 (d, J = 6.7 Hz, 1H), 5.04 (s, 1H), 3.83 (s, 3H), 3.30 (s, 3H), 3.06 - 2.96 (m, 1H). UPLC-MS (acidic 6 min): Rt = 1.96 min; m/z = 568.3 for [M+H] ⁺ , 86% purity

Example 50: Exemplary synthesis of Compound 223

[0001056] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001057] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 3.0 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The organics were then extracted with DCM (3 x 100 mL), washed with saturated Na ₂ CO ₃ solution (50 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford product (4.30 g, 10.5 mmol, 51% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[0001058] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[0001059] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (50.0 mL, 200.0 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product (3.97 g, 11.5 mmol, assumed quantitative yield), as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 310.0 for [M+H] ⁺

[0001060] Step 3: Methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[0001061] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (1.00 g, 2.89 mmol, 1.0 eq.) in DMF (10.0 mL) was added triethylamine (1.21 mL, 8.67 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C. Methyl- 3 -chlorosulfonylbenzoate (0.81 g, 3.47 mmol, 1.2 eq.) was added portion wise at 0°C over 10 min and the reaction mixture was allowed to warm to RT for 4 h. The reaction was quenched via the addition of water (50 mL) and extracted with ethyl acetate (100 mL followed by 50 mL). The combined organics were then washed with brine (2 x 100 mL) and concentrated to dryness. The residue was suspended in DCM (10 mL) and filtered, washing with further DCM (5 mL) afford product (0.980 g, 1.93 mmol, 67% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.09 (s, 1H), 7.94 - 7.84 (m, 2H), 7.74 (dd, J = 17.0, 8.3 Hz, 2H), 7.61 (d, J = 12.3 Hz, 2H), 7.53 - 7.38 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.88 (s, 3H), 3.83 (s, 3H), 3.35 (d, J = 14.6 Hz, 1H), 3.05 - 2.94 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.13 mm. m/z = 508.0 for [M+H] ⁺

[0001062] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[0001063] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (1.96 g, 3.85 mmol, 1.0 eq.) in THF (40.0 mL) was added a solution of lithium hydroxide (0.48 g, 11.6 mmol, 3.0 eq.) in water (12.0 mL) and the resulting mixture stirred at RT for 5 h. The reaction volume was reduced by half, diluted with water (100 mL) and then extracted with ethyl acetate (2 x 100 mL). The aqueous phase was acidified to pH 1.0 by the slow addition of 1 M HC1, extracted with ethyl acetate (2 x 100 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (1.82 g, 3.70 mmol, 96% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 13.30 (s, 1H), 9.06 (d, J = 8.5 Hz, 1H), 7.92 (d, J = 9.0 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 16.4 Hz, 2H), 7.59 (s, 1H), 7.50 (d, J = 7.9 Hz, 1H), 7.41 (q, J = 8.0 Hz, 2H), 7.23 (t, J = 7.8 Hz, 1H), 7.08 (d, J = 9.0 Hz, 1H), 5.00 (s, 1H), 3.83 (s, 3H), 3.39 - 3.34 (m, 1H), 2.99 (t, J = 12.3 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 0.84 mm. m/z = 494.0 for [M+H] ⁺

[0001064] Step 5: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001065] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.300 g, 0.608 mmol, 1.0 eq.) in DMF (3.2 mL) were added 2-methoxyethylamine (0.046 g, 0.608 mmol, 1.2 eq.), DIPEA (0.32 mL, 1.82 mmol, 3.0 eq.) and HATU (0.350 g, 0.912 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 6 h. Further 2-methoxyethylamine (0.23 mg, 0.304 mmol, 0.5 eq.) and HATU (0.173 g, 0.456 mmol, 0.75 eq.) were added and the reaction was stirred at RT for a further 18 h. The reaction mixture was diluted with ethyl acetate (100 mL), washed with brine (100 mL), saturated Na ₂ CO ₃ solution (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was dissolved in DCM, leaving behind insoluble material that was dried to afford product (0.154 g, 0.280 mmol, 46% yield) as a white solid. The dissolved material was purified by normal phase column chromatography (20 g cartridge) eluting with 40- 100% EtOAc:heptane to afford product (0.024 g, 0.0436 mmol, 7% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.99 (d, J = 8.4 Hz, 1H), 8.63 (s, 1H), 7.96 - 7.87 (m, 2H), 7.81 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 2.5 Hz, 1H), 7.61 - 7.52 (m, 2H), 7.46 (d, J = 7.9 Hz, 1H), 7.39 (t, J = 8.4 Hz, 2H), 7.17 (t, J = 7.8 Hz, 1H), 7.09 (dd, J = 8.6, 2.4 Hz, 1H), 5.09 - 4.99 (m, 1H), 3.84 (d, J = 1.8 Hz, 3H), 3.54 - 3.42 (m, 3H), 3.37 (dd, J = 13.9, 4.3 Hz, 1H), 3.04 - 2.90 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.04 mm. m/z = 551.0 for [M+H] ⁺

[0001066] Step 6: 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-b enzothiazol- 2-yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001067] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzami de (0.178 g, 0.323 mmol, 1.0 eq.) in EtOH (6.0 mL) were added hydroxylamine hydrochloride (0.045 g, 0.647 mmol, 2.0 eq.) and DIPEA (0.17 mL, 0.970 mmol, 3.0 eq.). The reaction mixture was stirred at reflux for 20 h. Further hydroxylamine hydrochloride (0.022 g, 0.323 mmol, 1.0 eq.) and DIPEA (0.084 mL, 0.485 mmol, 1.5 eq.) were added and the reaction mixture was stirred at reflux for a further 24 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.19 g, 0.324 mmol, assumed quantitative yield), as a colorless oil, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.93 min. m/z = 584.0 for [M+H] ⁺

[0001068] Step 7: [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[[3-(2- methoxyethylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]meth ylene]amino] acetate

[0001069] To a magnetically stirred solution of 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l- (6-methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]-N-(2-metho xyethyl)benzamide (0.190 g, 0.324 mmol, 1.0 eq) in acetic acid (3.0 mL) was added acetic anhydride (0.092 mL, 0.971 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 20 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 20-100% EtO Ac: isohexane to afford product (0.107 g, 0.171 mmol, 53% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.98 (d, J = 8.2 Hz, 1H), 8.65 (t, J = 5.5 Hz, 1H), 7.92 (t, J = 1.9 Hz, 1H), 7.84 - 7.71 (m, 2H), 7.62 (d, J = 2.6 Hz, 1H), 7.54 (dt, J = 7.9, 1.4 Hz, 1H), 7.49 (s, 1H), 7.39 (d, J = 7.8 Hz, 1H), 7.30 (t, J = 7.8 Hz, 1H), 7.22 (d, J = 7.7 Hz, 1H), 7.10 - 7.01 (m, 2H), 6.71 (s, 2H), 4.94 (td, J = 9.3, 5.0 Hz, 1H), 3.82 (s, 3H), 3.46 (dt, J = 19.1, 5.5 Hz, 4H), 3.33 - 3.24 (m, 5H), 2.96 (dd, J = 13.8, 10.1 Hz, 1H), 2.16 (s, 3H). UPLC- MS (basic 2 min): Rt = 0.99 min; m/z = 626.1 for [M+H] ⁺

[0001070] Step 8: 3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiazol- 2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001071] To a magnetically stirred solution [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)- 2-[[3-(2-methoxyethylcarbamoyl)phenyl]sulfonylamino]ethyl]ph enyl]methylene]amino] acetate (0.110 g, 0.171 mmol, 1.0 eq) in acetic acid (3.0 mL) was added zinc (0.220 g, 3.42 mmol, 20 eq.). The reaction mixture was stirred at RT for 20 h. Further zinc (0.220 g, 3.42 mmol, 20 eq.) was added and the reaction stirred for a further 24 h at RT. Further zinc (0.220 g, 3.42 mmol, 20 eq.) was added and the reaction mixture was stirred at RT for a further 24 h. The reaction mixture was filtered, washing with copious acetonitrile, ethanol and DCM and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 15-100% MeCN:H ₂ O eluent (0.05 % TFA) followed by a second purification by reverse phase preparative-HPLC eluting with a 30-100% MeCN:H ₂ O eluent (0.1% NH ₃ ) to afford product (0.040 g, 0.0705 mmol, 41% yield) as a white solid. UPLC-MS (basic 6 min): Rt = 2.05 min; m/z

= 568.1 for [M+H] ⁺ , 98% purity. 1H NMR (400 MHz, DMSO-d6) 5 8.60 (s, 1H), 7.96 (d, J = 1.8 Hz, 1H), 7.72 (dd, J = 8.5, 5.7 Hz, 2H), 7.59 (s, 1H), 7.53 (q, J = 2.9 Hz, 2H), 7.43 (d, J = 7.7 Hz, 1H), 7.30 - 7.20 (m, 2H), 7.12 (t, J = 7.7 Hz, 1H), 7.02 (dd, J = 8.9, 2.6 Hz, 1H), 4.77 (dd, J = 8.8, 4.8 Hz, 1H), 3.80 (s, 3H), 3.47 (dd, J = 6.3, 4.0 Hz, 2H), 3.43 (t, J = 4.7 Hz, 2H), 3.28 (s, 3H), 3.20 (dd, J = 13.4, 4.8 Hz, 1H), 2.96 (dd, J = 13.4, 8.9 Hz, 1H). Chiral analysis by Reach found 50.4% 1 ^st eluting isomer (rt 3.15 min) and 49.6% 2 ^nd eluting isomer (rt 5.14 min).

[0001072] Step 9: 3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiazol- 2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001073] 3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiazol- 2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide (34 mg, 0.0599 mmol) was submitted to Reach for chiral purification. Purification was achieved using SFC on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 MeOH:CO ₂ (0.2% v/v NH ₃ ) to afford the 1 ^st eluting enantiomer of the product (9.1 mg, 0.0160 mmol). This was then suspended in 4 N HC1 in 1,4-dioxane (1 mL, 4.00 mmol), mixed for 1 min and concentrated to dryness. This process was repeated a further two times before dissolving the residue in water, concentrating and drying in a vacuum oven to afford product (5.0 g, 0.00872 mmol, 15% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.14 (s, 2H), 8.97 (d, J = 8.2 Hz, 1H), 8.91 (s, 2H), 8.66 (d, J = 5.7 Hz, 1H), 7.94 (t, J = 1.8 Hz, 1H), 7.84 (dd, J = 7.9, 1.5 Hz, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.68 (s, 1H), 7.64 (d, J =

2.6 Hz, 1H), 7.56 (dt, J = 7.9, 1.3 Hz, 1H), 7.48 (d, J = 7.8 Hz, 1H), 7.44 (d, J = 7.7 Hz, 1H), 7.31 (t, J = 7.8 Hz, 1H), 7.19 (t, J = 7.8 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.04 (td, J = 9.2,

4.6 Hz, 1H), 3.83 (s, 3H), 3.51 - 3.42 (m, 4H), 3.37 (dd, J = 13.5, 4.6 Hz, 1H), 3.30 (s, 3H), 3.00 (dd, J = 13.8, 10.3 Hz, 1H). UPLC-MS (acidic 6 mm): Rt = 1.98 mm; m/z = 568.2 for [M+H] ⁺ , 98% purity

Example 51: Exemplary synthesis of Compound 223

[0001074] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001075] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (9.30 g, 27.6 mmol, 1.0 eq.) in toluene (162 mL) were added and T3P (16.0 mL, 27.6 mmol, 1.0 eq.), 2-amino-5-methoxy-benzenethiol (4.71 g, 30.3 mmol, 1.1 eq.) and DIPEA (14.0 mL, 82.7 mmol, 3.0 eq.). The resulting mixture was stirred at RT for 30 min then at reflux for 2 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL) and stirring for 30 min. The phases were separated, and the organics were washed with aq. saturated Na ₂ CO ₃ (200 mL), brine (200 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in heptane to afford the product (5.25 g, 12.8 mmol, 47% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H).n UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 410.0 for [M+H]+

[0001076] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[0001077] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (5.25 g, 12.8 mmol, 1.0 eq.) in DCM (50 mL) was slowly added trifluoracetic acid (50.0 mL, 653 mmol, 51.0 eq.) and the reaction mixture was stirred at RT for 1 h. The reaction mixture was concentrated to dryness and the residue was suspended in DCM (50 mL), to which a solution of K ₂ CO ₃ (12.3 g) in water (50 mL) was added over a 10 min period. The resultant mixture was stirred at RT for 30 min. The phases were separated, and the organics were extracted with DCM (3 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrated to dryness. The residue was re-dissolved in DCM (20 mL) a solution of K ₂ CO ₃ (7.8 g) in water (20 mL) was added. The resulting mixture was stirred for 2 h. The phases were separated and the organics were extracted with DCM (3 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrated to dryness to afford 3-[2-amino-2-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]benzonitrile (3.97 g, 12.1 mmol, 94% yield) as a brown oil, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 7.83 - 7.72 (m, 2H), 7.67 (d, J = 7.8 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.09 - 7.02 (m, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.2 Hz, 3H), 3.37 (dd, J = 13.6, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 309.9 for [M+H]+

[0001078] 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile (2.49 g, 7.57 mmol, 1.0 eq.) was suspended in 4 N HC1 in 1,4-dioxane (10.0 mL, 40.0 mmol, 5.3 eq.) and stirred at RT for 2 h. The reaction mixture was then triturated with diethyl ether (30 mL), filtered, and rinsed with copious diethyl ether to afford the product (2.11 g, 5.19 mmol, 69% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.01 (s, 3H), 7.93 (d, J = 9.0 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.75 (dt, J = 7.6, 1.4 Hz, 1H), 7.72 (d, J = 2.6 Hz, 1H), 7.58 (dt, J = 8.0, 1.5 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 7.15 (dd, J = 9.0, 2.6 Hz, 1H), 5.27 (s, 1H), 3.83 (s, 3H),

3.50 (dd, J = 13.9, 6.1 Hz, 1H), 3.43 - 3.30 (m, 1H). - residual Et20 and DCM present, small aliphatic impurity at 1.4 ppm. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 310.0 for [M+H]+

[0001079] Step 3: Methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[0001080] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (750 mg, 1.84 mmol, 1.0 eq.) in DMF (6 mL) was added triethylamine (0.8 mL, 5.53 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C and stirred for 10 min. Methyl-3-chlorosulfonylbenzoate (519 mg, 2.21 mmol, 1.2 eq.) was added portionwise over 10 min and the reaction mixture was allowed to warm to RT and stir for 3 h. The reaction was quenched via the addition of water (50 mL) and extracted with ethyl acetate (100 mL). The combined organics were then washed with water (3 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM and filtered to afford product (485 mg, 0.956 mmol, 52% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.10 (s, 1H), 7.92 (dt, J = 7.8, 1.4 Hz, 1H), 7.87 (t, J = 1.7 Hz, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.72 (ddd, J = 7.8, 2.0, 1.2 Hz, 1H), 7.66 - 7.57 (m, 2H),

7.50 (d, J = 7.8 Hz, 1H), 7.47 - 7.39 (m, 2H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 5.01 (s,lH), 3.88 (s, 3H), 3.83 (s, 3H), 3.40 - 3.34 (m, 1H), 3.00 (dd, J = 13.9, 10.7 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.29 mm. m/z = 508.0 for [M+H]+

[0001081] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[0001082] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (485 mg, 0.956 mmol, 1.0 eq.) in THF (10 mb) was added a solution of lithium hydroxide (120 mg, 2.87 mmol, 3.0 eq.) in water (3 mL) and the resulting mixture was stirred at RT for 4 h. The reaction volume was reduced by half, diluted with water (50 mL) and then extracted with ethyl acetate (50 mL). The aqueous phase was acidified to pH 2.0 via the slow addition of 1 M HC1 (ca. 5 mL) and left to stand for 5 min before filtering off the precipitate and allowing to air-dry to afford product (462 mg, 0.936 mmol, 98% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 13.32 (s, 1H), 9.06 (d, J = 8.5 Hz, 1H), 7.92 (ddd, J = 9.1, 1.7, 1.1 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.69 - 7.61 (m, 2H), 7.59 (t, J = 1.7 Hz, 1H), 7.51 (dt, J = 8.0, 1.5 Hz, 1H), 7.46 - 7.35 (m, 2H), 7.23 (t, J = 7.8 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 5.00 (ddd, J = 10.7, 8.5, 4.5 Hz, 1H), 3.83 (s, 3H), 3.37 (dd, J = 14.0, 4.5 Hz, 1H), 3.00 (dd, J = 13.9, 10.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 0.99 mm. m/z = 494.0 for [M+H]+

[0001083] Step 5: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001084] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.462 g, 0.936 mmol, 1.0 eq.) in DMF (6 mL) were added 2-methoxyethylamine (84.0 mg, 1.12 mmol, 1.2 eq.), DIPEA (0.5 mL, 2.81 mmol, 3.0 eq.) and HATU (537 mg, 1.40 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 18 h. The reaction mixture was diluted with ethyl acetate (30 mL), washed with aq. saturated Na ₂ CO ₃ (30 mL) and brine (2 x 30 mL). The organics were dried over anhydrous sodium sulfate and concentrated to dryness to afford product (272 mg, 0.494 mmol, 53% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.02 (d, J = 8.4 Hz, 1H), 8.68 - 8.61 (m, 1H), 7.97 - 7.87 (m, 2H), 7.81 (d, J = 8.9 Hz, 1H), 7.65 (d, J = 2.6 Hz, 1H), 7.62 - 7.57 (m, 1H), 7.56 (d, J = 1.8 Hz, 1H), 7.46 (d, J = 8.0 Hz, 1H), 7.43 - 7.35 (m, 2H), 7.17 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.06 - 4.97 (m, 1H), 3.83 (s, 3H), 3.49 (ddt, J = 11.8, 9.1, 4.1 Hz, 4H), 3.41 - 3.34 (m, 1H), 3.30 (s, 3H), 3.04 - 2.91 (m, 1H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 551.3 for [M+H]+

[0001085] Step 6: 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-b enzothiazol- 2-yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide

[0001086] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzami de (272 mg, 0.494 mmol, 1.0 eq.) in EtOH (6 mb) were added hydroxylamine hydrochloride (68.7 mg, 0.988 mmol, 2.0 eq.) and DIPEA (0.3 mL, 1.48 mmol, 3.0 eq.). The reaction mixture was stirred at reflux for 1.5 h, then cooled to RT and stirred for 40.5 h before concentrating to dryness to afford product (288 mg, 0.493 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.93 min. m/z = 584.3 for [M+H]+

[0001087] Step 7: [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[[3-(2- methoxyethylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]meth ylene]amino] acetate

[0001088] To a magnetically stirred solution of 3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l- (6-methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]-N-(2-metho xyethyl)benzamide (288 mg, 0.493 mmol, 1.0 eq) in acetic acid (3 mL) was added acetic anhydride (0.1 mL, 1.48 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in DCM to afford product (148 mg, 0.218 mmol, 44% yield) as a colourless glass. 1H NMR (400 MHz, DMSO-d6) 5 8.96 (s, 1H), 8.63 (t, J = 5.4 Hz, 1H), 7.93 (t, J = 1.8 Hz, 1H), 7.84 - 7.79 (m, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.61 (d, J = 2.6 Hz, 1H), 7.55 (dt, J = 8.1, 1.3 Hz, 1H), 7.49 (s, 1H), 7.39 (d, J = 7.8 Hz, 1H), 7.30 (t, J = 7.8 Hz, 1H), 7.22 (d, J = 7.7 Hz, 1H), 7.10 - 7.02 (m, 2H), 6.69 (s, 2H), 4.94 (s, 1H), 3.82 (s, 3H), 3.51 - 3.42 (m, 4H), 3.29 (s, 4H), 2.96 (dd, J = 13.9, 10.0 Hz, 1H), 2.16 (s, 3H). UPLC-MS (basic 2 mm): Rt = 0.96 min; m/z = 626.4 for [M+H]+

[0001089] Step 8: N-(2-methoxyethyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methox y-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide

[0001090] To a magnetically stirred solution of [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2- yl)-2-[[3-(2-methoxyethylcarbamoyl)phenyl]sulfonylamino]ethy l]phenyl]methylene]amino] acetate (148 mg, 0.218 mmol, 1.0 eq.) in acetic acid (3.0 mL) was added zinc (285 mg, 4.35 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 18 h. Further zinc (285 mg, 4.35 mmol, 20.0 eq.) was added and the reaction mixture was stirred for a further 26 h at RT. The reaction mixture was filtered over Celite, washing with copious acetonitrile and DCM, and concentrated to dryness. The residue was purified by SFC (Lux C4, 21.2mm x 250mm, 5um) eluting with 50:50 MeOH:CO ₂ (0.2% v/v NH ₃ ) to afford product (40.3 mg, 0.0710 mmol, 33% yield) as a yellow solid. UPLC-MS (basic 6 min): Rt = 1.95 min; m/z = 568.3 for [M+H]+

[0001091] Step 9: N-(2-methoxyethyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methox y-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide

[0001092] N-(2-methoxyethyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methox y-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide (40.3 mg, 0.0710 mmol, 1.0 eq.) was suspended in 4 N HC1 in 1,4-dioxane (1 mL, 4.00 mmol, 61.2 eq.) and stirred at RT for 2 h. The reaction mixture was then concentrated to dryness. The residue was re-suspended in 4 N HC1 in 1,4- dioxane (1 mL, 4.00 mmol, 61.2 eq.) and stirred at RT for 2.5 h. The reaction mixture was diluted with water (ca. 2 mL), concentrated to dryness and dried in a vacuum oven to afford the product (33.0 mg, 0.0558 mmol, 79% yield) as an off-white solid. 1H NMR (400 MHz, DMSO- d6) 5 9.15 (s, 2H), 8.99 - 8.92 (m, 3H), 8.65 (d, J = 5.7 Hz, 1H), 7.95 (t, J = 1.8 Hz, 1H), 7.85 (dt, J = 7.9, 1.4 Hz, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.69 (s, 1H), 7.63 (d, J = 2.6 Hz, 1H), 7.56 (dt, J = 8.1, 1.3 Hz, 1H), 7.46 (dd, J = 20.0, 7.7 Hz, 2H), 7.32 (t, J = 7.8 Hz, 1H), 7.19 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.04 (td, J = 9.2, 4.7 Hz, 1H), 3.83 (s, 3H), 3.47 (ddt, J = 14.8, 10.4, 5.0 Hz, 4H), 3.38 (dd, J = 13.8, 4.7 Hz, 1H), 3.30 (s, 3H), 3.01 (dd, J = 13.8, 10.2 Hz, 1H). UPLC-MS (acidic 6 min): Rt = 1.95 min; m/z = 568.3 for [M+H]+, 96% purity

Example 52: Exemplary synthesis of Compound 230

[0001093] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e)

[0001094] To a magnetically stirred solution of 2-{[(tert-butoxy)carbonyl]amino}-3-(3- cyanophenyl)propanoic acid (13.9 g, 47.9 mmol, 1.0 eq.) in toluene (280 mL) were added DIPEA (13.0 mL, 71.8 mmol, 1.5 eq.), 2-aminothiophenol (5.6 mL, 52.7 mmol, 1.1 eq.) and T3P (50% w/w in EtOAc) (17.0 mL, 57.5 mmol, 1.2 eq.). The reaction mixture was allowed to stir RT for 20 mins and then stirred under reflux for 3 h. The reaction mixture was cooled to RT and then diluted with aq. saturated Na ₂ CO ₃ (150 mL), extracted with EtOAc (3 x 200 mL). The mixture was washed with brine (200 mL) and the organic layer dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was purified via normal phase chromatography on a 220 g cartridge eluting with 5-50% EtOAc: isohexane. The residue was then repurified via column chromatography on a 120 g cartridge eluting with 0-15% EtOAc:DCM to afford product (4.90 g, 12.9 mmol, 27% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.13 - 8.06 (m, 1H), 8.00 - 7.95 (m, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.81

(t, J = 1.7 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.56 - 7.49 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.16 (ddd, J = 10.9, 8.7, 4.2 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 min) Rt = 1.25 min. m/z = 380.1 for [M+H] ⁺

[0001095] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile hydrochloride

[0001096] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl) ethylcarbamate (14.6 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10.0 mb) was added 4 N HC1 in 1,4-dioxane (150 mL, 600 mmol, 15.6 eq.) and the resulting mixture was stirred at RT for 4 h. The reaction was then concentrated to dryness to afford product (14.0 g, 39.5 mmol, assumed quantitative yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 3 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 280.0 for [M+H] ⁺

[0001097] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro benzene-l- sulfonamide

[0001098] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride(5.00 g, 14.1 mmol, 1.0 eq.) in DMF (50.0 mL) was added triethylamine (6.9 mL, 49.3 mmol, 3.5 eq.) and the reaction mixture was cooled to 0°C. 3- nitrobenzene-1 -sulfonyl chloride (3.75 g, 16.9 mmol, 1.2 eq.) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 4 h. The reaction mixture was diluted with ethyl acetate (250 mL), washed with brine (250 mL), saturated Na ₂ CO ₃ solution (250 mL) and brine (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated to dryness. The residue was then triturated with DCM (25 mL) and filtered under vacuum to afford product (4.42 g, 9.31 mmol, 66% yield) as an off-white solid.1H NMR (400 MHz, DMSO-d6) 5 9.35 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.88 (dddd, J = 7.8, 4.5, 1.6, 0.8 Hz, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.59 (t, J = 8.0 Hz, 1H), 7.55 (dt, J = 7.9, 1.4 Hz, 1H), 7.50 (ddd, J = 8.2, 7.2, 1.4 Hz, 1H), 7.47 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz,

1H), 5.17 (d, J = 9.9 Hz, 1H), 3.41 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 465.1 for [M+H] ⁺

[0001099] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001100] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] -3 -nitrobenzene-1-sulfonamide (4.42 g, 9.31 mmol, 1.0 eq.) in ethanol (45.0 mb) and water (23.0 mL) were added iron (5.20 g, 93.1 mmol, 10.0 eq.) and ammonium chloride (2.49 g, 46.6 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 24 h. The reaction mixture was then cooled to RT and filtered through a plug of celite and washed with EtOH. The filtrate was concentrated to dryness to afford product (2.61 g, 5.53 mmol, 59% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.71 (s, 1H), 8.11 - 8.06 (m, 1H), 7.97 - 7.93 (m, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 (tt, J = 6.7, 1.2 Hz, 2H), 7.51 - 7.48 (m, 1H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.0 Hz, 1H), 6.61 - 6.56 (m, 2H), 5.40 (s, 2H), 4.90 (dd, J = 9.9, 4.9 Hz, 1H), 3.38 (d, J = 4.9 Hz, 1H), 2.99 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.07 mm. m/z = 435.1 for [M+H] ⁺

[0001101] Step 5: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carbamate

[0001102] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] benzenesulfonamide (0.750 g, 1.73 mmol, 1.0 eq.) in DMF (10.0 mL) were added N-Boc-beta-alanine (0.327 g, 1.73 mmol, 1.0 eq.), DIPEA (0.90 mL, 5.18 mmol, 3.0 eq.) and HATU (0.990 g, 2.59 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 21 h. Lurther N-Boc-beta-alanine (0.327 g, 1.73 mmol, 1.0 eq.), DIPEA (0.90 mL, 5.18 mmol, 3.0 eq.) and HATU (0.990 g, 2.59 mmol, 1.5 eq.) were added and the reaction stirred for a further 1 h. The reaction mixture was then concentrated to dryness. The residue was then purified via reverse phase column chromatography (C18, 90 g cartridge) eluting with 0-100% MeCN:H ₂ O (+0.1% NH ₃ ) to afford product (0.572 g, 0.916 mmol, 53% yield) as a yellow solid. UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 606.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.07 (s, 1H), 9.00 (d, J = 8.2 Hz, 1H), 8.11 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.96 (dt, J = 8.1, 0.9 Hz, 1H), 7.84 (t, J = 2.0 Hz, 1H), 7.56 (t, J = 1.8 Hz, 1H), 7.55 - 7.50 (m, 2H), 7.49 - 7.46 (m, 1H), 7.44 (dt, J = 7.4, 1.0 Hz, 2H), 7.22 (dt, J = 10.7, 7.9 Hz, 2H), 7.12 (ddd, J = 7.8, 1.9, 1.1 Hz, 1H), 6.92 (t, J = 5.6 Hz, 1H), 4.93 (ddd, J = 10.7, 8.1, 4.3 Hz, 1H), 3.42 - 3.37 (m, 1H), 3.25 (q, J = 6.7 Hz, 2H), 2.97 (dd, J = 13.8, 10.7 Hz, 1H), 1.39 (s, 9H).

[0001103] Step 6: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl] sulfamoyl]anilino]-3-oxo-propyl]carbamate

[0001104] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carba mate (0.572 g, 0.944 mmol, 1.0 eq.) in EtOH (6.0 mL) were added hydroxylamine hydrochloride (0.131 g, 1.89 mmol, 2.0 eq.) and DIPEA (0.49 mL, 2.83 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 5.5 h. The reaction mixture was cooled to RT and then concentrated to dryness to afford product (1.41 g, 2.21 mmol, assumed quantitative yield) as a yellow foam. This crude material was sent to Reach for purification and chiral separation. UPLC-MS (basic 6 min) Rt = 2.90 min. m/z = 639.2 for [M+H] ⁺

[0001105] Step 7: 3-amino-N-[3-[[rac-(lS)-l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]propanami de

[0001106] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2- [3 -(N'-hydroxycarbamimidoyl)pheny 1] ethyl] sulfamoyl]anilino] -3 -oxo-propyl] carbamate (0.185 g, 0.29 mmol, 1.0 eq) was suspended in 4 N HC1 in 1,4-dioxane (2.0 mL, 8 mmol, 27.6 eq.) and stirred at RTfor 1.5 h. The reaction mixture was then concentrated to dryness and submitted for purification via reverse phase preparative HPLC (C18) eluting with 40-100% methanol: water (+0.1% NH ₃ ). The residue was re-dissolved in water and dried to afford product (0.016 g, 0.0297 mmol, 10% yield) as a white solid.1H NMR (400 MHz, DMSO-d6) 5 10.07 (s, 1H), 9.78 - 9.55 (m, 1H), 8.05 - 8.00 (m, 1H), 7.93 - 7.84 (m, 2H), 7.56 - 7.44 (m, 3H), 7.44 - 7.35 (m, 2H), 7.18 - 6.98 (m, 4H), 5.73 (s, 2H), 4.90 (dd, J = 9.2, 5.7 Hz, 1H), 3.24 (dd, J = 13.6,

5.7 Hz, 1H), 2.97 (dd, J = 13.8, 9.1 Hz, 1H), 2.84 (t, J = 6.5 Hz, 2H), 2.39 (t, J = 6.5 Hz, 2H).

UPLC-MS (acidic 2 min): Rt = 1.61 min; m/z = 539.1 for [M+H] ⁺ , 98% purity.

Example 53: Exemplary synthesis of Compound 230

[0001107] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e)

[0001108] To a magnetically stirred solution of 2-{[(tert-butoxy)carbonyl]amino}-3-(3- cyanophenyl)propanoic acid (13.9 g, 47.9 mmol, 1.0 eq.) in toluene (280 mL) were added DIPEA (13.0 mL, 71.8 mmol, 1.5 eq.), 2-aminothiophenol (5.6 mL, 52.7 mmol, 1.1 eq.) and T3P (50% w/w in EtOAc) (17.0 mL, 57.5 mmol, 1.2 eq.). The reaction mixture was allowed to stir RT for 20 mins and then stirred under reflux for 3 h. The reaction mixture was cooled to RT and then diluted with aq. saturated Na ₂ CO ₃ (150 mL), extracted with EtOAc (3 x 200 mL). The mixture was washed with brine (200 mL) and the organic layer dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was purified via normal phase chromatography on a 220 g cartridge eluting with 5-50% EtO Ac: isohexane. The residue was then repurified via column chromatography on a 120 g cartridge eluting with 0-15% EtOAc:DCM to afford product (4.90 g, 12.9 mmol, 27% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.13 - 8.06 (m, 1H), 8.00 - 7.95 (m, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.81 (t, J = 1.7 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.56 - 7.49 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.16 (ddd, J = 10.9, 8.7, 4.2 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.25 mm. m/z = 380.1 for [M+H] ⁺

[0001109] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile hydrochloride

[0001110] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl) ethylcarbamate (14.6 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10.0 mL) was added 4 N HC1 in 1,4-dioxane (150 mL, 600 mmol, 15.6 eq.) and the resulting mixture was stirred at RT for 4 h. The reaction was then concentrated to dryness to afford product (14.0 g, 39.5 mmol, assumed quantitative yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 3 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 280.0 for [M+H] ⁺

[0001111] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro benzene-l- sulfonamide

[0001112] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride(5.00 g, 14.1 mmol, 1.0 eq.) in DMF (50.0 mL) was added triethylamine (6.9 mL, 49.3 mmol, 3.5 eq.) and the reaction mixture was cooled to 0°C. 3- nitrobenzene-1 -sulfonyl chloride (3.75 g, 16.9 mmol, 1.2 eq.) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 4 h. The reaction mixture was diluted with ethyl acetate (250 mL), washed with brine (250 mL), aq. saturated Na ₂ CO ₃ solution (250 mL) and brine (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated to dryness. The residue was then triturated with DCM (25 mL) and filtered under vacuum to afford product (4.42 g, 9.31 mmol, 66% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.35 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.88 (dddd, J = 7.8, 4.5, 1.6, 0.8 Hz, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.59 (t, J = 8.0 Hz, 1H), 7.55 (dt, J = 7.9, 1.4 Hz, 1H), 7.50 (ddd, J = 8.2, 7.2, 1.4 Hz, 1H), 7.47 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.17 (d, J = 9.9 Hz, 1H), 3.41 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 465.1 for [M+H] ⁺

[0001113] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001114] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] -3 -nitrobenzene-1-sulfonamide (4.42 g, 9.31 mmol, 1.0 eq.) in ethanol (45.0 mb) and water (23.0 mL) were added iron (5.20 g, 93.1 mmol, 10.0 eq.) and ammonium chloride (2.49 g, 46.6 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 24 h. The reaction mixture was then cooled to RT and filtered through a plug of celite and washed with EtOH. The filtrate was concentrated to dryness to afford product (2.61 g, 5.53 mmol, 59% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.71 (s, 1H), 8.11 - 8.06 (m, 1H), 7.97 - 7.93 (m, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 (tt, J = 6.7, 1.2 Hz, 2H), 7.51 - 7.48 (m, 1H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.0 Hz, 1H), 6.61 - 6.56 (m, 2H), 5.40 (s, 2H), 4.90 (dd, J = 9.9, 4.9 Hz, 1H), 3.38 (d, J = 4.9 Hz, 1H), 2.99 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.07 mm. m/z = 435.1 for [M+H] ⁺

[0001115] Step 5: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carbamate

[0001116] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] benzenesulfonamide (0.750 g, 1.73 mmol, 1.0 eq.) in DMF (10.0 mL) were added N-Boc-beta-alanine (0.327 g, 1.73 mmol, 1.0 eq.), DIPEA (0.90 mL, 5.18 mmol, 3.0 eq.) and HATU (0.990 g, 2.59 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 21 h. Lurther N-Boc-beta-alanine (0.327 g, 1.73 mmol, 1.0 eq.), DIPEA (0.90 mL, 5.18 mmol, 3.0 eq.) and HATU (0.990 g, 2.59 mmol, 1.5 eq.) were added and the reaction stirred for a further 1 h. The reaction mixture was then concentrated to dryness. The residue was then purified via reverse phase column chromatography (C18, 90 g cartridge) eluting with 0-100% MeCN:H ₂ O (+0.1% NH ₃ ) to afford product (0.572 g, 0.916 mmol, 53% yield) as a yellow solid. UPLC-MS (basic 2 mm) Rt = 1.14 mm. m/z = 606.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.07 (s, 1H), 9.00 (d, J = 8.2 Hz, 1H), 8.11 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.96 (dt, J = 8.1, 0.9 Hz, 1H), 7.84 (t, J = 2.0 Hz, 1H), 7.56 (t, J = 1.8 Hz, 1H), 7.55 - 7.50 (m, 2H), 7.49 - 7.46 (m, 1H), 7.44 (dt, J = 7.4, 1.0 Hz, 2H), 7.22 (dt, J = 10.7, 7.9 Hz, 2H), 7.12 (ddd, J = 7.8, 1.9, 1.1 Hz, 1H), 6.92 (t, J = 5.6 Hz, 1H), 4.93 (ddd, J = 10.7, 8.1, 4.3 Hz, 1H), 3.42 - 3.37 (m, 1H), 3.25 (q, J = 6.7 Hz, 2H), 2.97 (dd, J = 13.8, 10.7 Hz, 1H), 1.39 (s, 9H). One CH ₂ signal concealed under solvent peaks.

[0001117] Step 6: tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl] sulfamoyl]anilino]-3-oxo-propyl]carbamate

[0001118] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]anilino]-3-oxo-propyl]carba mate (0.572 g, 0.944 mmol, 1.0 eq.) in EtOH (6.0 mL) were added hydroxylamine hydrochloride (0.131 g, 1.89 mmol, 2.0 eq.) and DIPEA (0.49 mL, 2.83 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 5.5 h. The reaction mixture was cooled to RT and then concentrated to dryness to afford product (1.41 g, 2.21 mmol, assumed quantitative yield) as a yellow foam. This crude material was sent to Reach for purification and chiral separation. UPLC-MS (basic 6 min) Rt = 2.90 min. m/z = 639.2 for [M+H] ⁺

[0001119] Step 7: 3-amino-N-[3-[[rac-(lS)-l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]propanami de

[0001120] To a magnetically stirred solution of tert-butyl N-[3-[3-[[l-(l,3-benzothiazol-2-yl)- 2- [3 -(N'-hydroxycarbamimidoyl)pheny 1] ethyl] sulfamoyl]anilino] -3 -oxo-propyl] carbamate (0.172 g, 0.270 mmol, 1.0 eq) was suspended in 4 N HC1 in 1,4-dioxane (2.0 mL, 8 mmol, 29.6 eq.) and stirred at RT for 1.5 h. The reaction mixture was then concentrated to dryness and submitted for purification via reverse phase preparative HPLC (C18) eluting with 40-100% methanol: water (+0.1% NH ₃ ). The residue was re-dissolved in water and dried to afford product (0.093 g, 0.169 mmol, 63% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.03 (dt, J = 8.0, 0.9 Hz, 1H), 7.92 - 7.85 (m, 2H), 7.57 - 7.45 (m, 3H), 7.43 - 7.35 (m, 2H), 7.18 - 7.00 (m, 4H), 5.71 (s, 2H), 4.90 (dd, J = 9.1, 5.8 Hz, 1H), 3.25 (dd, J = 13.8, 5.7 Hz, 1H), 2.98 (dd, J = 13.8, 9.1 Hz, 1H), 2.84 (t, J = 6.5 Hz, 2H), 2.39 (t, J = 6.5 Hz, 2H). Exchangeables not visible except for the NH2 at 5.71 ppm). UPLC-MS (acidic 2 min): Rt = 1.59 min; m/z = 539.1 for [M+H] ⁺ , 98% purity.

Example 54: Exemplary synthesis of Compound 232

[0001121] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001122] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (17.8 g, 61.3 mmol, 1.0 eq.) in toluene (250.0 mL) were added DIPEA (35.0 mL, 201 mmol, 3.3 eq.), 2-amino-5-methoxy-benzenethiol (10.77 g, 69.4 mmol, 1.1 eq.) and T3P (80.0 mL, 134 mmol, 2.2 eq.). The resulting mixture was stirred at reflux for 18 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (200 mL). The organics were then extracted with EtOAc (3 x 250 mL), washed with brine (250 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 220 g cartridge eluting with 0-100% ethyl acetate in isohexane to afford product as a beige solid (7.56 g, 18.4 mmol, 30% yield). Lurther purification of other mixed fractions via normal phase chromatography on a 40 g cartridge eluting with 0-100% EtOAc in isohexane afforded product (1.72 g, 4.20 mmol, 7% yield) as an orange solid. 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.7, 5.1 Hz, 3H), 7.52 (t, J = 7.8 Hz, 1H), 7.10 (dd, J = 9.0, 2.4 Hz, 1H), 5.16 - 5.05 (m, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.7, 4.3 Hz, 1H), 3.11 (t, J = 12.4 Hz, 1H), 1.30 (s, 9H).UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[0001123] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[0001124] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (7.56 g, 18.4 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (145 mL, 580 mmol, 31.4 eq.) was stirred at RT for 3 h. The reaction mixture was diluted with excess diethyl ether and the precipitate that formed was collected by filtration, washing with copious diethyl ether, and dried in a vacuum oven to afford the product as a grey solid (7.00 g, 20.2 mmol, assumed quantitative yield) which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.25 (d, J = 5.7 Hz, 3H), 7.89 (d, J = 8.9 Hz,

1H), 7.79 (s, 1H), 7.73 - 7.66 (m, 2H), 7.56 (d, J = 7.8 Hz, 1H), 7.46 (t, J = 7.7 Hz, 1H), 7.12 (dd, J = 8.9, 2.5 Hz, 1H), 5.20 (s, 1H), 3.81 (s, 3H), 3.61 (dd, J = 13.7, 5.5 Hz, 1H), 3.38 (dd, J = 13.7, 8.9 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.02 min. m/z = 310.0 for [M+H] ⁺

[0001125] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-4-nitro- benzenesulfonamide

[0001126] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (0.950 g, 2.75 mmol, 1.0 eq.) in DMF (12.0 mL) was added triethylamine (1.1 mL, 8.24 mmol, 3.0 eq.) and the reaction mixture was cooled to 0°C. 4- Nitrobenzene-1 -sulfonyl chloride (0.730 g, 3.30 mmol, 1.2 eq.) was added portion wise at 0°C over 10 min and the reaction mixture was allowed to warm to RT for 18 h. Further 4- Nitrobenzene-1 -sulfonyl chloride (0.730 g, 3.30 mmol, 1.2 eq.) and triethylamine (0.57 mL, 4.12 mmol, 1.5 eq.) was added and the reaction was stirred at RT for a further 18 h. The reaction was diluted with ethyl acetate (60 mL), washed with brine (60 mL), aq. saturated Na ₂ CO ₃ solution (60 mL) and brine (60 mL), dried over anhydrous sodium sulfate and concentrated to dryness. Purification was then performed via reverse phase chromatography on a 45 g C18 cartridge eluting with 5-95% MeCN:H ₂ O (+0.1% NH ₃ ) to afford product (0.340 g, 0.688 mmol, 25% yield) as an orange solid. 1H NMR (400 MHz, DMSO-d6) 5 8.04 (d, J = 8.5 Hz, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.69 - 7.62 (m, 3H), 7.59 (s, 1H), 7.55 (d, J = 7.9 Hz, 1H), 7.47 (d, J = 7.7 Hz, 1H), 7.30 (t, J = 7.7 Hz, 1H), 7.07 (dd, J = 8.9, 2.4 Hz, 1H), 5.06 (dd, J = 10.8, 4.4 Hz, 1H), 3.82 (d, J = 1.6 Hz, 3H), 3.58 (s, 1H), 3.39 (dd, J = 14.1, 4.5 Hz, 1H), 3.03 (dd, J = 13.9, 10.7 Hz, 1H).

UPLC-MS (basic 2 min) Rt = 1.11 min. m/z = 495.1 for [M+H] ⁺

[0001127] Step 4: 4-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[0001128] To a stirred suspension of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]-4-nitro-benzenesulfonamide (0.340 g, 0.688 mmol, 1.0 eq.) in ethanol (6.0 mL) and water (4.0 mL) was added ammonium chloride (0.290 g, 5.50 mmol, 8.0 eq.) and iron (0.610 g, 11.0 mmol, 16.0 eq.) and the resulting mixture was stirred at 85 °C, under a balloon of nitrogen, for 5 h. The reaction was then cooled to RT and filtered over Celite, washing with copious ethanol. The filtrate was concentrated to dryness and the residue re-dissolved in DCM (30 mL) and washed with aq. saturated Na ₂ CO ₃ solution (20 mL). After separation of the phases, the aqueous was extracted with DCM (3 x 25 mL) and the combined organics were dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (0.250 g, 0.547 mmol, 80%) as a orange solid. 1H NMR (400 MHz, DMSO-d6) 5 8.41 (d, J = 8.0 Hz, 1H), 7.81 (d, J = 8.8 Hz, 1H), 7.68 - 7.58 (m, 2H), 7.56 (d, J = 7.7 Hz, 1H), 7.46 (d, J = 7.9 Hz, 1H), 7.30 (t, J = 7.7 Hz, 1H), 7.13 (d, J = 8.3 Hz, 2H), 7.08 (dd, J = 8.9, 2.5 Hz, 1H), 6.40 (d, J = 8.4 Hz, 2H), 5.75 (s, OH), 4.80 (t, J = 7.7 Hz, 1H), 3.83 (s, 3H), 3.00 - 2.89 (m, 2H). UPLC-MS (basic 2 min) Rt = 1.06 min. m/z = 465.1 for [M+H] ⁺

[0001129] Step 5: tert-butyl N-[2-[4-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate

[0001130] To a magnetically stirred solution of 4-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]benzenesulfonamide (0.241 g, 0.519 mmol, 1.0 eq.) was added N- alpha-t-BOC-glycine (0.109 g, 0.623 mmol, 1.2 eq.), DIPEA (0.27 mL, 1.56 mmol, 3.0 eq.) and HATU (0.296 g, 0.778 mmol, 1.5 eq.) before stirring at RT for 18 h. The reaction was redosed with N-alpha-t-BOC-glycine (0.055 g, 0.311 mmol, 0.6 eq.), DIPEA (0.09 mL, 0.519 mmol, 1.0 eq.) and HATU (0.148 g, 0.389 mmol, 0.75 eq.) and stirred at RT for a further 24 h. TCFH (0.218 g, 0.778 mmol, 1.5 eq.) and NMI (0.12 mL, 1.56 mmol, 3.0 eq.) were added and the reaction was stirred at RT. The reaction mixture was concentrated to dryness before diluting with ethyl acetate (10 mL), washed with brine (10 mL), aq. saturated Na ₂ CO ₃ solution (10 mL) and brine (10 mL), dried over anhydrous sodium sulfate, filtered and concentrated to dryness. The residue was purified via normal phase chromatography on a 4 g cartridge eluting with 0-100% EtOAc in isohexane to afford product (0.130 g, 0.209 mmol, 40% yield) as a beige foam. 1H NMR analysis (sample reference: 151842-4) (400 MHz, DMSO-d6) 5 10.20 (s, 1H), 7.81 (d, J = 8.9 Hz, 1H), 7.69 - 7.54 (m, 2H), 7.47 (d, J = 9.3 Hz, 3H), 7.36 (d, J = 8.5 Hz, 2H), 7.23 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 14.5, 7.3 Hz, 2H), 3.83 (s, 3H), 3.75 (d, J = 6.0 Hz, 1H), 3.00 - 2.88

(m, 2H), 2.38 - 2.22 (m, 2H), 1.39 (d, J = 16.4 Hz, 9H). - 2 protons missing in aromatic region. UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 622.1 for [M+H] ⁺

[0001131] Step 6: N-[2-[4-[[2-[3-[(E)-N'-hydroxycarbamimidoyl]phenyl]-l-(6-met hoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carba mate

[0001132] To a magnetically stirred solution of tert-butyl N-[2-[4-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo -ethyl]carbamate (0.130 g, 0.209 mmol, 1.0 eq.) in EtOH (3.0 mL) were added hydroxylamine hydrochloride (0.029 g, 0.418 mmol, 2.0 eq.) and DIPEA (0.11 mL, 0.627 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 6 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.200 g, 0.304 mmol, assumed quantitative yield) as a brown oil which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 655.2 for [M+H] ⁺

[0001133] Step 7: tert-butyl N-[2-[4-[[2-[3-[(E)-N'-hydroxycarbamimidoyl]phenyl]-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo -ethyl]carbamate

[0001134] To a magnetically stirred solution of tert-butyl N-[2-[4-[[2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-2- oxo-ethyl] carbamate (0.195 g, 0.298 mmol, 1.0 eq) in acetic acid (4.0 mL) was added acetic anhydride (0.084 mL, 0.893 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 18 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-100% ethyl acetate in isohexane to afford product (0.195 g, 0.298 mmol, 24% yield) as a yellow oil. 1H NMR analysis (sample reference: 152346-2) (400 MHz, DMSO-d6) 5 10.10 (s, 1H), 8.71 (s, 1H), 7.77 (d, J = 9.0 Hz, 1H), 7.60 (d, J = 2.6 Hz, 1H), 7.56 (s, 1H), 7.41 (q, J = 8.9 Hz, 5H), 7.18 (d, J = 7.7 Hz, 1H), 7.13 - 7.03 (m, 3H), 6.70 (s, 2H), 4.86 (s, 1H), 3.82 (s, 3H), 3.74 (d, J = 6.1 Hz, 2H), 2.33 (p, J = 1.9 Hz, 2H), 2.15 (s, 3H), 1.40 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.10 mm; m/z = 697.2 for [M+H] ⁺

[0001135] Step 8: tert-butyl N-[2-[4-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carba mate;2,2,2-trifluoroacetic acid

[0001136] To a magnetically stirred solution of [(E)-[amino-[3-[2-[[4-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.050 g, 0.0718 mmol, 1.0 eq) in acetic acid (2.0 mL) was added zinc (0.094 g, 1.44 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 7 h. Further zinc (0.047 g, 0.718 mmol, 10.0 eq.) was added and the reaction stirred for a further 24 h at RT. The reaction mixture was filtered and the filtrate was concentrated to dryness. The residue was purified by reverse phase preparative-HPLC eluting with a 20-100% MeOH:H ₂ O eluent (0.05% TFA) to afford product (0.036 g, 0.0478 mmol, 67% yield) as a white solid and as a mixture of boc-protected and boc-deprotected material. UPLC- MS (acidic 6 min): Rt = 1.85 min; m/z = 539.0 for [M-boc+H] ⁺ , 77% purity; Rt = 2.63, ESI(+) = 639.2 for [M+H] ⁺ , 19%

[0001137] Step 9: 2-amino-N-[4-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethyl]sulfamoyl]phenyl]acetamide

[0001138] To a suspension tert-butyl N-[2-[4-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carba mate;2,2,2-trifluoroacetic acid (0.022 g, 0.0292 mmol, 1.0 eq.) in 1,4-dioxane (1.0 mL) was added 4 N HC1 in 1,4-dioxane (1.0 mL, 4.00 mmol, 137 eq.) and the resulting suspension stirred at RT for 1 h. The reaction mixture was then concentrated to dryness. This process was repeated 3 more times before redissolving in acetonitrile/water and concentrating again before drying in a vacuum oven. The residue was re- purified by reverse phase preparative-HPLC eluting with a 5-100% MeCN:H ₂ O eluent (0.05% TFA). The residue was then suspended in 4 N HC1 in 1,4-dioxane (1.0 mL, 4.00 mmol, 137 eq.) and the resulting suspension stirred at RT for 1 h. The reaction mixture was then concentrated to dryness. This process was repeated 3 more times before redissolving in acetonitrile/water and concentrating again before drying in a vacuum oven to afford product (3.0 mg, 0.0056 mmol, 19% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.79 (s, 1H), 7.78 (d, J = 8.8 Hz,

1H), 7.72 (s, 1H), 7.63 (s, 1H), 7.59 (d, 1H), 7.46 (d, J = 8.8 Hz, 5H), 7.28 (t, 1H), 7.09 (dd, J = 8.9, 2.7 Hz, 1H), 6.83 (s, 1H), 4.98 (s, 1H), 3.83 (s, 4H), 3.67 (s, 2H), 3.08 - 3.00 (m, 2H).

UPLC-MS (acidic 6 min): Rt = 1.34 min; m/z = 539.2 for [M+H]+, 99% purity

Example 55: Exemplary synthesis of Compound 103

[0001139] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001140] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (10.0 g, 34.4 mmol, 1.0 eq.) in toluene (200.0 mL) were added DIPEA (9.0 mL, 51.7 mmol, 1.5 eq.), 2-amino-5-methoxy-benzenethiol (5.88 g, 37.9 mmol, 1.1 eq.) and T3P (25.0 mL, 41.3 mmol, 1.2 eq.). The resulting mixture was stirred at reflux for 2.5 h followed by 17 h at RT. The reaction was concentrated to dryness and the residue was diluted with ethyl acetate (200 mL), washed with brine (200 mL), saturated Na ₂ CO ₃ solution (2 x 100 mL), brine (100 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 50 g high-capacity cartridge eluting with 0-100% ethyl acetate in hexane to afford product (3.35 g, 8.19 mmol, 24% yield) as a green solid. 1H NMR (400 MHz, DMSO-d6) 5 7.86 (d, J = 8.9 Hz, 2H), 7.80 (s, 1H), 7.73 - 7.68 (m, 2H), 7.66 (d, J = 2.6 Hz, 1H), 7.53 (t, J = 7.7 Hz, 1H), 7.11 (dd, J = 8.9, 2.6 Hz, 1H), 5.17 - 5.05 (m, 1H), 3.84 (s, 3H), 3.53 (dd, J = 13.8, 4.4 Hz, 1H), 3.12 (dd, J = 13.8, 11.0 Hz, 1H), 1.31 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.2 for [M+H] ⁺

[0001141] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[0001142] A magnetically stirred mixture of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (3.35 g, 8.19 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (40.0 mL, 160.0 mmol, 19.5 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated to dryness to afford product (2.76 g, 6.07 mmol, 74% yield), as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.13 (d, J = 4.9 Hz, 3H), 7.92 (d, J = 9.0 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.75 - 7.71 (m, 2H), 7.58 (dt, J = 7.9, 1.5 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.15 (dd, J = 9.0, 2.6 Hz, 1H), 5.29 - 5.20 (m, 1H), 3.83 (s, 3H), 3.54 (d, J = 5.9 Hz, 1H), 3.37 (dd, J = 13.8, 8.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 310.1 for [M+H] ⁺

[0001143] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-nitro- benzenesulfonamide

[0001144] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (2.76 g, 7.98 mmol, 1.0 eq.) in DMF (30.0 mL) was added triethylamine (3.9 mL, 27.9 mmol, 3.5 eq.) and the reaction mixture was cooled to 0°C. 3- nitrobenzene-1 -sulfonyl chloride (2.12 g, 9.58 mmol, 1.2 eq.) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 1 h. The reaction mixture was diluted with EtOAc (150 mL), washed with brine (150 mL), aq. saturated Na ₂ CO ₃ solution (150 mL) and brine (150 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was then triturated with DCM (15 mL) and filtered under vacuum to afford product (2.15 g, 4.35 mmol, 54% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 9.29 (s, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.09 (t, J = 2.0 Hz, 1H), 7.87 (ddd, J = 7.8, 1.8, 1.0 Hz, 1H), 7.75 (d, J = 8.9 Hz, 1H), 7.62 (t, J = 2.0 Hz, 2H), 7.59 (t, J = 8.0 Hz, 1H), 7.54 (dt, J = 7.8, 1.5 Hz, 1H), 7.44 (dt, J = 7.8, 1.4 Hz, 1H), 7.25 (t, J = 7.7 Hz, 1H), 7.07 (dd, J = 8.9, 2.6 Hz, 1H), 5.11 (dd, J = 10.7, 4.6 Hz, 1H), 3.82 (s, 3H), 3.38 (dd, J = 13.9, 4.6 Hz, 1H), 3.03 (dd, J = 13.9, 10.7 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 mm. m/z = 495.0 for [M+H] ⁺

[0001145] Step 4: 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[0001146] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-nitro-benzenesulfonamide (2.15 g, 4.35 mmol, 1.0 eq.) in ethanol (22.0 mL) and water (11.0 mL) were added iron (2.43 g, 43.5 mmol, 10.0 eq.) and ammonium chloride (1.16 g, 21.7 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 3.5 h. The reaction mixture was then cooled to RT and filtered through a plug of celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness and the residue taken up in DCM (50 mL). The organic layer was washed with aq. saturated Na ₂ CO ₃ solution (50 mL) and the aqueous was re-extracted with DCM (2 x 50 mL). The combined organics were then washed with brine (50 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford product (1.71 g, 3.68 mmol, 85% yield), as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.65 (d, J = 6.6 Hz, 1H), 7.82 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.58 - 7.51 (m, 2H), 7.47 (d, J = 7.8 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.1 Hz, 1H), 6.59 (dt, J = 7.8, 2.2 Hz, 2H), 5.40 (s, 2H), 4.83 (s, 1H), 3.83 (s, 3H), 3.35 (d, J = 5.2 Hz, 1H), 2.96 (dd, J = 13.8, 9.7 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.07 min. m/z = 465.1 for [M+H] ⁺

[0001147] Step 5: tert-butyl N-[2-[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate

[0001148] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]benzenesulfonamide (1.71 g, 3.68 mmol, 1.0 eq.) in DMF (17.0 mL) were added N-alpha-t-BOC-glycine (0.770 g, 4.42 mmol, 1.2 eq.), DIPEA (1.9 mL, 11.0 mmol, 3.0 eq. ) and HATU (2.10 g, 5.52 mmol, 1.5 eq. ) and the reaction mixture was stirred at RT for 3 h. The reaction mixture was diluted with EtOAc (170 mL), washed with brine (170 mL), aq. saturated Na ₂ CO ₃ solution (170 mL) and brine (170 mL) before drying over anhydrous sodium sulfate and being concentrated to dryness to afford the product (2.55 g, 3.81 mmol, assumed quantitative yield) as a beige foam. 1H NMR (400 MHz, DMSO-d6) 5 10.05 (s, 1H), 8.91 (d, J = 8.4 Hz, 1H), 7.82 (d, J = 8.8 Hz, 2H), 7.65 (d, J = 2.6 Hz, 1H), 7.54 (d, J = 6.4 Hz, 2H), 7.51 - 7.41 (m, 2H), 7.28 (t, J = 7.7 Hz, 1H), 7.22 (t, J = 8.0 Hz, 1H), 7.13 (dt, J = 8.0, 1.4 Hz, 1H), 7.11 - 7.05 (m, 2H), 4.93 - 4.82 (m, 1H), 3.83 (s, 3H), 3.74 (d, J = 6.2 Hz, 2H), 3.35 (dd, J = 13.9, 4.6 Hz, 1H), 2.96 (dd, J = 13.8, 10.6 Hz, 1H), 1.42 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.14 min. m/z = 622.2 for [M+H] ⁺

[0001149] Step 6: tert-butyl N-[2-[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methoxy - 1 ,3 -benzothiazol-2-yl)ethy 1] sulfamoyl] anilino] -2-oxo-ethyl] carbamate

[0001150] To a magnetically stirred solution of tert-butyl N-[2-[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo -ethyl]carbamate (2.55 g, 3.81 mmol, 1.0 eq.) in EtOH (50.0 mL) were added hydroxylamine hydrochloride (0.530 g, 7.63 mmol, 2.0 eq.) and DIPEA (2.0 mL, 11.4 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 4 h. The reaction mixture was cooled down to RT and stirred for a further 16.5 h before being concentrated to dryness to afford product (3.73 g, 5.47 mmol, assumed quantitative yield) as a beige foam which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.04 min. m/z = 655.2 for [M+H] ⁺

[0001151] Step 7: [[amino-[3-[2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[0001152] To a magnetically stirred solution of tert-butyl N-[2-[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-2- oxo-ethyl] carbamate (3.20 g, 4.89 mmol, 1.0 eq) in acetic acid (32.0 mL) was added acetic anhydride (1.4 mL, 14.7 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 2 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (50 g cartridge) eluting with 20-100% ethyl acetate: isohexane to afford product (1.67 g, 2.28 mmol, 47% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.00 (s, 1H), 8.85 (d, J = 8.2 Hz, 1H), 7.89 (d, J = 2.0 Hz, 1H), 7.78 (d, J = 8.9 Hz, 1H), 7.60 (d, J = 2.6 Hz, 1H), 7.54 (s, 1H), 7.48 (d, J = 7.8 Hz, 1H), 7.43 (dt, J = 7.8, 1.5 Hz, 1H), 7.19 (t, J = 6.4 Hz, 1H), 7.17 - 7.04 (m, 4H), 6.68 (s, 2H), 4.87 (d, J = 7.8 Hz, 1H), 3.82 (s, 3H), 3.72 (d, J = 6.2 Hz, 2H), 3.27 (dd, J = 13.9, 5.5 Hz, 1H), 2.98 (dd, J = 13.8, 9.5 Hz, 1H), 2.15 (s, 3H), 1.41 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 697.2 for [M+H] ⁺

[0001153] Step 8: tert-butyl N-[2-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carba mate

[0001154] To a magnetically stirred solution of [[amino-[3-[2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (1.67 g, 2.28 mmol, 1.0 eq) in acetic acid (34.0 mL) was added zinc (2.98 g, 45.5 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 22.5 h. The reaction mixture was filtered over Celite, washing with copious acetonitrile, ethanol and DCM, concentrated to dryness and the residue was submitted to Reach for purification and chiral separation. Purification was performed via SFC on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 MeOH:CCh (0.2% v/v NH ₃ ) to afford product (0.580 g, 0.903 mmol, 28% yield) as a white solid. UPLC-MS (acidic 2.5 min): rt 1.19 min, m/z = 639.2 [M+H] ⁺

[0001155] Step 9: 2-amino-N-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethyl]sulfamoyl]phenyl]acetamide; dihydrochloride

[0001156] To tert-butyl N-[2-[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzoth iazol- 2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate (0.380 g, 0.592 mmol, 1.0 eq.) was added 4 N HC1 in 1,4-dioxane solution (5.0 mL, 20.0 mmol, 33.8 eq.) and the reaction mixture was stirred at RT for 1.5 h. The reaction mixture was concentrated to dryness before being resuspended in 4 N HC1 in 1,4-dioxane (5.0 mL, 20.0 mmol, 33.8 eq.) and stirred at RT for 4 h. The reaction mixture was concentrated to dryness before being triturated with diethyl ether, suspended in water and re-dried, to afford product (0.220 g, 0.401 mmol, 68% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 11.00 (d, J = 2.9 Hz, 1H), 9.30 - 9.20 (m, 4H), 8.98 (dd, J = 8.1, 3.1 Hz, 1H), 8.37 (s, 3H), 7.93 - 7.87 (m, 1H), 7.82 (dd, J = 8.9, 3.2 Hz, 1H), 7.72 (s, 1H), 7.67 (t, J = 3.1 Hz, 1H), 7.60 (d, J = 8.0 Hz, 1H), 7.53 (d, J = 8.0 Hz, 1H), 7.47 (d, J = 7.7 Hz, 1H), 7.27 (td, J = 7.8, 3.1 Hz, 1H), 7.22 - 7.06 (m, 3H), 4.93 (d, J = 10.3 Hz, 1H), 3.87 (d, J = 5.9 Hz, 2H), 3.84 - 3.81 (m, 3H), 3.37 (d, J = 13.6 Hz, 1H), 3.01 (t, J = 12.1 Hz, 1H). UPLC-MS (acidic 6 min): Rt = 1.46 min; m/z = 539.0 for [M+H] ⁺ , 99% purity

Example 56: Exemplary synthesis of Compound 233

[0001157] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001158] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120 mL) was added 2- amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.), T3P (9.1 mL, 30.7 mmol, 1.5 eq.) and DIPEA (8.9 mL, 51.2 mmol, 2.5 eq.) at RT and the mixture was stirred for 10 min, then heated to 115 °C and stirred at reflux for 3 h. The reaction was then allowed to cool to RT and 10% (w/v) aqueous citric acid was added (100 mL). The phases were separated and the organics were extracted into DCM (3 x 100 mL), washed with brine (2 x 50 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by normal phase column chromatography (120 g cartridge) eluting with a gradient of 0-60% EtOAc in heptane to afford the product (4.30 g, 10.5 mmol, 51% yield) as a brown solid. NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS analysis (basic, 2 mins): Rt. = 1.21 mm; m/z = 410.1 for [M+H] ⁺

[0001159] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile hydrochloride

[0001160] HC1 4 N in 1,4-dioxane (50 mL, 200 mmol, 19.1 eq.) was added to tert-butyl N-[2- (3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]car bamate (4.30 g, 10.5 mmol, 1.0 eq.) and the resultant suspension was magnetically stirred at RT for 3 h. The reaction mixture was then concentrated to dryness under reduced pressure to afford the product (3.97 g, 11.5 mmol, assumed quantitative yield) as a brown solid. ¹ H NMR (400 MHz, DMSO-d6) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.02 min; m/z = 310.0 for [M+H] ⁺

[0001161] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-4-nitro- benzenesulfonamide

[0001162] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (1.30 g, 3.76 mmol, 1.0 eq.) in DMF (13 mL) was added Triethylamine (1.6 mL, 11.3 mmol, 3.0 eq.) and the resultant mixture was cooled to 0 °C. 4- Nitrobenzene-1 -sulfonyl chloride (1.00 g, 4.51 mmol, 1.2 eq.) was added portionwise over 10 mins, and the reaction mixture was allowed to gradually warm to RT for 3 h. The reaction mixture was purified by reverse phase column chromatography (C18, 45 g cartridge) eluting with a gradient of 5-95% MeCN in water (0.1% NH ₃ ) to afford the product (531 mg, 1.07 mmol, 28% yield) as a yellow solid. ¹ H NMR (400 MHz, DMSO-d6) 5 9.29 (d, J = 8.6 Hz, 1H), 8.09 - 8.01 (m, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.68 - 7.65 (m, 2H), 7.64 (d, J = 2.5 Hz, 1H), 7.60 (s, 1H),

7.55 (d, J = 7.9 Hz, 1H), 7.47 (d, J = 7.8 Hz, 1H), 7.31 (t, J = 7.8 Hz, 1H), 7.07 (dd, J = 8.9, 2.6 Hz, 1H), 5.11 - 5.03 (m, 1H), 3.82 (s, 3H), 3.40 (dd, J = 13.9, 4.6 Hz, 1H), 3.03 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.13 min; m/z = 495.0 for [M+H] ⁺

[0001163] Step 4: 4-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide

[0001164] To a magnetically stirred suspension of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-4-nitro-benzenesulfonamide (0.50 g, 1.01 mmol, 1.0 eq.) in Ethanol (8 mb) and Water (4 mb) was added Ammonium chloride (0.43 g, 8.09 mmol, 8.0 eq.) and iron (0.90 g, 16.2 mmol, 16.0 eq.). The reaction was heated to 85 °C, under N2, for 96 h. The reaction mixture was then cooled and filtered over Celite, followed by washing with a copious amount of EtOH. The filtrate was concentrated to dryness and the residue was taken up in DCM (25 mb) and aq. saturated NaHCO ₃ (25 mb). The phases were separated and the organics were extracted with DCM (3 x 25 mb), washed with brine (20 mb), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to afford the product (145 mg, 0.312 mmol, 31% yield) as a beige foam. ¹ H (400 MHz, DMSO-d6) 5 8.36 (s, 1H), 7.81 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.59 (s, 1H), 7.56 (d, J = 7.5 Hz, 1H), 7.46 (d, J = 7.7 Hz, 1H), 7.31 (t, J = 7.7 Hz, 1H), 7.14 - 7.04 (m, 3H), 6.34 (d, J = 8.8 Hz, 2H), 5.84 (s, 2H), 4.77 (s, 1H), 3.83 (s, 3H), 2.96 (dd, J = 13.8, 9.8 Hz, 2H). UPEC-MS (basic 2 mm) Rt = 1.09 mm; m/z = 465.0 for [M+H] ⁺

[0001165] Step 5: tert-butyl N-[4-[4-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl] sulfamoyl] anilino] -4-oxo-butyl] carbamate

[0001166] To a solution of 4-amino-N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl]benzenesulfonamide (200 mg, 0.431 mmol, 1.0 eq.) in DMF (4 mb), under N2, was added 4-(tert- butoxy carbonylamino)butanoic acid (105 mg, 0.517 mmol, 1.2 eq.) and DIPEA (0.22 mb, 1.29 mmol, 3.0 eq.) followed by HATU (246 mg, 0.646 mmol, 1.5 eq.) and the resulting mixture was magnetically stirred at RT for 18 h. The reaction was redosed with 4-(tert- butoxycarbonylamino)butanoic acid (52 mg, 0.258 mmol, 0.6 eq.), DIPEA (0.45 mb, 2.58 mmol, 6.0 eq.) and HATU (123 mg, 0.323 mmol, 0.8 eq.) and left to stir for 18 h. The residue was diluted with EtOAc (20 mL) and washed with brine (20 mL), aq. saturated Na ₂ CO ₃ (20 mL) and brine again (20 mL). The organics were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with a gradient of 0-100% EtOAc: iso-hexane to afford the desired product (242 mg, 0.372 mmol, 86% yield) as a yellow oil. ¹ H NMR (400 MHz, DMSO-d6) 5 10.14 (s, 1H), 8.76 (s, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.5 Hz, 1H), 7.57 (s, 1H), 7.51 - 7.43 (m, 4H), 7.33 (d, J = 8.8 Hz, 2H), 7.26 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 6.88 (t, J = 6.6 Hz, 1H), 4.88 (s, 1H), 3.82 (s, 3H), 3.37 (s, 1H), 3.31 (s, 1H), 2.98 (dd, J = 6.7, 6.7 Hz, 2H), 2.34 (d, J = 8.8 Hz, 2H), 1.75 - 1.67 (m, 2H), 1.38 (s, 9H). UPLC-MS (basic 2 mm) Rt = 1.14 min; m/z = 650.2 for [M+H] ⁺

[0001167] Step 6: tert-butyl N-[4-[4-[[2-[3-[(E)-N'-hydroxycarbamimidoyl]phenyl]-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo -butyl]carbamate

[0001168] To a magnetically stirred solution of tert-butyl N-[4-[4-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo -butyl]carbamate (242 mg, 0.372 mmol, 1.0 eq.) in Ethanol (4 mL) was added Hydroxylammonium chloride (52.0 mg, 0.745 mmol, 2.0 eq.) and DIPEA (0.19 mL, 1.12 mmol, 3.0 eq.) with the resultant mixture heated to 85 °C for 16 h. The reaction mixture was cooled to RT and concentrated to dryness under reduced pressure to afford the product (403 mg, 0.590 mmol, assumed quantitative yield) as a brown oil which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.04 min; m/z = 683.2 for [M+H] ⁺

[0001169] Step 7: [(E)- [amino- [3-[2-[[3-[4-(tert- butoxy carbonylamino)butanoylamino]phenyl]sulfonylamino]-2-(6-metho xy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[0001170] To a magnetically stirred solution of tert-butyl N-[4-[4-[[2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]-l-(6-methoxy-l,3-benzothiazol-2 -yl)ethyl]sulfamoyl]anilino]-4- oxo-butyl] carbamate (254 mg, 0.372 mmol, 1.0 eq.) in Acetic acid (5 mL) was added Acetic anhydride (0.11 mL, 1.12 mmol, 3.0 eq.) at RT for 16 h. The reaction mixture was concentrated before the residue was purified by normal phase column chromatography (12 g cartridge) eluting with a gradient of 40-100% EtOAc in iso-hexane to afford the desired product (127 mg, 0.175 mmol, 47% yield) as a beige foam. ¹ H NMR (400 MHz, DMSO-d6) 5 10.05 (s, 1H), 8.70 (s, 1H), 7.77 (d, J = 9.0 Hz, 1H), 7.59 (d, J = 2.6 Hz, 1H), 7.56 (s, 1H), 7.46 - 7.39 (m, 3H), 7.36 (d, J = 8.8 Hz, 2H), 7.18 (d, J = 7.8 Hz, 1H), 7.10 (t, J = 7.6 Hz, 1H), 7.05 (dd, J = 8.9, 2.6 Hz, 1H), 6.87 (t, J = 5.8 Hz, 1H), 6.73 (s, 2H), 4.87 (s, 1H), 3.81 (s, 3H), 3.30 - 3.24 (m, 1H), 2.98 (dd, J = 13.0, 6.2 Hz, 3H), 2.31 (t, 2H), 2.15 (s, 3H), 1.69 (t, J = 7.3 Hz, 2H), 1.38 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.08 min; m/z = 725.2 for [M+H] ⁺

[0001171] Step 8: tert-butyl N-[4-[4-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-4-oxo-butyl]carba mate

[0001172] To a magnetically stirred solution of [(E)-[amino-[3-[2-[[4-[4-(tert- butoxycarbonylamino)butanoylamino]phenyl]sulfonylamino]-2-(6 -methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (127 mg, 0.175 mmol 1.0 eq.) in Acetic acid (3 mL) was added Zinc (229 mg, 3.50 mmol, 20.0 eq.) and the resultant suspension was stirred at RT for 18 h. The reaction was redosed with Zinc (115 mg, 1.75 mmol, 10.0 eq.) and stirred at RT for 48 h. The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM and the filtrate was concentrated in vacuo. The residue was purified via reverse phase preparative-HPLC eluting with 60-100% v/v methanol:H ₂ O (+10 mM NH4CO3 and 0.1% NH ₃ ) followed by a second purification via reverse phase prep-HPLC eluting with 30-100% MeCN:H ₂ O (+10 mM NHTOi and 0.1% NH ₃ ) to afford the desired product (13.0 mg, 0.0195 mmol, 11% yield) as a white solid. UPLC-MS (acidic 6 min): Rt = 2.79 min; m/z = 667.2 for [M+H] ⁺

[0001173] Step 9: 4-amino-N-[4-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-be nzothiazol- 2-yl)ethyl]sulfamoyl]phenyl]butanamide

[0001174] To a magnetically stirred solution of tert-butyl N-[4-[4-[[2-(3- carbamimidoylphenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]sulfamoyl]anilino]-4-oxo- butyl] carbamate (13.0 mg, 0.0195 mmol, 1.0 eq.) in 1,4-Dioxane (1.0 mb) was added Hydrogen chloride 4 N in 1,4-dioxane (1.0 mL, 4.00 mmol, 205 eq.) and the resultant suspension was stirred at RT for 16 h. The reaction mixture was concentrated under reduced pressure before being dried in a vacuum oven overnight, to afford the desired product (10.0 mg, 0.0176 mmol, 91% yield) as an off-white solid. ¹ H NMR (400 MHz, DMSO-d6) 5 7.77 (d, J = 8.8 Hz, 1H), 7.72 (s, 1H), 7.62 (s, 1H), 7.58 (d, J = 7.9 Hz, 1H), 7.47 - 7.36 (m, 5H), 7.27 (t, J = 7.7 Hz, 1H), 7.07 (d, J = 8.9 Hz, 1H), 4.96 (s, 1H), 3.82 (d, J = 1.6 Hz, 3H), 3.06 - 3.00 (m, 1H), 2.85 (s, 2H), 1.86 (s, 2H). UPLC-MS (acidic 6 min): Rt = 1.49 min; m/z = 567.1 for [M+H] ⁺ , 93% purity.

Example 57: Exemplary synthesis of Compound 167

[0001175] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001176] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 2.5 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL). The organics were then extracted with DCM (3 x 100 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford product (4.30 g, 10.5 mmol, 51% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[0001177] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile

[0001178] A magnetically stirred suspension of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq,) in 4 N HC1 in 1,4-dioxane (50.0 mL, 200 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated to dryness to afford the product (3.97 g, 11.5 mmol, assumed quantitative yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 310.0 for [M+H] ⁺

[0001179] Step 3: methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[0001180] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (0.500 g, 1.45 mmol, 1.0 eq,) in DMF (5.0 mL) was added triethylamine (0.60 mL, 4.34 mmol, 1.5 eq.) and the reaction mixture was cooled to 0°C. Methyl- 3 -chlorosulfonylbenzoate (0.407 g, 1.73 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 4 h. The reaction mixture was quenched via the addition of water (50 mL) and diluted with ethyl acetate (100 mL). After separation of the phases, the organics were washed with further water (3 x 50 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was then triturated with DCM, filtered and allowed to air dry to afford the product (0.390 g, 0.753 mmol, 52% yield). 1H NMR (400 MHz, DMSO-d6) 5 9.09 (d, J = 6.3 Hz, 1H), 7.96 - 7.85 (m, 2H), 7.79 - 7.69 (m, 2H), 7.64 - 7.57 (m, 2H), 7.53 - 7.38 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 5.01 (s, 1H), 3.88 (s, 3H), 3.83 (s, 3H), 3.36 (dd, J = 13.9, 4.5 Hz, 1H), 3.00 (dd, J = 13.9,

10.7 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.13 mm. m/z = 508.0 for [M+H] ⁺

[0001181] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[0001182] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (0.390 g, 0.768 mmol, 1.0 eq.) in THF (8.0 mL) was added a solution of lithium hydroxide (0.097 g, 2.31 mmol, 3.0 eq.) in water (2.4 mL) and the resulting mixture stirred at RT for 4 h. The reaction volume was reduced by half and then diluted with ethyl acetate (100 mL) and water (100 mL). After separation, the aqueous phase was acidified to pH 2.0 by the addition of 1 M HC1 (ca. 20 mL), extracted with ethyl acetate (2 x 100 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (0.394 g, 0.758 mmol, 99% yield). 1H NMR (400 MHz, DMSO-d6) 5 13.29 (s, 1H), 9.04 (d, J = 8.5 Hz, 1H), 7.98 - 7.88 (m, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.66 (d, J = 7.9 Hz, 1H), 7.63 (d, J = 2.6 Hz, 1H), 7.59 (s, 1H), 7.50 (d, J = 7.9 Hz, 1H), 7.47 - 7.35 (m, 2H), 7.23 (t, J =

7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 5.05 - 4.95 (m, 1H), 3.83 (s, 3H), 3.41 - 3.35 (m, 1H), 3.00 (dd, J = 13.9, 10.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 0.86 mm. m/z = 494.0 for [M+H] ⁺

[0001183] Step 5: tert-butyl N-[2-[[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl] sulfamoyl] benzoyl] amino] ethyl] carbamate

[0001184] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.835 g, 1.69 mmol, 1.0 eq.) in DMF (10 mL) were added tert-Butyl N-(2-aminoethyl)carbamate (0.325 g, 2.03 mmol, 1.2 eq.), DIPEA (0.88 mL, 5.08 mmol, 3.0 eq.) and HATU (0.965 g, 2.54 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 4 h. The reaction mixture was diluted with ethyl acetate (100 mL), washed with brine (100 mL), saturated sodium hydrogen carbonate solution (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-100 % ethyl acetate in isohexane to afford product (1.06 g, 1.67 mmol, 99% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.00 (d, J = 7.3 Hz, 1H), 8.56 (t, J = 5.7 Hz, 1H), 7.93 (s, 1H), 7.88 (d, J = 7.8 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.60 - 7.54 (m, 2H), 7.46 (dd, J = 7.9, 1.8 Hz, 1H), 7.44 - 7.33 (m, 2H), 7.18 (t, J = 7.8 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 6.91 (t, J = 5.8 Hz, 1H), 5.02 (s, 1H), 3.83 (s, 3H), 3.37 (dd, J = 13.9, 4.5 Hz, 1H), 3.33 - 3.32 (m, 1H), 3.15 (t, J = 6.3 Hz, 2H), 2.97 (dd, J = 13.9, 10.6 Hz, 1H), 1.37 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 636.2 for [M+H] ⁺

[0001185] Step 6: tert-butyl N-[2-[[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methox y- 1 ,3 -benzothiazol-2-yl)ethy 1] sulfamoyl] benzoyl] amino] ethyl] carbamate

[0001186] To a magnetically stirred solution of tert-butyl N-[2-[[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]amino] ethyl]carbamate (1.06 g, 1.67 mmol, 1.0 eq.) in EtOH (20.0 mL) were added hydroxylamine hydrochloride (0.232 g, 3.33 mmol, 2.0 eq.) and DIPEA (0.87 mL, 5.00 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 20 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (1.12 g, 1.67 mmol, assumed quantitative yield) as a white oil which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 669.2 for [M+H] ⁺

[0001187] Step 7: [[amino-[3-[2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[0001188] To a magnetically stirred solution of tert-butyl N-[2-[[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl] -1-(6-methoxy- 1 ,3 -benzothiazol-2- yl)ethyl]sulfamoyl]benzoyl]amino]ethyl]carbamate (1.28 g, 1.91 mmol, 1.0 eq) in acetic acid (10.0 mL) was added acetic anhydride (0.54 mL, 5.73 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 20-100% EtOAc in isohexane to afford product (0.615 g, 0.865 mmol, 45% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.95 (d, J = 8.3 Hz, 1H), 8.54 (t, J = 5.5 Hz, 1H), 7.94 (d, J = 1.9 Hz, 1H), 7.80 (d, J = 8.0 Hz, 1H), 7.76 (d, J = 8.9 Hz, 1H), 7.60 (d, J = 2.6 Hz, 1H), 7.57 - 7.51 (m, 2H), 7.39 (dt, J = 8.0, 1.4 Hz, 1H), 7.31 (t, J = 7.8 Hz, 1H), 7.22 (d, J = 7.7 Hz, 1H), 7.12 - 7.03 (m, 2H), 6.89 (t, J = 5.7 Hz, 1H), 6.69 (s, 2H), 4.94 (td, J = 9.1, 5.2 Hz, 1H), 3.82 (s, 3H), 3.29 (d, J = 4.1 Hz, 1H), 3.13 (t, J = 6.3 Hz, 2H), 2.98 (dd, J = 13.9, 9.8 Hz, 1H), 2.52 (d, J = 1.9 Hz, 1H), 2.16 (s, 3H), 1.37 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.06 mm; m/z = 711.3 for [M+H] ⁺

[0001189] Step 8: tert-butyl N-[2-[[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]amino]ethyl]carbam ate

[0001190] To a magnetically stirred solution of [[amino-[3-[2-[[3-[2-(tert- butoxycarbonylamino)ethylcarbamoyl]phenyl]sulfonylamino]-2-( 6-methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.620 g, 0.865 mmol, 1.0 eq) in acetic acid (10.0 mL) was added zinc (1.13 g, 17.3 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 96 h. The reaction mixture was then filtered through Celite, washing with copious acetonitrile, ethanol and DCM before concentrating to dryness. The residue was then submitted to Reach for chiral purification via SFC on a Lux Cl, eluting with 35:65 EtOH:CO ₂ (+0.2% v/v NH ₃ ) to afford the product (0.122 g, 0.187 mmol, 11% yield) as a white solid.

UPLC-MS (acidic 2.5 min): Rt = 1.19 min; m/z = 653.2 for [M+H] ⁺ Reach determined the chiral purity (Lux Cl) to be 100.0% of the 1 ^st eluting enantiomer (Rt 6.563 min).

[0001191] Step 9: N-(2-aminoethyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy- l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide dihydrochloride

[0001192] To tert-butyl N-[2-[[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzot hiazol- 2-yl)ethyl]sulfamoyl]benzoyl]amino]ethyl]carbamate (0.122 g, 0.187 mmol, 1.00 eq.) was added 4 N HC1 in 1,4-Dioxane solution (2.0 mL, 8.00 mmol, 42.9 eq.) and the reaction mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness, resuspended in water, concentrated to dryness again before drying in a vacuum oven overnight to afford the product (0.076 g, 0.136 mmol, 73% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.24 (s, 2H), 9.09 (s, 2H), 9.03 - 8.99 (m, 1H), 8.86 (d, J = 5.8 Hz, 1H), 8.07 (s, 3H), 8.00 (d, J = 1.8 Hz, 1H), 7.94 (d, J = 7.6 Hz, 1H), 7.78 (dd, J = 8.9, 1.6 Hz, 1H), 7.73 (s, 1H), 7.66 - 7.60 (m, 1H), 7.59 - 7.51 (m, 2H), 7.44 (d, J = 7.7 Hz, 1H), 7.33 (td, J = 7.8, 1.5 Hz, 1H), 7.26 - 7.17 (m, 1H), 7.09 (ddd, J = 9.0, 2.6, 1.6 Hz, 1H), 5.04 (d, J = 11.7 Hz, 1H), 3.83 (d, J = 1.7 Hz, 3H), 3.54 (s, 2H), 3.42 - 3.32 (m, 1H), 3.08 - 2.94 (m, 3H). UPLC-MS (acidic 6 mm): Rt = 1.59 mm; m/z = 553.2 for [M+H] ⁺ , 99% purity

Example 58: Exemplary synthesis of Compound 167

[0001193] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001194] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (5.94 g, 20.5 mmol, 1.0 eq.) in toluene (120.0 mL) were added DIPEA (8.9 mL, 51.2 mmol, 2.5 eq.), 2-amino-5-methoxy-benzenethiol (3.49 g, 22.5 mmol, 1.1 eq.) and T3P (9.1 mL, 30.7 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 10 min then at reflux for 3 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (100 mL). The organics were then extracted with DCM (3 x 100 mL), washed with brine (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography on a 120 g cartridge eluting with 0-60% ethyl acetate in heptane to afford product (4.30 g, 10.5 mmol, 51% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 7.85 (d, J = 8.9 Hz, 2H), 7.79 (s, 1H), 7.68 (dd, J = 16.4, 5.2 Hz, 3H), 7.52 (t, J = 7.7 Hz, 1H), 7.10 (dd, J = 8.9, 2.5 Hz, 1H), 5.12 (d, J = 8.5 Hz, 1H), 3.83 (s, 3H), 3.52 (dd, J = 13.9, 4.4 Hz, 1H), 3.16 - 3.06 (m, 1H), 1.30 (s, 8H). UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 410.1 for [M+H] ⁺

[0001195] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile

[0001196] A magnetically stirred suspension of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (4.30 g, 10.5 mmol, 1.0 eq,) in 4 N HC1 in 1,4-dioxane (50.0 mL, 200 mmol, 19.1 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated to dryness to afford the product (3.97 g, 11.5 mmol, assumed quantitative yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.04 (d, J = 5.3 Hz, 3H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (s, 1H), 7.72 (dd, J = 7.5, 4.8 Hz, 2H), 7.57 (d, J = 7.9 Hz, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.18 - 7.11 (m, 1H), 5.25 (d, J = 8.2 Hz, 1H), 3.82 (d, J = 1.4 Hz, 3H), 3.52 (dd, J = 13.9, 6.1 Hz, 1H), 3.36 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.02 mm. m/z = 310.0 for [M+H] ⁺

[0001197] Step 3: methyl 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoate

[0001198] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile hydrochloride (0.500 g, 1.45 mmol, 1.0 eq,) in DMF (5.0 mL) was added triethylamine (0.60 mL, 4.34 mmol, 1.5 eq.) and the reaction mixture was cooled to 0°C. Methyl- 3 -chlorosulfonylbenzoate (0.407 g, 1.73 mmol, 1.2 eq,) was added portion wise at 0°C over 10 mins and the reaction mixture was allowed to warm to RT for 4 h. The reaction mixture was quenched via the addition of water (50 mL) and diluted with ethyl acetate (100 mL). After separation of the phases, the organics were washed with further water (3 x 50 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was then triturated with DCM, filtered and allowed to air dry to afford the product (0.390 g, 0.753 mmol, 52% yield). 1H NMR (400 MHz, DMSO-d6) 5 9.09 (d, J = 6.3 Hz, 1H), 7.96 - 7.85 (m, 2H), 7.79 - 7.69 (m,

2H), 7.64 - 7.57 (m, 2H), 7.53 - 7.38 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 5.01 (s, 1H), 3.88 (s, 3H), 3.83 (s, 3H), 3.36 (dd, J = 13.9, 4.5 Hz, 1H), 3.00 (dd, J = 13.9,

10.7 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 508.0 for [M+H] ⁺

[0001199] Step 4: 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]sulfamoyl]benzoic acid

[0001200] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoate (0.390 g, 0.768 mmol, 1.0 eq.) in THF (8.0 mL) was added a solution of lithium hydroxide (0.097 g, 2.31 mmol, 3.0 eq.) in water (2.4 mL) and the resulting mixture stirred at RT for 4 h. The reaction volume was reduced by half and then diluted with ethyl acetate (100 mL) and water (100 mL). After separation, the aqueous phase was acidified to pH 2.0 by the addition of 1 M HC1 (ca. 20 mL), extracted with ethyl acetate (2 x 100 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (0.394 g, 0.758 mmol, 99% yield). 1H NMR (400 MHz, DMSO-d6) 5 13.29 (s, 1H), 9.04 (d, J = 8.5 Hz, 1H), 7.98 - 7.88 (m, 2H), 7.78 (d, J = 8.9 Hz, 1H), 7.66 (d, J = 7.9 Hz, 1H), 7.63 (d, J = 2.6 Hz, 1H), 7.59 (s, 1H), 7.50 (d, J = 7.9 Hz, 1H), 7.47 - 7.35 (m, 2H), 7.23 (t, J =

7.7 Hz, 1H), 7.08 (dd, J = 8.9, 2.6 Hz, 1H), 5.05 - 4.95 (m, 1H), 3.83 (s, 3H), 3.41 - 3.35 (m, 1H), 3.00 (dd, J = 13.9, 10.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 0.86 mm. m/z = 494.0 for [M+H] ⁺

[0001201] Step 5: tert-butyl N-[2-[[3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2 - yl)ethyl] sulfamoyl] benzoyl] amino] ethyl] carbamate

[0001202] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoic acid (0.835 g, 1.69 mmol, 1.0 eq.) in DMF (10 mL) were added tert-Butyl N-(2-aminoethyl)carbamate (0.325 g, 2.03 mmol, 1.2 eq.), DIPEA (0.88 mL, 5.08 mmol, 3.0 eq.) and HATU (0.965 g, 2.54 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 4 h. The reaction mixture was diluted with ethyl acetate (100 mL), washed with brine (100 mL), saturated sodium hydrogen carbonate solution (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 40-100 % ethyl acetate in isohexane to afford product (1.06 g, 1.67 mmol, 99% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.00 (d, J = 7.3 Hz, 1H), 8.56 (t, J = 5.7 Hz, 1H), 7.93 (s, 1H), 7.88 (d, J = 7.8 Hz, 1H), 7.80 (d, J = 8.9 Hz, 1H), 7.64 (d, J = 2.6 Hz, 1H), 7.60 - 7.54 (m, 2H), 7.46 (dd, J = 7.9, 1.8 Hz, 1H), 7.44 - 7.33 (m, 2H), 7.18 (t, J = 7.8 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 6.91 (t, J = 5.8 Hz, 1H), 5.02 (s, 1H), 3.83 (s, 3H), 3.37 (dd, J = 13.9, 4.5 Hz, 1H), 3.33 - 3.32 (m, 1H), 3.15 (t, J = 6.3 Hz, 2H), 2.97 (dd, J = 13.9, 10.6 Hz, 1H), 1.37 (s, 9H). UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 636.2 for [M+H] ⁺

[0001203] Step 6: tert-butyl N-[2-[[3-[[2-[3-(N'-hydroxycarbamimidoyl)phenyl]-l-(6-methox y- 1 ,3 -benzothiazol-2-yl)ethy 1] sulfamoyl] benzoyl] amino] ethyl] carbamate

[0001204] To a magnetically stirred solution of tert-butyl N-[2-[[3-[[2-(3-cyanophenyl)-l-(6- methoxy-l,3-benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]amino] ethyl]carbamate (1.06 g, 1.67 mmol, 1.0 eq.) in EtOH (20.0 mL) were added hydroxylamine hydrochloride (0.232 g, 3.33 mmol, 2.0 eq.) and DIPEA (0.87 mL, 5.00 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 20 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (1.12 g, 1.67 mmol, assumed quantitative yield) as a white oil which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 669.2 for [M+H] ⁺

[0001205] Step 7: [[amino-[3-[2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-(6- methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[0001206] To a magnetically stirred solution of tert-butyl N-[2-[[3-[[2-[3-(N'- hydroxycarbamimidoyl)phenyl] -1-(6-methoxy- 1 ,3 -benzothiazol-2- yl)ethyl]sulfamoyl]benzoyl]amino]ethyl]carbamate (1.28 g, 1.91 mmol, 1.0 eq) in acetic acid (10.0 mL) was added acetic anhydride (0.54 mL, 5.73 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 20-100% EtOAc in isohexane to afford product (0.615 g, 0.865 mmol, 45% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.95 (d, J = 8.3 Hz, 1H), 8.54 (t, J = 5.5 Hz, 1H), 7.94 (d, J = 1.9 Hz, 1H), 7.80 (d, J = 8.0 Hz, 1H), 7.76 (d, J = 8.9 Hz, 1H), 7.60 (d, J = 2.6 Hz, 1H), 7.57 - 7.51 (m, 2H), 7.39 (dt, J = 8.0, 1.4 Hz, 1H), 7.31 (t, J = 7.8 Hz, 1H), 7.22 (d, J = 7.7 Hz, 1H), 7.12 - 7.03 (m, 2H), 6.89 (t, J = 5.7 Hz, 1H), 6.69 (s, 2H), 4.94 (td, J = 9.1, 5.2 Hz, 1H), 3.82 (s, 3H), 3.29 (d, J = 4.1 Hz, 1H), 3.13 (t, J = 6.3 Hz, 2H), 2.98 (dd, J = 13.9, 9.8 Hz, 1H), 2.52 (d, J = 1.9 Hz, 1H), 2.16 (s, 3H), 1.37 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.06 mm; m/z = 711.3 for [M+H] ⁺

[0001207] Step 8: tert-butyl N-[2-[[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]amino]ethyl]carbam ate

[0001208] To a magnetically stirred solution of [[amino-[3-[2-[[3-[2-(tert- butoxycarbonylamino)ethylcarbamoyl]phenyl]sulfonylamino]-2-( 6-methoxy-l,3-benzothiazol-2- yl)ethyl]phenyl]methylene]amino] acetate (0.620 g, 0.865 mmol, 1.0 eq) in acetic acid (10.0 mL) was added zinc (1.13 g, 17.3 mmol, 20.0 eq.). The reaction mixture was stirred at room temperature for 96 h. The reaction mixture was then filtered through Celite, washing with copious acetonitrile, ethanol and DCM before concentrating to dryness. The residue was then submitted to Reach for chiral purification via SFC on a Lux Cl, eluting with 35:65 EtOH:CO ₂ (+0.2% v/v NH ₃ ) to afford the product (0.150 g, 0.229 mmol, 13% yield) as a white solid.

UPLC-MS (acidic 2.5 min): Rt = 1.19 min; m/z = 653.2 for [M+H] ⁺

[0001209] Step 9: N-(2-aminoethyl)-3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy- l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzamide

[0001210] To tert-butyl N-[2-[[3-[[2-(3-carbamimidoylphenyl)-l-(6-methoxy-l,3-benzot hiazol- 2-yl)ethyl]sulfamoyl]benzoyl]amino]ethyl]carbamate (0.150 g, 0.229 mmol, 1.00 eq.) was added 4 N HC1 in 1,4-Dioxane solution (2.0 mL, 8.00 mmol, 34.9 eq.) and the reaction mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness. This procedure was repeated twice more, stirring for 4 h and then for 5 h before concentrating to dryness and purifying via reverse phase preparative-HPLC eluting with a gradient of 15-100% MeCN:H ₂ O (+10 mM ammonium bicarbonate). The solid obtained from concentrating the fractions was resuspended in MeCN/H ₂ O before concentrating and then drying in a vacuum oven overnight to afford the product (0.061 g, 0.110 mmol, 48% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.06 (s, 1H), 8.06 (s, 1H), 7.83 (d, J = 8.9 Hz, 1H), 7.78 - 7.65 (m, 2H), 7.58 (s, 1H), 7.51 (d, J = 7.8 Hz, 1H), 7.39 (s, 2H), 7.19 - 7.07 (m, 2H), 7.03 (s, 1H), 5.39 (s, 1H), 4.88 (d, J = 11.1 Hz, 1H), 3.87 - 3.78 (m, 5H), 2.93 (t, J = 13.0 Hz, 1H), 2.69 (d, J = 20.4 Hz, 1H). UPLC-MS (acidic 6 min): Rt = 1.63 min; m/z = 553.2 for [M+H] ⁺ , 96% purity

Example 59: Exemplary synthesis of Compound 234

[0001211] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001212] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (21.0 g, 72.3 mmol, 1.0 eq.) in toluene (420 mL) were added 2- aminothiophenol (8.5 mL, 79.6 mmol, 1.1 eq.), T3P (32.0 mL, 54.3 mmol, 0.8 eq.) and DIPEA (19.0 mL, 109 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min, then at 115 °C for 6 h. The reaction mixture was cooled to RT and stirred for 16.5 h. The reaction mixture was re-dosed with T3P (19.0 mL, 32.6 mmol, 0.5 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction mixture was quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and stirred for 20 min. The phases were separated and the organics were extracted using EtOAc (3 x 250 mL), combined, washed with brine (250 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-20% EtOAc in DCM to afford the product (9.70 g, 25.6 mmol, 35% yield) as an off-white solid. 1H NMR (400 MHz, DMSO- d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (dt, J = 8.0, 1.0 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.81 (d, J =

I.9 Hz, 1H), 7.71 (dd, J = 7.7, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.17 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8,

I I.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.25 mm; m/z = 380.1 for [M+H]+

[0001213] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001214] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (14.6 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10 mL) was added 4 N HC1 in 1,4-dioxane (150 mL, 600 mmol, 15.6 eq.) and the resultant solution was stirred at RT for 4 h. The reaction mixture was then concentrated to dryness to afford the product (14.0 g, 39.5 mmol, assumed quantitative yield) as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). - residual 1,4-dioxane present (9% wt.). UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.0 for [M+H]+

[0001215] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001216] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (5.00 g, 14.1 mmol, 1.0 eq.) in DMF (50 mL) cooled to 0 °C was added triethylamine (6.9 mL, 49.3 mmol, 3.5 eq.) and the resultant solution was stirred for 10 min. To the cooled solution was added 3 -nitrobenzenesulfonyl chloride (3.75 g, 16.9 mmol, 1.2 eq.) portionwise over 10-15 min. The resultant mixture was then gently warmed to RT and stirred for 4 h. The organics were then extracted into EtOAc (250 mL), washed with brine (250 mL), aq. saturated Na ₂ CO ₃ (250 mL), and brine again (250 mL). The organics were then dried over anhydrous sodium sulfate, filtered and concentrated to dryness. The residue was triturated with DCM (25 mL) and filtered under vacuum to afford the product (4.42 g, 9.31 mmol, 66% yield) as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.35 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.88 (dddd, J = 7.8, 4.5, 1.6, 0.8 Hz, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.59 (t, J = 8.0 Hz, 1H), 7.55 (dt, J = 7.9, 1.4 Hz, 1H), 7.50 (ddd, J = 8.2, 7.2, 1.4 Hz, 1H), 7.47 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.17 (d, J = 9.9 Hz, 1H), 3.41 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.14 mm; m/z = 465.1 for [M+H]+

[0001217] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001218] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-nitro-benzenesulfonamide (4.42 g, 9.31 mmol, 1.0 eq.) in ethanol (45 mL) and water (23 mL) were added ammonium chloride (2.49 g, 46.6 mmol, 5.0 eq.) and iron (5.20 g, 93.1 mmol, 10.0 eq.). The reaction mixture was heated to 85 °C and stirred for 24 h. The reaction mixture was then cooled to RT and filtered through a plug of Celite under vacuum, washing with copious EtOH. The filtrate was concentrated to dryness to afford the product (2.61 g, 5.53 mmol, 59% yield) as a white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.71 (s, 1H), 8.11 - 8.06 (m, 1H), 7.97 - 7.93 (m, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 (tt, J = 6.7, 1.2 Hz, 2H), 7.51 - 7.48 (m, 1H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.0 Hz, 1H), 6.61 - 6.56 (m,

2H), 5.40 (s, 2H), 4.90 (dd, J = 9.9, 4.9 Hz, 1H), 3.38 (d, J = 4.9 Hz, 1H), 2.99 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 min): Rt = 1.06 min; m/z = 435.1 for [M+H]+

[0001219] Step 5: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate

[0001220] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (0.500 g, 1.15 mmol, 1.0 eq.) in DMF (5 mb) was added N-alpha-t-BOC-glycine (0.241 g, 1.38 mmol, 1.2 eq.) and DIPEA (0.6 mb, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 5.5 h. The reaction mixture was then diluted with EtOAc (50 mL) and washed with brine (50 mL), aq. saturated Na ₂ CO ₃ (50 mL) and brine (50 mL) again. The organics were dried over anhydrous sodium sulfate, filtered and concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with a gradient of 10-70% EtOAc in iso-hexane. Co-elution of the starting material and the product was observed. The product-containing fractions were concentrated to dryness and purified by reverse phase column chromatography (45 g cartridge) eluting with 35-60% MeCN in water (0.1% NH ₃ ) to afford the product (0.276 g, 0.387 mmol, 34% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.06 (s, 1H), 9.00 (s, 1H), 8.09 (d, J = 7.9 Hz, 1H), 7.94 (d, J = 8.2 Hz, 1H), 7.79 (s, 1H), 7.56 - 7.39 (m, 7H), 7.28 (t, J = 7.7 Hz, 1H), 7.21 (t, J = 7.9 Hz, 1H), 7.16 - 7.08 (m, 2H), 4.91 (s, 1H), 3.74 (d, J = 6.1 Hz, 2H), 3.38 (s, 1H), 2.97 (dd, J = 13.8, 10.7 Hz, 1H), 1.42 (s, 8H). UPLC-MS (basic 2 min): Rt = 1.13 min; m/z = 592.1 [M+H]+

[0001221] Step 6: tert-butyl N-[2-[3-[[l-(l, 3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]anilino]-2-oxo-e thyl]carbamate

[0001222] To a magnetically stirred solution of tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbam ate (0.280 g, 0.387 mmol, 1.0 eq.) in EtOH (6 mL) were added hydroxylamine hydrochloride (54.0 mg, 0.774 mmol, 2.0 eq.) and DIPEA (0.2 mL, 1.16 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 24 h. Further hydroxylamine hydrochloride (0.027 g, 0.387 mmol, 1.0 eq.) was added and the reaction mixture was stirred under reflux for a further 4.5 h. The reaction mixture was then cooled to RT and concentrated to dryness to the product (0.535 g, 0.856 mmol, assumed quantitative yield), as a brown oil, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 625.1 for [M+H] ⁺

[0001223] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]ethyl] phenyl]methylene]amino] acetate

[0001224] To a magnetically stirred solution of tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)- 2-[3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]anilino ]-2-oxo-ethyl]carbamate (0.535 g, 0.856 mmol, 1.0 eq.) in acetic acid (10 mL) was added acetic anhydride (0.2 mL, 2.57 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 2.5 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 30-100% EtOAc in iso-hexane to the product (0.145 g, 0.211 mmol, 25% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.00 (s, 1H), 8.93 (s, 1H), 8.05 (d, J = 8.0 Hz, 1H), 7.92 (d, J = 8.1 Hz, 1H), 7.88 (s, 1H), 7.55 (s, 1H), 7.53 - 7.45 (m, 2H), 7.41 (t, J = 7.9 Hz, 2H), 7.21 (d, J = 7.6 Hz, 1H), 7.11 (dq, J = 12.9, 7.2 Hz, 4H), 6.69 (s, 2H), 4.92 (s, 1H), 3.71 (d, J = 6.2 Hz, 2H), 3.28 (d, J = 5.3 Hz, 1H), 3.04 - 2.93 (m, 1H), 2.14 (d, J = 5.8 Hz, 3H), 1.41 (s, 7H). -UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 667.2 for [M+H] ⁺

[0001225] Step 8: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]car bamate

[0001226] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- [[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]ethyl] phenyl]methylene]amino] acetate (0.145 g, 0.217 mmol, 1.0 eq.) in acetic acid (3 mL) was added zinc (0.284 g, 4.35 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 16.5 h. Lurther zinc (0.284 g, 4.35 mmol, 20.0 eq.) was added and the reaction mixture was stirred at RT for a further 23 h. The reaction mixture was filtered and washed with acetic acid (2 mL). The residue was stirred with zinc

(0.284 g, 4.35 mmol, 20.0 eq.) at RT for 20 h. The reaction mixture was filtered, washed with copious MeCN and concentrated to dryness. The residue was sent to Reach for chiral purification via SFC (Lux C421.2 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (+0.2% v/v NH ₃ ). Approximately 5 mg of each enantiomer was combined to afford racemic product (11.0 mg, 0.0174 mmol, 8% yield) as a white solid. UPLC-MS (basic 2.5 min): Rt = 1.05 min; m/z = 609.2 for [M+H] ⁺

[0001227] Step 9: 2-amino-N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]acetamide dihydrochloride

[0001228] To tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]car bamate (11.0 mg, 0.0174 mmol, 1.0 eq.) was added 4 N HC1 in 1,4-di oxane solution (1.0 mL, 4.00 mmol, 230 eq.) and the reaction mixture was stirred at RT for 5.5 h. The reaction mixture was concentrated to dryness, resuspended in water and concentrated to dryness again before being dried in a vacuum oven overnight to afford the product (4.00 mg, 0.00786 mmol, 45% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.66 (s, 1H), 9.20 (s, 2H), 9.01 (t, J = 4.0 Hz, 3H), 8.19 (s, 4H), 8.11 - 8.04 (m, 1H), 7.96 - 7.90 (m, 1H), 7.88 (s, 1H), 7.72 (s, 1H), 7.60 - 7.46 (m, 4H), 7.46 - 7.40 (m, 1H), 7.30 (t, J = 7.7 Hz, 1H), 7.21 - 7.10 (m, 3H), 5.09 - 4.97 (m, 1H), 3.82 (d, J = 5.8 Hz, 2H), 3.06 (dd, J = 13.8, 10.1 Hz, 1H). - 1.4 wt.% acetic acid, product suggested to be bis HC1 salt. UPLC-MS (acidic 6 min): Rt = 1.34 min; m/z = 509.2 for [M+H] ⁺

Example 60: Exemplary synthesis of Compound 234

[0001229] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001230] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (21.00 g, 72.3 mmol, 1.0 eq.) in toluene (420 mL) were added 2- aminothiophenol (8.5 mL, 79.6 mmol, 1.1 eq.), T3P (32 mL, 54.3 mmol, 0.8 eq.) and DIPEA (19 mL, 109 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min, then at 115 °C for 6 h. The reaction mixture was cooled to RT and stirred for 16.5 h. The reaction mixture was re- dosed with T3P (19 mL, 32.6 mmol, 0.5 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction mixture was quenched via the addition of saturated aqueous Na ₂ CO ₃ solution (250 mL) and stirred for 20 min. The phases were separated, and the organics were extracted using EtOAc (3 x 250 mL), combined, washed with saturated brine solution (250 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography eluting with 0-20% EtOAc in DCM to afford tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e as an off-white solid (9.70 g, 25.6 mmol, 35% yield). 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (dt, J = 8.0, 1.0 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.81 (d, J = 1.9 Hz, 1H), 7.71 (dd, J = 7.7, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.17 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.25 mm; m/z = 380.1 for [M+H]+

[0001231] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001232] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (14.60 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10 mL) was added 4 N HC1 in 1,4-dioxane solution (150 mL, 600 mmol, 15.6 eq.) and the reaction mixture was stirred at RT for 4 h. The reaction mixture was concentrated to dryness to afford 3-[2-amino-2- (l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydrochloride as an off-white solid (14.00 g, 39.5 mmol, 103% yield), which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.03 min; m/z = 280.0 for [M+H]+

[0001233] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001234] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (5.00 g, 14.1 mmol, 1.0 eq.) in DMF (50 mL) cooled to 0 °C was added triethylamine (6.9 mL, 49.3 mmol, 3.5 eq.) and the resultant solution was stirred for 10 min. To the cooled solution was added 3 -nitrobenzenesulfonyl chloride (3.75 g, 16.9 mmol, 1.2 eq.) portionwise over 10-15 min. The reaction mixture was then gently warmed to RT and stirred for 4 h. The organics were extracted into EtOAc (250 mL), washed with saturated brine solution (250 mL), aqueous Na ₂ CO ₃ solution (250 mL), and brine again (250 mL). The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was triturated with DCM (25 mL) and filtered under vacuum to afford N-[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]-3-nitro-benzenesulfonamide as an off-white solid (4.42 g, 9.31 mmol, 66 % yield), which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.35 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.88 (dddd, J = 7.8, 4.5, 1.6, 0.8 Hz, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.59 (t, J = 8.0 Hz, 1H), 7.55 (dt, J = 7.9, 1.4 Hz, 1H), 7.50 (ddd, J = 8.2, 7.2, 1.4 Hz, 1H), 7.47 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.17 (d, J = 9.9 Hz, 1H), 3.41 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min): Rt = 1.14 min; m/z = 465.1 for [M+H]+

[0001235] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001236] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-nitro-benzenesulfonamide (4.42 g, 9.31 mmol, 1.0 eq.) in ethanol (45 mL) and water (23 mL) were added ammonium chloride (2.49 g, 46.6 mmol, 5.0 eq.) and iron (5.20 g, 93.1 mmol, 10.0 eq.). The reaction mixture was heated to 85 °C and stirred for 24 h. The reaction mixture was then cooled to RT and filtered through a plug of celite under vacuum, washing with copious EtOH. The filtrate was concentrated to dryness to afford 3-amino-N-[l-(l,3- benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]benzenesulfonamide as a white solid (2.61 g, 5.53 mmol, 59% yield), which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.71 (s, 1H), 8.11 - 8.06 (m, 1H), 7.97 - 7.93 (m, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 (tt, J = 6.7, 1.2 Hz, 2H), 7.51 - 7.48 (m, 1H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.0 Hz, 1H), 6.61 - 6.56 (m, 2H), 5.40 (s, 2H), 4.90 (dd, J = 9.9, 4.9 Hz, 1H), 3.38 (d, J = 4.9 Hz, 1H), 2.99 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 min): Rt = 1.06 min; m/z = 435.1 for [M+H]+

[0001237] Step 5: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] sulfamoyl] anilino]-2-oxo-ethyl] carbamate

[0001238] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (0.500 g, 1.15 mmol, 1.0 eq.) in DMF (5 mb) were added N-alpha-t-BOC-glycine (0.241 g, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 5.5 h. The reaction mixture was then diluted with EtOAc (50 mL) and washed with saturated brine solution (50 mL), saturated aqueous Na ₂ CO ₃ (50 mL) and brine (50 mL) again. The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 10-70% EtOAc in iso-hexane. Co-elution of the starting material and the product was observed. The product- containing fractions were concentrated to dryness and purified by reverse phase column chromatography (45 g cartridge) eluting with 35-60% MeCN (0.1% NH ₃ ) in water (0.1% NH ₃ ) to afford tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate as an off-white solid (0.276 g, 0.387 mmol, 34% yield). 1H NMR (400 MHz, DMSO-d6) 5 10.06 (s, 1H), 9.00 (s, 1H), 8.09 (d, J = 7.9 Hz, 1H), 7.94 (d, J = 8.2 Hz, 1H), 7.79 (s, 1H), 7.56 - 7.39 (m, 7H), 7.28 (t, J = 7.7 Hz, 1H), 7.21 (t, J = 7.9 Hz, 1H), 7.16 - 7.08 (m, 2H), 4.91 (s, 1H), 3.74 (d, J = 6.1 Hz, 2H), 3.38 (s, 1H), 2.97 (dd, J = 13.8, 10.7 Hz, 1H), 1.42 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.13 mm; m/z = 592.1 [M+H]+

[0001239] Step 6: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]anilino]-2-oxo-e thyl]carbamate

[0001240] To a magnetically stirred solution of tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbam ate (0.280 g, 0.387 mmol, 1.0 eq.) in EtOH (6 mL) were added hydroxylamine hydrochloride (0.054 g, 0.774 mmol, 2.0 eq.) and DIPEA (0.20 mL, 1.16 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 24 h. Lurther hydroxylamine hydrochloride (0.027 g, 0.387 mmol, 1.0 eq.) was added and the reaction mixture was stirred under reflux for a further 4.5 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2- yl)-2-[3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]ani lino]-2-oxo-ethyl]carbamate as a brown oil (0.535 g, 0.856 mmol, assumed quantitative yield), which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 625.1 for [M+H] ⁺

[0001241] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]ethyl] phenyl]methylene]amino] acetate

[0001242] To a magnetically stirred solution of tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)- 2-[3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]anilino ]-2-oxo-ethyl]carbamate (0.535 g, 0.856 mmol, 1.0 eq.) in acetic acid (10 mL) was added acetic anhydride (0.24 mL, 2.57 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 2.5 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 30-100% EtOAc in iso-hexane to afford [[amino-[3-[2-(l,3- benzothiazol-2-yl)-2- [ [3 - [ [2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]ethyl] phenyl]methylene]amino] acetate as a white solid (0.145 g, 0.211 mmol, 25% yield). 1H NMR (400 MHz, DMSO-d6) 5 10.00 (s, 1H), 8.93 (s, 1H), 8.05 (d, J = 8.0 Hz, 1H), 7.92 (d, J = 8.1 Hz, 1H), 7.88 (s, 1H), 7.55 (s, 1H), 7.53 - 7.45 (m, 2H), 7.41 (t, J = 7.9 Hz, 2H), 7.21 (d, J = 7.6 Hz, 1H), 7.11 (dq, J = 12.9, 7.2 Hz, 4H), 6.69 (s, 2H), 4.92 (s, 1H), 3.71 (d, J = 6.2 Hz, 2H), 3.28 (d, J = 5.3 Hz, 1H), 3.04 - 2.93 (m, 1H), 2.14 (d, J = 5.8 Hz, 3H), 1.41 (s, 7H). UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 667.2 for [M+H] ⁺

[0001243] Step 8: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]car bamate

[0001244] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- [[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]ethyl] phenyl]methylene]amino] acetate (0.145 g, 0.217 mmol, 1.0 eq.) in acetic acid (3 mL) was added zinc (0.284 g, 4.35 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 16.5 h. Lurther zinc (0.284 g, 4.35 mmol, 20.0 eq.) was added and the reaction mixture was stirred at RT for a further 23 h. The reaction mixture was filtered and washed with acetic acid (2 mL). The residue was stirred with zinc (0.284 g, 4.35 mmol. 20.0 eq.) at RT for 20 h. The reaction mixture was filtered, washed with copious MeCN and concentrated to dryness. The residue was sent to Reach for chiral purification via SFC (Lux C421.2 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (+0.2% v/v NH ₃ ) to afford tert-butyl N- [2-oxo-2- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]anilino]ethyl]carbamate as a white solid (0.021 g, 0.0345 mmol, 13% yield). UPLC-MS (basic 2.5 min): Rt = 1.05 min; m/z = 609.2 for [M+H] ⁺ Reach determined the chiral purity (Lux C4) to be 99.8% of the 1 ^st eluting enantiomer (Rt 4.222 min).

[0001245] Step 9: 2-amino-N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]acetamide dihydrochloride

[0001246] To tert-butyl N-[2-oxo-2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]ethyl]carbamate (0.0210 g, 0.0345 mmol, 1.0 eq.) was added 4 N HC1 in 1,4-dioxane solution (2.0 mL, 8.00 mmol, 232 eq.) and the reaction mixture was stirred at RT for 5.5 h. The reaction mixture was concentrated to dryness, re- suspended in water and concentrated to dryness again before being dried in a vacuum oven overnight afford 2-amino-N-[3-[[ l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]acetamide as an off-white solid (0.0130 g, 0.0256 mmol, 74% yield). 1H NMR (400 MHz, DMSO-d6) 5 10.71 (s, 1H), 9.21 (s, 2H), 9.04 (s, 2H), 9.01 (d, J = 8.1 Hz, 1H), 8.21 (s, 3H), 8.12 - 8.05 (m, 1H), 7.96 - 7.90 (m, 1H), 7.88 (d, J = 2.0 Hz, 1H), 7.72 (s, 1H), 7.57 (d, J = 7.8 Hz, 1H), 7.54 - 7.47 (m, 3H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.30 (t, J = 7.8 Hz, 1H), 7.21 - 7.09 (m, 2H), 5.08 - 4.97 (m, 1H), 3.83 (d, J = 5.8 Hz, 2H), 3.44 - 3.35 (m, 1H), 3.05 (dd, J = 13.9, 10.2 Hz, 1H). UPLC-MS (acidic, 6 mm): Rt = 1.36 min; m/z = 509.2 for [M+H]+

Example 61: Exemplary synthesis of Compound 234

[0001247] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001248] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (21.00 g, 72.3 mmol, 1.0 eq.) in toluene (420 mL) were added 2- aminothiophenol (8.5 mL, 79.6 mmol, 1.1 eq.), T3P (32 mL, 54.3 mmol, 0.8 eq.) and DIPEA (19 mL, 109 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min, then at 115 °C for 6 h. The reaction mixture was cooled to RT and stirred for 16.5 h. The reaction mixture was re- dosed with T3P (19 mL, 32.6 mmol, 0.5 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction mixture was quenched via the addition of saturated aqueous Na ₂ CO ₃ solution (250 mL) and stirred for 20 min. The phases were separated, and the organics were extracted using EtOAc (3 x 250 mL), combined, washed with saturated brine solution (250 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography eluting with 0-20% EtOAc in DCM to afford tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e as an off-white solid (9.70 g, 25.6 mmol, 35% yield). 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (dt, J = 8.0, 1.0 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.81 (d, J = 1.9 Hz, 1H), 7.71 (dd, J = 7.7, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.17 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.25 mm; m/z = 380.1 for [M+H]+

[0001249] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001250] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (14.60 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10 mL) was added 4 N HC1 in 1,4-dioxane solution (150 mL, 600 mmol, 15.6 eq.) and the reaction mixture was stirred at RT for 4 h. The reaction mixture was concentrated to dryness to afford 3-[2-amino-2- (l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydrochloride as an off-white solid (14.00 g, 39.5 mmol, 103% yield), which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.03 min; m/z = 280.0 for [M+H]+

[0001251] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001252] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (5.00 g, 14.1 mmol, 1.0 eq.) in DMF (50 mL) cooled to 0 °C was added triethylamine (6.9 mL, 49.3 mmol, 3.5 eq.) and the resultant solution was stirred for 10 min. To the cooled solution was added 3 -nitrobenzenesulfonyl chloride (3.75 g, 16.9 mmol, 1.2 eq.) portionwise over 10-15 min. The reaction mixture was then gently warmed to RT and stirred for 4 h. The organics were extracted into EtOAc (250 mL), washed with saturated brine solution (250 mL), aqueous Na ₂ CO ₃ solution (250 mL), and brine again (250 mL). The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was triturated with DCM (25 mL) and filtered under vacuum to afford N-[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]-3-nitro-benzenesulfonamide as an off-white solid (4.42 g, 9.31 mmol, 66 % yield), which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.35 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.88 (dddd, J = 7.8, 4.5, 1.6, 0.8 Hz, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.59 (t, J = 8.0 Hz, 1H), 7.55 (dt, J = 7.9, 1.4 Hz, 1H), 7.50 (ddd, J = 8.2, 7.2, 1.4 Hz, 1H), 7.47 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.17 (d, J = 9.9 Hz, 1H), 3.41 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min): Rt = 1.14 min; m/z = 465.1 for [M+H]+

[0001253] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001254] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-nitro-benzenesulfonamide (4.42 g, 9.31 mmol, 1.0 eq.) in ethanol (45 mL) and water (23 mL) were added ammonium chloride (2.49 g, 46.6 mmol, 5.0 eq.) and iron (5.20 g, 93.1 mmol, 10.0 eq.). The reaction mixture was heated to 85 °C and stirred for 24 h. The reaction mixture was then cooled to RT and filtered through a plug of celite under vacuum, washing with copious EtOH. The filtrate was concentrated to dryness to afford 3-amino-N-[l-(l,3- benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]benzenesulfonamide as a white solid (2.61 g, 5.53 mmol, 59% yield), which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.71 (s, 1H), 8.11 - 8.06 (m, 1H), 7.97 - 7.93 (m, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 (tt, J = 6.7, 1.2 Hz, 2H), 7.51 - 7.48 (m, 1H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.0 Hz, 1H), 6.61 - 6.56 (m, 2H), 5.40 (s, 2H), 4.90 (dd, J = 9.9, 4.9 Hz, 1H), 3.38 (d, J = 4.9 Hz, 1H), 2.99 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 min): Rt = 1.06 min; m/z = 435.1 for [M+H]+

[0001255] Step 5: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] sulfamoyl] aniline] -2-oxo-ethyl] carbamate

[0001256] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (0.500 g, 1.15 mmol, 1.0 eq.) in DMF (5 mb) were added N-alpha-t-BOC-glycine (0.241 g, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 5.5 h. The reaction mixture was then diluted with EtOAc (50 mL) and washed with saturated brine solution (50 mL), saturated aqueous Na ₂ CO ₃ (50 mL) and brine (50 mL) again. The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 10-70% EtOAc in iso-hexane. Co-elution of the starting material and the product was observed. The product- containing fractions were concentrated to dryness and purified by reverse phase column chromatography (45 g cartridge) eluting with 35-60% MeCN (0.1% NH ₃ ) in water (0.1% NH ₃ ) to afford tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate as an off-white solid (0.276 g, 0.387 mmol, 34% yield). 1H NMR (400 MHz, DMSO-d6) 5 10.06 (s, 1H), 9.00 (s, 1H), 8.09 (d, J = 7.9 Hz, 1H), 7.94 (d, J = 8.2 Hz, 1H), 7.79 (s, 1H), 7.56 - 7.39 (m, 7H), 7.28 (t, J = 7.7 Hz, 1H), 7.21 (t, J = 7.9 Hz, 1H), 7.16 - 7.08 (m, 2H), 4.91 (s, 1H), 3.74 (d, J = 6.1 Hz, 2H), 3.38 (s, 1H), 2.97 (dd, J = 13.8, 10.7 Hz, 1H), 1.42 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.13 mm; m/z = 592.1 [M+H]+

[0001257] Step 6: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]anilino]-2-oxo-e thyl]carbamate

[0001258] To a magnetically stirred solution of tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbam ate (0.280 g, 0.387 mmol, 1.0 eq.) in EtOH (6 mL) were added hydroxylamine hydrochloride (0.054 g, 0.774 mmol, 2.0 eq.) and DIPEA (0.20 mL, 1.16 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 24 h. Lurther hydroxylamine hydrochloride (0.027 g, 0.387 mmol, 1.0 eq.) was added and the reaction mixture was stirred under reflux for a further 4.5 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2- yl)-2-[3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]ani lino]-2-oxo-ethyl]carbamate as a brown oil (0.535 g, 0.856 mmol, assumed quantitative yield), which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 625.1 for [M+H] ⁺

[0001259] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]ethyl] phenyl]methylene]amino] acetate

[0001260] To a magnetically stirred solution of tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)- 2-[3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]anilino ]-2-oxo-ethyl]carbamate (0.535 g, 0.856 mmol, 1.0 eq.) in acetic acid (10 mL) was added acetic anhydride (0.24 mL, 2.57 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 2.5 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 30-100% EtOAc in iso-hexane to afford [[amino-[3-[2-(l,3- benzothiazol-2-yl)-2- [ [3 - [ [2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]ethyl] phenyl]methylene]amino] acetate as a white solid (0.145 g, 0.211 mmol, 25% yield). 1H NMR (400 MHz, DMSO-d6) 5 10.00 (s, 1H), 8.93 (s, 1H), 8.05 (d, J = 8.0 Hz, 1H), 7.92 (d, J = 8.1 Hz, 1H), 7.88 (s, 1H), 7.55 (s, 1H), 7.53 - 7.45 (m, 2H), 7.41 (t, J = 7.9 Hz, 2H), 7.21 (d, J = 7.6 Hz, 1H), 7.11 (dq, J = 12.9, 7.2 Hz, 4H), 6.69 (s, 2H), 4.92 (s, 1H), 3.71 (d, J = 6.2 Hz, 2H), 3.28 (d, J = 5.3 Hz, 1H), 3.04 - 2.93 (m, 1H), 2.14 (d, J = 5.8 Hz, 3H), 1.41 (s, 7H). UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 667.2 for [M+H] ⁺

[0001261] Step 8: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]car bamate

[0001262] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- [[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]ethyl] phenyl]methylene]amino] acetate (0.145 g, 0.217 mmol, 1.0 eq.) in acetic acid (3 mL) was added zinc (0.284 g, 4.35 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 16.5 h. Lurther zinc (0.284 g, 4.35 mmol, 20.0 eq.) was added and the reaction mixture was stirred at RT for a further 23 h. The reaction mixture was filtered and washed with acetic acid (2 mL). The residue was stirred with zinc (0.284 g, 4.35 mmol. 20.0 eq.) at RT for 20 h. The reaction mixture was filtered, washed with copious MeCN and concentrated to dryness. The residue was sent to Reach for chiral purification via SFC (Lux C421.2 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (+0.2% v/v NH ₃ ) to afford tert-butyl N- [2-oxo-2- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]anilino]ethyl]carbamate as a white solid (0.021 g, 0.0345 mmol, 13% yield). UPLC-MS (basic 2.5 min): Rt = 1.05 min; m/z = 609.2 for [M+H] ⁺

[0001263] Step 9: 2-amino-N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]acetamide dihydrochloride

[0001264] To tert-butyl N-[2-oxo-2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]ethyl]carbamate (0.0190 g, 0.0311 mmol, 1.0 eq.) was added 4 N HC1 in 1,4-dioxane solution (2.0 mL, 8.00 mmol, 257 eq.) and the reaction mixture was stirred at RT for 4 h. The reaction mixture was concentrated to dryness, re- suspended in water and concentrated to dryness again before being dried in a vacuum oven overnight to afford 2-amino-N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]acetamide as an off-white solid (0.0120 g, 0.0236 mmol, 76% yield). 1H NMR (400 MHz, DMSO-d6) 5 10.69 (s, 1H), 9.21 (s, 2H), 9.02 (s, 2H), 9.00 (s, 1H), 8.20 (s, 3H), 8.08 (dt, J = 7.6, 1.1 Hz, 1H), 7.96 - 7.90 (m, 1H), 7.88 (d, J = 2.1 Hz, 1H), 7.72 (s, 1H), 7.57 (d, J = 7.9 Hz, 1H), 7.54 - 7.47 (m, 3H), 7.47 - 7.40 (m, 1H), 7.30 (t, J = 7.7 Hz, 1H), 7.17 (t, J = 7.7 Hz, 1H), 7.14 - 7.09 (m, 1H), 5.08 - 4.97 (m, 1H), 3.82 (d, J = 5.8 Hz, 2H), 3.44 - 3.35 (m, 1H), 3.05 (dd, J = 13.9, 10.2 Hz, 1H). UPLC-MS (acidic, 6 mm): Rt = 1.35 min; m/z = 509.2 for [M+H]+

Example 62: Exemplary synthesis of Compound 235

[0001265] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001266] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (21.0 g, 72.3 mmol, 1.0 eq.) in toluene (420 mL) were added DIPEA (19.0 mL, 109.0 mmol, 1.5 eq.), 2-aminothiophenol (8.5 mL, 79.6 mmol, 1.1 eq.) and T3P (32.0 mL, 54.3 mmol, 0.75 eq.). The resulting mixture was stirred at reflux for 6 h before being cooled to RT. After 16.5 h, further T3P (19.0 mL, 32.6 mmol, 0.45 eq.) was added and the mixture was stirred at reflux for 2.5 h. The reaction mixture was cooled to RT, quenched with saturated sodium hydrogen carbonate solution (250 mL) and stirred for 20 minutes. The phases were separated and the organics were extracted into EtOAc (3 x 250 mL), washed with brine (250 mL), dried over anhydrous sodium sulfate filtered and concentrated to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-20% EtOAc in DCM to afford product (9.70 g, 25.6 mmol, 35% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (dt, J = 8.0, 1.0 Hz, 1H), 7.91 (d, J = 8.8

Hz, 1H), 7.81 (d, J = 1.9 Hz, 1H), 7.71 (dd, J = 7.7, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.17 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 min) Rt = 1.25 min. m/z = 380.1 for [M+H] ⁺

[0001267] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile; hydrochloride

[0001268] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (14.6 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10.0 mL) was added 4 N HC1 in 1,4-dioxane (150.0 mL, 600 mmol, 15.6 eq.) was stirred at RT for 4 h. The reaction mixture was concentrated to dryness to afford product (14.0 g, 39.5 mmol, quantitative yield assumed) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 280.0 for [M+H] ⁺

[0001269] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001270] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (5.00 g, 14.1 mmol, 1.0 eq.) in DMF (50.0 mL) was added triethylamine (6.9 mL, 49.3 mmol, 3.5 eq.) and the reaction mixture was cooled to 0 °C for 10 min. 3 -nitrobenzene-1-sulfonyl chloride (3.75 g, 16.9 mmol, 1.2 eq.) was added portion-wise at 0°C over 10 min and the reaction mixture was stirred at this temperature for a further 10 min before being allowed to warm to RT for 1 h. The reaction was extracted into EtOAc (250 mL), washed with brine (250 mL), aq. saturated Na ₂ CO ₃ (250 mL) and brine (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated to dryness. The residue was triturated with DCM and filtered under vacuum to afford the product (4.42 g, 9.31 mmol, 66% yield) as an off- white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.35 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.88 (dddd, J = 7.8, 4.5, 1.6, 0.8 Hz, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.59 (t, J = 8.0 Hz, 1H), 7.55 (dt, J = 7.9, 1.4 Hz, 1H), 7.50 (ddd, J = 8.2, 7.2, 1.4 Hz, 1H), 7.47 - 7.40 (m,

2H), 7.24 (t, J = 7.8 Hz, 1H), 5.17 (d, J = 9.9 Hz, 1H), 3.41 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.14 min. m/z = 465.1 for [M+H] ⁺

[0001271] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001272] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-nitro-benzenesulfonamide (4.42 g, 9.31 mmol, 1.0 eq.) in ethanol (45.0 mb) and water (23.0 mL) was added iron (5.20 g, 93.1 mmol, 10.0 eq.) and ammonium chloride (2.49 g, 46.6 mmol, 5.0 eq.). The reaction mixture was heated to 85 °C under nitrogen and stirred for 18 h. The reaction mixture was then cooled to RT and filtered through a plug of Celite, washing with copious EtOH. The filtrate was concentrated to dryness and the residue taken up in DCM (50 mL). The organic layer was washed with aq. saturated Na ₂ CO ₃ solution (50 mL) and the aqueous was extracted with further DCM (2 x 40 mL). The combined organics were then washed with brine (50 mL), dried over anhydrous sodium sulfate, filtered and concentrated to dryness to afford product (2.61 g, 5.53 mmol, 59%) as a white solid which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.71 (s, 1H), 8.11 - 8.06 (m, 1H), 7.97 - 7.93 (m, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 (tt, J = 6.7, 1.2 Hz, 2H), 7.51 - 7.48 (m, 1H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.0 Hz, 1H), 6.61 - 6.56 (m, 2H), 5.40 (s, 2H), 4.90 (dd, J = 9.9, 4.9 Hz, 1H), 3.38 (d, J = 4.9 Hz, 1H), 2.99 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.07 mm. m/z = 435.1 for [M+H] ⁺

[0001273] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl] phenyl]acetamide

[0001274] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.06 mmol, 1.0 eq.) in acetic acid (5.0 mL) was added

[0001275] acetic anhydride (0.30 mL, 3.18 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 17 h. The reaction mixture was concentrated to dryness to afford the product N-[3-[[l- (l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamoyl]phe nyl]acetamide (379 mg, 0.748 mmol, 71% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.01 (s, 1H), 8.06 (ddd, J = 7.9, 1.4, 0.6 Hz, 1H), 7.96 - 7.86 (m, 1H), 7.77 (t, J = 2.0 Hz, 1H), 7.53 (t, J = 1.7 Hz, 1H), 7.50 - 7.45 (m, 2H), 7.45 - 7.38 (m, 3H), 7.17 (td, J = 7.8, 3.9 Hz, 2H), 7.08 (ddd, J = 7.8, 1.9, 1.1 Hz, 1H), 4.88 (dd, J = 10.7, 4.3 Hz, 1H), 3.36 (d, J = 4.4 Hz, 1H), 2.93 (dd, J = 13.8, 10.7 Hz, 1H), 2.03 (s, 3H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 477.0 for [M+H] ⁺

[0001276] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl] phenyl]acetamide

[0001277] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]acetamide (379 mg, 0.795 mmol, 1.0 eq.) in EtOH (4.0 mL) was added hydroxylamine hydrochloride (111 mg, 1.59 mmol, 2.0 eq.) and DIPEA (0.42 mL, 2.39 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 17 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (0.698 g, 0.44 mmol, 81% yield) as an orange oil which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.92 min. m/z = 510.0 for [M+H] ⁺

[0001278] Step 7: [[[3-[2-[(3-acetamidophenyl)sulfonylamino]-2-(l,3-benzothiaz ol-2- yl)ethyl]phenyl]-amino-methylene]amino] acetate

[0001279] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]acetamide (698 mg, 0.644 mmol, 1.0 eq.) in acetic acid (7.0 mL) was added acetic anhydride (0.31 mL, 3.22 mmol, 5.0 eq.) and the resulting mixture was stirred at RT for 48 h. Additional acetic anhydride was added (0.31 mL, 3.22 mmol, 5.0 eq.) and the reaction was left to stir for 48 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 0-100% EtOAc in hexane to afford product (0.114g, 0.222 mmol, 34% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.93 (s, 1H), 8.87 (s, 1H), 8.01

(ddd, J = 7.9, 1.3, 0.7 Hz, 1H), 7.87 (dt, J = 8.1, 1.2 Hz, 1H), 7.79 (t, J = 1.9 Hz, 1H), 7.54 - 7.52 (m, 1H), 7.47 - 7.42 (m, 2H), 7.42 - 7.37 (m, 2H), 7.18 - 7.13 (m, 1H), 7.12 - 7.04 (m, 3H), 6.67 (s, 2H), 4.87 (s, 1H), 3.27 - 3.21 (m, 1H), 2.96 (dd, J = 13.8, 9.6 Hz, 1H), 2.11 (s, 3H), 1.99 (s, 3H). UPLC-MS (basic 2 min): Rt = 0.96 min; m/z = 552.0 for [M+H] ⁺

[0001280] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylphenyl)et hyl] sulfamoyl]phenyl]acetamide

[0001281] To a magnetically stirred solution of [[[3-[2-[(3-acetamidophenyl)sulfonylamino]-2- (l,3-benzothiazol-2-yl)ethyl]phenyl]-amino-methylene]amino] acetate (0.144 g, 0.222 mmol, 1.0 eq.) in acetic acid (2.0 mL) was added zinc (0.435 g, 6.66 mmol, 30.0 eq.). The reaction mixture was stirred at room temperature for 18 h. The reaction mixture was filtered, washing with acetonitrile, ethanol and DCM and concentrated to dryness. The residue was sent to Reach for purification via reverse phase preparative HPLC on a XSelect CSH C18 (30mm x 150mm, 5um) eluting with 5-100% MeCN in H ₂ O (+0.2% v/v NH ₃ ). This afforded the desired product (15.0 mg, 0.030 mmol, 14% yield) as a white solid. UPLC-MS (basic 4 min): Rt = 0.99 min; m/z = 494.4 for [M+H] ⁺ , 99% purity. 1H NMR (400 MHz, DMSO-d6) 5 9.98 (s, 1H), 7.97 - 7.93 (m, 1H), 7.84 - 7.80 (m, 1H), 7.70 (s, 1H), 7.58 (s, 1H), 7.50 - 7.45 (m, 1H), 7.44 - 7.38 (m, 2H), 7.34 - 7.29 (m, 1H), 7.19 - 7.15 (m, 1H), 7.11 - 7.05 (m, 3H), 4.80 - 4.73 (m, 1H), 2.95 (dd, J = 13.5, 8.6 Hz, 1H), 1.99 (s, 3H).

Example 63: Exemplary synthesis of Compound 236

[0001282] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001283] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (21.0 g, 72.3 mmol, 1.0 eq.) in toluene (420 mL) were added 2- aminothiophenol (8.5 mL, 79.6 mmol, 1.1 eq.), T3P (32.0 mL, 54.3 mmol, 0.8 eq.) and DIPEA (19.0 mL, 109 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min, then at 115 °C for 6 h. The reaction mixture was cooled to RT and stirred for 16.5 h. The reaction mixture was re-dosed with T3P (19.0 mL, 32.6 mmol, 0.5 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction mixture was quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and stirred for 20 min. The phases were separated, and the organics were extracted using EtOAc (3 x 250 mL), combined, washed with brine (250 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-20% EtOAc in DCM to afford the product (9.70 g, 25.6 mmol, 35% yield) as an off-white solid. 1H NMR (400 MHz, DMSO- d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (dt, J = 8.0, 1.0 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.81 (d, J =

I.9 Hz, 1H), 7.71 (dd, J = 7.7, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.17 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8,

I I.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.25 mm; m/z = 380.1 for [M+H]+

[0001284] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001285] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (14.6 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10 mL) was added 4 N HC1 in 1,4-dioxane (150 mL, 600 mmol, 15.6 eq.) and the resultant solution was stirred at RT for 4 h. The reaction mixture was then concentrated to dryness to afford the product (14.0 g, 39.5 mmol, assumed quantitative yield) as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). - residual 1,4-dioxane present (9% wt.). UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.0 for [M+H]+

[0001286] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001287] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (5.00 g, 14.1 mmol, 1.0 eq.) in DMF (50 mL), cooled to 0 °C, was added triethylamine (6.9 mL, 49.3 mmol, 3.5 eq.) and the resultant solution was stirred for 10 min. To the cooled solution was added 3 -nitrobenzenesulfonyl chloride (3.75 g, 16.9 mmol, 1.2 eq.) portionwise over 10-15 min. The resultant mixture was then gently warmed to RT and stirred for 4 h. The organics were then extracted into EtOAc (250 mL), washed with brine (250 mL), aq. saturated Na ₂ CO ₃ (250 mL), and brine again (250 mL). The organics were then dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was triturated with DCM (25 mL) and filtered under vacuum to afford the product (4.42 g, 9.31 mmol, 66% yield) as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.35 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.88 (dddd, J = 7.8, 4.5, 1.6, 0.8 Hz, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.59 (t, J = 8.0 Hz, 1H), 7.55 (dt, J = 7.9, 1.4 Hz, 1H), 7.50 (ddd, J = 8.2, 7.2, 1.4 Hz, 1H), 7.47 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.17 (d, J = 9.9 Hz, 1H), 3.41 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.14 mm; m/z = 465.1 for [M+H]+

[0001288] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001289] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-nitro-benzenesulfonamide (4.42 g, 9.31 mmol, 1.0 eq.) in ethanol (45 mL) and water (23 mL) were added ammonium chloride (2.49 g, 46.6 mmol, 5.0 eq.) and iron (5.20 g, 93.1 mmol, 10.0 eq.). The reaction mixture was heated to 85 °C and stirred for 24 h. The reaction mixture was then cooled to RT and filtered through a plug of Celite under vacuum, washing with copious EtOH. The filtrate was concentrated to dryness to afford the product (2.61 g, 5.53 mmol, 59% yield) as a white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.71 (s, 1H), 8.11 - 8.06 (m, 1H), 7.97 - 7.93 (m, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 (tt, J = 6.7, 1.2 Hz, 2H), 7.51 - 7.48 (m, 1H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.0 Hz, 1H), 6.61 - 6.56 (m, 2H), 5.40 (s, 2H), 4.90 (dd, J = 9.9, 4.9 Hz, 1H), 3.38 (d, J = 4.9 Hz, 1H), 2.99 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.06 mm; m/z = 435.1 for [M+H]+

[0001290] Step 5: tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidine-1-ca rboxylate

[0001291] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (0.500 g, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added l-tert-Butoxycarbonylpiperidine-4-carboxylic acid (0.317 g, 1.38 mmol, 1.2 eq.), DIPEA (0.6 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 46.5 h. The reaction mixture was re-dosed with 1-tert-

Butoxycarbonylpiperidine-4-carboxylic acid (0.317 g, 1.38 mmol, 1.2 eq.), DIPEA (0.6 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and stirred at RT for 6 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25 mL) again. The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was dissolved in DMF (5 mL) and re-dosed with l-tert-Butoxycarbonylpiperidine-4-carboxylic acid (0.317 g, 1.38 mmol, 1.2 eq.), DIPEA (0.6 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and stirred at RT for 18 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25 mL) again. The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with a gradient of 20-80% EtOAc in iso-hexane to afford the product (0.560 g, 0.870 mmol, 76% yield) as a brown oil. 1H NMR (400 MHz, DMSO-d6) 5 10.04 (s, 1H), 8.95 (d, J = 8.3 Hz, 1H), 8.10 (dt, J = 7.8, 0.8 Hz, 1H), 7.98 - 7.91 (m, 1H), 7.85 (t, J = 2.0 Hz, 1H), 7.58 - 7.52 (m, 2H), 7.52 - 7.47 (m, 2H), 7.47 - 7.45 (m, 1H), 7.45 - 7.43 (m, 1H), 7.42 (dt, J = 2.8, 1.3 Hz, 1H), 7.21 (t, J = 7.8 Hz, 2H), 7.12 (dt, J = 8.1, 1.3 Hz, 1H), 4.93 (ddd, J = 10.7, 8.2, 4.4 Hz, 1H), 3.38 (dd, J = 13.9, 4.3 Hz, 1H), 2.97 (dd, J = 13.9, 10.7 Hz, 1H), 2.79 (s, 3H), 1.87 - 1.73 (m, 3H), 1.51 (d, J = 12.2 Hz, 1H), 1.42 (s, 8H). UPLC- MS (basic 2 min): Rt = 1.20 min; m/z = 644.2 [M-H]-

[0001292] Step 6: tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]carbamoyl ]piperidine-1-carboxylate

[0001293] To a magnetically stirred solution of tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2- (3-cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidine-1 -carboxylate (0.560 g, 0.870 mmol, 1.0 eq.) in EtOH (11 mL) were added hydroxylamine hydrochloride (120 mg, 1.74 mmol, 2.0 eq.) and DIPEA (0.5 mL, 2.61 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 17.5 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (0.790 g, 1.16 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.09 min; m/z = 679.2 for [M+H] ⁺

[0001294] Step 7: tert-butyl 4-[[3-[[2-[3-[(E)-N'-acetoxycarbamimidoyl]phenyl]-l-(l,3- benzothiazol-2-yl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidin e-1-carboxylate

[0001295] To a magnetically stirred solution of tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2- [3-[(E)-N'-hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]pheny l]carbamoyl]piperidine-l- carboxylate (0.790g, 1.16 mmol, 1.0 eq.) in acetic acid (16 mL) was added acetic anhydride (0.30 mL, 3.49 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 19 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 20-80% EtOAc in iso-hexane to afford the product (0.261 g, 0.362 mmol, 31% yield) as a colourless glass. 1H NMR (400 MHz, DMSO-d6) 5 9.96 (d, J = 2.7 Hz, 1H), 8.91 (s, 1H), 8.08 - 8.01 (m, 1H), 7.91 (dd, J = 7.9, 2.4 Hz, 1H), 7.85 (q, J = 1.9 Hz, 1H), 7.55 (d, J = 3.0 Hz, 1H), 7.54 - 7.44 (m, 2H), 7.44 - 7.38 (m, 2H), 7.19 (t, J = 5.4 Hz, 1H), 7.17 - 7.02 (m, 3H), 6.73 - 6.69 (m, 2H), 4.90 (s, 1H), 4.08 - 3.89 (m, 1H), 3.27 (s, 1H), 2.99 (t, J = 11.9 Hz, 1H), 2.77 (s, 2H), 2.47 - 2.41 (m, 1H), 2.18 - 2.12 (m, 3H), 1.78 (d, J = 13.0 Hz, 2H), 1.47 (d, J = 12.6 Hz, 2H), 1.43 - 1.36 (m, 9H), 1.23 (s, 1H). UPLC-MS (basic 2 min): Rt = 1.12 min; m/z = 721.3 for [M+H] ⁺

[0001296] Step 8: tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperid ine-1-carboxylate

[0001297] To a magnetically stirred solution of 4-[[3-[[2-[3-[(E)-N'- acetoxycarbamimidoyl]phenyl]-l-(l,3-benzothiazol-2- yl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidine-l-carboxylate (0.261 g, 0.362 mmol, 1.0 eq.) in acetic acid (5 mL) was added zinc (0.473 g, 7.24 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 40.5 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was then submitted to Reach for chiral purification via SEC on a Lux C4 (21.2mm x 250mm, 5um), eluting with 50:50 EtOH:CO ₂ (+0.2% v/v NH ₃ ) to afford the 1 ^st eluting enantiomer (0.0228 g, 0.0341 mmol, 9% yield) as a white solid and the 2 ^nd eluting enantiomer (0.0217 g, 0.0324 mmol, 8% yield) as a white solid. 5.00 mg of each enantiomer were combined, dissolved in MeCN/FUO, concentrated to dryness and dried in a vacuum oven to afford product (10.0 mg, 0.0150 mmol, 4% yield) as a white solid. UPLC-MS (acidic 2.5 min): Rt = 1.26 min; m/z = 663.2 for [M+H] ⁺

[0001298] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]piperidine-4-carb oxamide

[0001299] To tert-butyl 4-[[3-l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperid ine-1-carboxylate (10.0 mg, 0.0150 mmol, 1.0 eq.) was added 4 N HC1 in 1,4-dioxane solution (1.0 mL, 4.00 mmol, 268 eq.) and the reaction mixture was stirred at RT for 3 h. The reaction mixture was concentrated to dryness, resuspended in water, and concentrated to dryness again to afford the product (12.0 mg, 0.0211 mmol, assumed quantitative yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.24 (s, 1H), 9.23 (s, 2H), 9.07 (s, 2H), 8.93 (d, J = 8.1 Hz, 1H), 8.84 (s, 1H), 8.57 (s, 1H), 8.11 - 8.04 (m, 1H), 7.95 - 7.88 (m, 2H), 7.72 (s, 1H), 7.58 - 7.39 (m, 5H), 7.24 (t, J = 7.8 Hz, 1H), 7.20 - 7.09 (m, 2H), 5.06 - 4.96 (m, 1H), 3.36 - 3.24 (m, 1H), 3.04 (dd, J = 13.8, 10.1 Hz, 1H), 2.95 (d, J = 10.2 Hz, 2H), 1.99 (d, J = 14.0 Hz, 2H), 1.84 (t, J = 12.3 Hz, 2H). UPLC-MS (acidic 6 min): Rt = 1.47 min; m/z = 563.3 for [M+H] ⁺ , 99% purity.

Example 64: Exemplary synthesis of Compound 237

[0001300] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001301] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (9.30 g, 27.6 mmol, 1.0 eq.) in toluene (162 mL) were added T3P (16.0 mL, 27.6 mmol, 1.0 eq.), 2-amino-5-methoxy-benzenethiol (4.71 g, 30.3 mmol, 1.1 eq.), and DIPEA (14.0 mL, 82.7 mmol, 3.0 eq.). The resulting mixture was stirred at RT for 30 min, then at 110 °C for 2 h. The reaction mixture was cooled to RT, quenched via the addition of 10% (w/v) aq. citric acid (100 mL) and stirred for 30 min. The phases were separated, and the organics were washed with aq. saturated Na ₂ CO ₃ (200 mL) and brine (200 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in heptane to afford the product (5.25 g, 12.8 mmol, 47% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.22 mm; m/z =410.0 for [M+H]+

[0001302] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride

[0001303] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (5.25 g, 12.8 mmol, 1.0 eq.) in DCM (50 mb) was added trifluoroacetic acid (50.0 mL, 653 mmol, 51.0 eq.) and the resultant solution was stirred at RT for 1 h. The reaction mixture was concentrated to dryness. The residue was suspended in DCM (50 mL) and to it was added K ₂ CO ₃ (12.3 g) in water (50 mL) portionwise over 10 min. The reaction mixture was stirred at RT for 30 min. The phases were separated, and the organics were extracted with DCM (3 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was suspended in DCM (20 mL), and to it was added K ₂ CO ₃ (7.80 g) in water (20 mL) and the resultant mixture was stirred at RT for 2 h. The phases were separated, and the organics were extracted with DCM (3 x 20 mL) and dried over anhydrous sodium sulfate before being filtered and concentrated to dryness to afford the product (3.97 g, 12.1 mmol, 94% yield) as a brown oil, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 7.83 - 7.72 (m, 2H), 7.67 (d, J = 7.8 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.09 - 7.02 (m, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.2 Hz, 3H), 3.37 (dd, J = 13.6, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). - 6% DCM by weight. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 309.9 for [M+H]+

[0001304] 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile (2.49 g, 7.57 mmol) was suspended in 4 N HC1 in 1,4-dioxane (10.0 mL, 40.0 mmol, 5.3 eq.) and the suspension was stirred at RT for 2 h. The reaction mixture was then triturated with diethyl ether (30 mL), before filtering and rinsing with copious diethyl ether to afford the product (2.11 g, 5.19 mmol, 69% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.01 (s, 3H), 7.93 (d, J = 9.0 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.75 (dt, J = 7.6, 1.4 Hz, 1H), 7.72 (d, J = 2.6 Hz, 1H), 7.58 (dt, J = 8.0, 1.5 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 7.15 (dd, J = 9.0, 2.6 Hz, 1H), 5.27 (s, 1H), 3.83 (s, 3H), 3.50 (dd, J = 13.9, 6.1 Hz, 1H), 3.43 - 3.30 (m, 1H). UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 310.0 for [M+H]+

[0001305] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-oxo-4H- 1 ,4-benzoxazine-6-sulfonamide

[0001306] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (600 mg, 1.73 mmol, 1.0 eq.) in DMF (12 mL) was added triethylamine (0.73 mL, 5.20 mmol, 3.0 eq.) and the resultant mixture was cooled to 0 °C. 3-oxo-4H-l,4- benzoxazine-6-sulfonyl chloride (516 mg, 2.08 mmol, 1.2 eq.) was added portionwise over 10 min, and the reaction mixture was allowed to gradually warm to RT for 4 h. The reaction was then quenched via the addition of water (50 mL) and diluted with ethyl acetate (75 mL). After separation of the phases, the organic was washed with saturated aqueous Na ₂ CO ₃ solution (50 mL) and brine (50 mL). The organics were then dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude was then dissolved in the minimum amount of DCM and upon addition of iso-hexane, a precipitate formed. The solid was collected and dried in air to afford the product (229 mg, 0.442 mmol, 25% yield) as a beige solid. (400 MHz, DMSO-d6) 5 10.77 (s, 1H), 8.85 (s, 1H), 7.80 (dd, J = 9.0, 4.4 Hz, 1H), 7.65 (s, 1H), 7.60 (s, 1H), 7.55 (d, J = 7.9 Hz, 2H), 7.36 - 7.29 (m, 1H), 7.08 (d, J = 9.0 Hz, 1H), 6.97 (d, J = 5.9 Hz, 1H), 6.92 (s, 1H), 6.74 (dd, J = 8.4, 4.5 Hz, 1H), 4.86 (s, 1H), 4.66 - 4.51 (m, 2H), 3.82 (d, J = 4.3 Hz, 3H), 2.98 (t, J = 13.2 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.02 mm; m/z = 521.2 for [M+H] ⁺

[0001307] Step 4: N'-hydroxy-3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(3-oxo- 4H-l,4- benzoxazin-6-yl)sulfonylamino]ethyl]benzamidine

[0001308] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-oxo-4H-l,4-benzoxazine-6-sulfonam ide (229 mg, 0.440 mmol, 1.0 eq.) in ethanol (4 mL) was added hydroxylammonium chloride (61.1 mg, 0.880 mmol, 2.0 eq.) and DIPEA (0.23 mL, 1.32, 3.0 eq.) with the resultant mixture heated to 85 °C for 18 h. The mixture was cooled to RT and concentrated to dryness under reduced pressure to afford the product (414 mg, 0.748 mmol, assumed quantitative yield) as a pale yellow solid which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.94 min; m/z = 554.2 for [M+H] ⁺

[0001309] Step 5: [(E)-[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(3-ox o-4H-l,4- benzoxazin-6-yl)sulfonylamino]ethyl]phenyl]methylene]amino] acetate

[0001310] To a magnetically stirred solution of N'-hydroxy-3-[2-(6-methoxy-l,3-benzothiazol- 2-yl)-2-[(3-oxo-4H-l,4-benzoxazin-6-yl)sulfonylamino]ethyl]b enzamidine (243 mg, 0.439 mmol, 1.0 eq.) in acetic acid (5 mL) was added acetic anhydride (0.12 mL, 1.32 mmol, 3.0 eq.) and the resultant mixture was stirred at RT for 18 h. The reaction mixture was concentrated before the residue was purified by normal phase column chromatography (20 g cartridge) eluting with a gradient of 0-75% EtOAc in DCM followed by 75% EtOAc in 4: 1 DCM:MeOH, to afford the product (116 mg, 0.195 mmol, 44% yield) as a yellow oil. ^! H NMR (400 MHz, DMSO-d6) 5 10.67 (s, 1H), 8.80 (s, 1H), 7.77 (t, J = 8.6 Hz, 1H), 7.60 (t, J = 7.7 Hz, 2H), 7.48 (s, 1H), 7.29 - 7.17 (m, 2H), 7.06 (s, 1H), 7.01 - 6.93 (m, 2H), 6.71 (d, J = 8.0 Hz, 3H), 4.83 (s, 1H), 4.51 (t, J = 8.2 Hz, 2H), 3.82 (d, J = 8.4 Hz, 3H), 3.02 (s, 1H), 2.15 (d, J = 8.1 Hz, 3H). UPLC-MS (basic 2 min): Rt = 1.01 min; m/z = 596.1 for [M+H] ⁺

[0001311] Step 6: 3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(3-oxo-4H-l,4-benz oxazin-6- yl)sulfonylamino]ethyl]benzamidine

[0001312] To a magnetically stirred solution of [(E)-[amino-[3-[2-(6-methoxy-l,3- benzothiazol-2-yl)-2-[(3-oxo-4H-l,4-benzoxazin-6- yl)sulfonylamino]ethyl]phenyl]methylene]amino] acetate (116 mg, 0.195 mmol, 1.0 eq.) in acetic acid (10 mL) was added zinc (255 mg, 3.89 mmol, 20.0 eq.) and the resultant suspension was stirred at RT for 72 h. The reaction was redosed with zinc (127 mg, 1.95 mmol, 10.0 eq.) three times and stirred at RT for 18 h after each redose. The reaction was redosed a final time with zinc (255 mg, 3.89 mmol, 20.0 eq.) and stirred at RT for 18 h. The reaction mixture was then filtered through Celite, washing with copious acetonitrile, ethanol and DCM before concentrating to dryness. The residue was then submitted to Reach for chiral purification via SFC on a Lux C2 (20 mm x 250 mm, 5 um), eluting with 60:40 MeOH:CO ₂ (0.2% v/v NH ₃ ) to afford the first eluting enantiomer (41.3 mg, 0.0768 mmol, 40% yield) as a white solid and the second eluting enantiomer (33.5 mg, 0.0623 mmol, 32% yield) as a white solid. Each enantiomer was suspended in 4 N HC1 in 1,4-dioxane (1.0 mL, 0.0768 mmol, 1.0 eq.), stirred for 1 h and concentrated in vacuo. This process was repeated twice more before the residue was dissolved in MeCN/water, concentrated again and dried in a vacuum oven. 5 mg of each enantiomer were combined, dissolved in MeCN/water, concentrated and dried in a vacuum oven to afford the racemic product as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 10.72 (s, 1H), 9.19 (s, 2H), 8.87 (s, 2H), 8.77 (d, J = 8.2 Hz, 1H), 7.76 (d, J = 8.9 Hz, 2H), 7.63 - 7.57 (m, 2H), 7.50 (d, J = 7.6 Hz, 1H), 7.38 (t, J = 7.7 Hz, 1H), 7.07 (dd, J = 8.9, 2.6 Hz, 1H), 6.97 (d, J = 7.9 Hz, 2H), 6.69 (d, J = 8.1 Hz, 1H), 4.93 (s, 1H), 4.57 - 4.45 (m, 2H), 3.82 (s, 3H), 3.29 (d, J = 5.3 Hz, 1H), 3.10 - 3.02 (m, 1H). UPLC-MS (6 min, acidic): rt = 1.81 min, m/z = 538.1 [M+H] ⁺ , 94% purity.

Example 65: Exemplary synthesis of Compound 238

[0001313] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001314] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (9.30 g, 27.6 mmol, 1.0 eq.) in toluene (162 mL) were added T3P

(16.0 mL, 27.6 mmol, 1.0 eq.), 2-amino-5-methoxy-benzenethiol (4.71 g, 30.3 mmol, 1.1 eq.), and DIPEA (14.0 mL, 82.7 mmol, 3.0 eq.). The resulting mixture was stirred at RT for 30 min, then at 110 °C for 2 h. The reaction mixture was cooled to RT, quenched via the addition of 10% (w/v) aq. citric acid (100 mL) and stirred for 30 min. The phases were separated, and the organics were washed with aq. saturated Na ₂ CO ₃ (200 mL) and brine (200 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in heptane to afford the product (5.25 g, 12.8 mmol, 47% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.22 mm; m/z =410.0 for [M+H]+

[0001315] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride

[0001316] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (5.25 g, 12.8 mmol, 1.0 eq.) in DCM (50 mL) was added trifluoroacetic acid (50.0 mL, 653 mmol, 51.0 eq.) and the resultant solution was stirred at RT for 1 h. The reaction mixture was concentrated to dryness. The residue was suspended in DCM (50 mL) and to it was added K ₂ CO ₃ (12.3 g) in water (50 mL) portionwise over 10 min. The reaction mixture was stirred at RT for 30 min. The phases were separated, and the organics were extracted with DCM (3 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was suspended in DCM (20 mL), and to it was added K ₂ CO ₃ (7.80 g) in water (20 mL) and the resultant mixture was stirred at RT for 2 h. The phases were separated, and the organics were extracted with DCM (3 x 20 mL) and dried over anhydrous sodium sulfate before being filtered and concentrated to dryness to afford the product (3.97 g, 12.1 mmol, 94% yield) as a brown oil, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 7.83 - 7.72 (m, 2H), 7.67 (d, J = 7.8 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.09 - 7.02 (m, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H),

3.82 (d, J = 1.2 Hz, 3H), 3.37 (dd, J = 13.6, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). - 6% DCM by weight. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 309.9 for [M+H]+

[0001317] 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile (2.49 g, 7.57 mmol) was suspended in 4 N HC1 in 1,4-dioxane (10.0 mb, 40.0 mmol, 5.29 eq.) and the suspension was stirred at RT for 2 h. The reaction mixture was then triturated with diethyl ether (30 mL), before filtering and rinsing with copious diethyl ether to afford the product (2.11 g, 5.19 mmol, 69% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.01 (s, 3H), 7.93 (d, J = 9.0 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.75 (dt, J = 7.6, 1.4 Hz, 1H), 7.72 (d, J = 2.6 Hz, 1H), 7.58 (dt, J = 8.0, 1.5 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 7.15 (dd, J = 9.0, 2.6 Hz, 1H), 5.27 (s, 1H), 3.83 (s, 3H), 3.50 (dd, J = 13.9, 6.1 Hz, 1H), 3.43 - 3.30 (m, 1H). UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 310.0 for [M+H]+

[0001318] Step 3 : N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-2-oxo-l,3- dihydrobenzimidazole-5-sulfonamide

[0001319] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (0.500 g, 1.23 mmol, 1.0 eq.) in DMF (5 mL) cooled to 0 °C was added tri ethylamine (0.6 mL, 4.30 mmol, 3.5 eq.) and the resultant solution was stirred for 15 min. To the cooled solution was added 2-oxo-2,3-dihydro-lH-l,3-benzodiazole-5-sulfonyl chloride (0.343 g, 1.47 mmol, 1.2 eq.) portionwise. The resultant mixture was then gently warmed to RT and stirred for 25 h. The reaction mixture was re-dosed with tri ethylamine (0.3 mL, 2.15 mmol, 1.75 eq.), cooled to 0 °C, and stirred for 10 min. 2-Oxo-2,3-dihydro-lH-l,3- benzodiazole-5-sulfonyl chloride (0.172 g, 0.737 mmol, 0.6 eq.) was then added and the reaction mixture was gently warmed to RT and stirred for 5.5 h. The reaction mixture was concentrated to dryness. The residue was diluted with EtOAc (25 mL) and washed with brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25 mL). The organics were then dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was triturated with DCM (ca. 10 mL) and filtered under vacuum. A second crop precipitated from the filtrate, which was filtered under vacuum. The solids were combined to afford the product (0.225 g, 0.352 mmol,

29% yield) as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 10.98 (s, 1H), 10.77 (s, 1H), 8.70 (s, 1H), 7.79 (dd, J = 8.9, 1.9 Hz, 1H), 7.63 (t, J = 2.2 Hz, 1H), 7.51 (s, 1H), 7.47 (d, J = 7.8 Hz, 1H), 7.34 (d, J = 7.7 Hz, 1H), 7.21 (t, J = 7.7 Hz, 1H), 7.09 (td, J = 8.6, 4.5 Hz, 2H), 6.85 (t, J = 1.8 Hz, 1H), 6.75 (dd, J = 8.2, 1.9 Hz, 1H), 4.85 (s, 1H), 3.82 (d, J = 1.8 Hz, 3H), 2.99 - 2.88 (m, 1H) UPLC-MS (basic 2 min): Rt = 0.98 min; m/z = 506.0 for [M+H]+

[0001320] Step 4: N'-hydroxy-3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(2-oxo- l,3- dihydrobenzimidazol-5 -y l)sulfonylamino] ethyl] benzamidine

[0001321] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-2-oxo-l,3-dihydrobenzimidazole-5-su lfonamide (225 mg, 0.352 mmol, 1.0 eq.) in EtOH (5 mL) were added hydroxylamine hydrochloride (49.0 mg, 0.703 mmol, 2.0 eq.) and DIPEA (0.2 mL, 1.05 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 25 h. The reaction mixture was then cooled to RT and stirred for 18 h. The reaction was re-dosed with hydroxylamine hydrochloride (24.0 mg, 0.352 mmol, 1.0 eq.) and DIPEA (0.1 mL, 0.527 mmol, 1.5 eq.) and stirred under reflux for 3 h. The reaction mixture was cooled to RT and concentrated to dryness to afford the product (508 mg, 0.792 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 0.88 min; m/z = 539.1 for [M+H] ⁺

[0001322] Step 5: [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(2-oxo-l, 3- dihydrobenzimidazol-5 -y l)sulfonylamino] ethyl] phenyl] methylene] amino] acetate

[0001323] To a magnetically stirred solution of N'-hydroxy-3-[2-(6-methoxy-l,3-benzothiazol- 2-yl)-2-[(2-oxo-l,3-dihydrobenzimidazol-5-yl)sulfonylamino]e thyl]benzamidine (538 mg, 0.839 mmol, 1.0 eq.) in acetic acid (5 mL) was added acetic anhydride (0.2 mL, 2.52 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 2 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 0-90% EtOAc m DCM to afford the product (0.252 g, 0.434 mmol, 52% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.84 (s, 1H), 10.68 (s, 1H), 8.63 (s, 1H),

7.75 (d, J = 8.9 Hz, 1H), 7.60 - 7.54 (m, 2H), 7.34 (d, J = 7.8 Hz, 1H), 7.14 (d, J = 7.7 Hz, 1H), 7.11 (dd, J = 8.2, 1.8 Hz, 1H), 7.07 - 6.98 (m, 2H), 6.93 (d, J = 1.8 Hz, 1H), 6.75 (s, 2H), 6.70 (d, J = 8.2 Hz, 1H), 4.79 (s, 1H), 3.81 (d, J = 0.6 Hz, 3H), 3.24 (dd, J = 14.0, 5.3 Hz, 1H), 2.96 (dd, J = 13.9, 9.4 Hz, 1H), 2.16 (d, J = 0.6 Hz, 3H). UPLC-MS (basic 2 min): Rt = 0.94 min; m/z = 581.3 for [M+H] ⁺

[0001324] Step 6: 3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(2-oxo-l,3-dihydro benzimidazol- 5-yl)sulfonylamino]ethyl]benzamidine

[0001325] To a magnetically stirred solution of [[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2- yl)-2-[(2-oxo-l,3-dihydrobenzimidazol-5-yl)sulfonylamino]eth yl]phenyl]methylene]amino] acetate (252 mg, 0.434 mmol, 1.0 eq.) in acetic acid (5 mL) was added zinc (568 mg, 8.68 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 18 h. The reaction mixture was re-dosed with zinc (568 mg, 8.68 mmol, 20.0 eq.) and stirred at RT for 30 h. The reaction mixture was filtered and concentrated to dryness. The residue was then submitted to Reach for achiral purification via prep-HPLC on a Gemini NX C18, eluting with a gradient of 5-100% MeCN in water (+0.2% v/v formic acid) to afford the product (13.0 mg, 0.0231 mmol, 5% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.48 (s, 1H), 7.76 (d, J = 8.9 Hz, 1H), 7.68 (s, 1H), 7.60 (d, J = 2.6 Hz, 1H), 7.44 (d, J = 7.9 Hz, 1H), 7.36 (d, J = 7.6 Hz, 1H), 7.20 - 7.09 (m, 2H), 7.06 (dd, J = 8.9, 2.6 Hz, 1H), 6.93 (d, J = 1.8 Hz, 1H), 6.69 (d, J = 8.2 Hz, 1H), 4.91 (dd, J = 9.7, 5.0 Hz, 1H), 3.82 (s, 3H), 2.99 (dd, J = 13.8, 9.8 Hz, 1H). UPLC-MS (acidic 6 mm): Rt = 1.59 mm; m/z = 523.2 for [M+H]+; 93% purity.

Example 66: Exemplary synthesis of Compound 239

[0001326] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001327] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (21.0 g, 72.3 mmol, 1.0 eq.) in toluene (420 mL) were added 2- aminothiophenol (8.5 mL, 79.6 mmol, 1.1 eq.), T3P (32.0 mL, 54.3 mmol, 0.8 eq.) and DIPEA (19.0 mL, 109 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min, then at 115 °C for 6 h. The reaction mixture was cooled to RT and stirred for 16.5 h. The reaction mixture was re-dosed with T3P (19.0 mL, 32.6 mmol, 0.5 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction mixture was quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and stirred for 20 min. The phases were separated, and the organics were extracted using EtOAc (3 x 250 mL), combined, washed with brine (250 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-20% EtOAc in DCM to afford the product (9.70 g, 25.6 mmol, 35% yield) as an off-white solid. 1H NMR (400 MHz, DMSO- d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (dt, J = 8.0, 1.0 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.81 (d, J =

I.9 Hz, 1H), 7.71 (dd, J = 7.7, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.17 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8,

I I.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.25 mm; m/z = 380.1 for [M+H]+

[0001328] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001329] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (14.6 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10 mL) was added 4 N HC1 in 1,4-dioxane (150 mL, 600 mmol, 15.6 eq.) and the resultant solution was stirred at RT for 4 h. The reaction mixture was then concentrated to dryness to afford the product (14.0 g, 39.5 mmol, assumed quantitative yield) as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 280.0 for [M+H]+

[0001330] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001331] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (3.00 g, 8.45 mmol, 1.0 eq.) in DMF (30 mL) cooled to 0°C was added triethylamine (4.1 mL, 29.6 mmol, 3.5 eq.) and the reaction mixture was stirred for 10 min. Methy 1-3 -chlorosulfonylbenzoate (2.38 g, 10.1 mmol, 1.2 eq.) was added portionwise over 10 min and the reaction mixture was allowed to warm to RT and stir for 2 h. The reaction was cooled to 0 °C and quenched via the addition of brine (150 mb). The organics were extracted with ethyl acetate (150 mL), washed with aq. saturated Na ₂ CO ₃ (150 mL) and brine (150 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM (ca. 3.5 mL) and filtered to afford product (2.49 g, 5.11 mmol, 60% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.18 (s, 1H), 8.08 (d, J = 8.1 Hz, 1H), 7.93 - 7.89 (m, 2H), 7.87 (t, J = 1.8 Hz, 1H), 7.72 (dt, J = 7.9, 1.5 Hz, 1H), 7.60 (d, J = 2.0 Hz, 1H), 7.54 - 7.47 (m, 2H), 7.47 - 7.39 (m, 3H), 7.21 (t, J = 7.7 Hz, 1H), 5.06 (d, J = 10.3 Hz, 1H), 3.88 (s, 3H), 3.39 (dd, J = 14.0, 4.4 Hz, 1H), 3.00 (dd, J = 13.9, 10.9 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 478.1 for [M+H]+

[0001332] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001333] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (2.49 g, 5.11 mmol, 1.0 eq.) in THF (50 mL) was added a solution of lithium hydroxide (0.214 g, 5.11 mmol, 1.0 eq.) in water (15 mL) and the resulting mixture was stirred at RT for 3 h. The reaction mixture was re-dosed with lithium hydroxide (0.429 g, 10.2 mmol, 2.0 eq.) and stirred at RT for 20 h. The reaction volume was reduced by half and the organics were extracted with EtOAc (30 mL). The aqueous phase was acidified to pH 1.0 via the addition of 1 M HC1 (ca. 1 mL), then diluted with EtOAc (130 mL), water (100 mL) and brine (50 mL). The phases were separated, and the organics were re-extracted with DCM (50 mL). The organics were combined, washed with water (150 mL), and re-extracted from the aqueous with EtOAc (4 x 150 mL). The organics were combined and concentrated to dryness. The residue was suspended in EtOAc (200 mL), MeOH (50 mL) and brine (100 mL) and the phases were separated. The organics were re-extracted from the aqueous layer using EtOAc (100 mL) and MeOH (50 mL). All organics were combined and concentrated to dryness to afford the product (2.40 g, 5.02 mmol, 98% yield) as a white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.15 (d, J = 8.5 Hz, 1H),

8.08 (d, J = 8.0 Hz, 1H), 7.95 - 7.88 (m, 3H), 7.65 (d, J = 7.8 Hz, 1H), 7.60 (s, 1H), 7.51 (t, J = 8.9 Hz, 2H), 7.45 - 7.35 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 5.04 (d, J = 7.4 Hz, 1H), 3.07 - 2.96 (m, 1H). UPLC-MS (basic 2 min) Rt = 0.86 min. m/z = 464.1 for [M+H] ⁺

[0001334] Step 5: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]-N-(2- methoxyethyl)benzamide

[0001335] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (1.20 g, 2.51 mmol, 1.0 eq.) in DMF (12 mL) were added 2-methoxyethylamine (0.26 mL, 3.01 mmol, 1.2 eq.), DIPEA (1.3 mL, 7.53 mmol, 3.0 eq.) and HATU (1.43 g, 3.77 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 2 h. The reaction mixture was diluted with EtOAc (60 mL), washed with brine (60 mL), aq. saturated Na ₂ CO ₃ (60 mL) and brine (60 mL). The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was triturated with DCM (ca. 10 mL), filtered and dried to afford product (0.451 g, 0.832 mmol, 33% yield) as a white solid. The precipitate that formed in the work-up was filtered, rinsed with EtOAc, dried and combined with the triturated solid to afford product (1.09 g, 2.03 mmol, 81% yield) as a white solid. Both batches of product were combined to afford product (1.54 g, 2.86 mmol, assumed quantitative yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.09 (s, 1H), 8.66 (t, J = 5.4 Hz, 1H), 8.10 (ddd, J = 7.9, 1.3, 0.6 Hz, 1H), 7.98 - 7.92 (m, 2H), 7.90 (dt, J = 7.8, 1.3 Hz, 1H), 7.61 - 7.55 (m, 2H), 7.51 (ddd, J = 8.2, 7.2, 1.3 Hz, 1H), 7.46 (tt, J = 7.9, 1.3 Hz, 2H), 7.43 - 7.36 (m, 2H), 7.16 (t, J = 7.7 Hz, 1H), 5.09 (d, J = 10.5 Hz, 1H), 3.56 - 3.40 (m, 4H), 3.40 - 3.36 (m, 1H), 3.31 (s, 3H), 2.97 (dd, J = 13.9, 10.9 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 521.1 for [M+H]+

[0001336] Step 6: 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]-N-(2-methoxyeth yl)benzamide

[0001337] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]-N-(2-methoxyethyl)benzamide (1.54 mg, 2.84 mmol, 1.0 eq.) in EtOH (30 mL) were added DIPEA (1.5 mL, 8.52 mmol, 3.0 eq.) and hydroxylamine hydrochloride (0.395 g, 5.68 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 17.5 h, then cooled to RT and concentrated to dryness to afford product (2.82 g, 3.62 mmol, assumed quantitative yield), as a white oil, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.93 min. m/z = 554.1 for [M+H]+

[0001338] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(2- methoxyethylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]meth ylene]amino] acetate

[0001339] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]-N-(2-methoxyeth yl)benzamide (2.82 g, 5.09 mmol, 1.0 eq.) in acetic acid (30 mL) was added acetic anhydride (1.4 mL, 15.3 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 2 h. The reaction mixture was concentrated to dryness and the residue was triturated with DCM and filtered. The filtrate was concentrated to dryness and purified by normal phase column chromatography (40 g cartridge) eluting with 20- 100% EtOAc in z.w-hexane to afford product (0.136 g, 0.210 mmol, 4% yield) as a white solid. The triturated solid was re-triturated with DCM, filtered and rinsed with DCM and iso-hexane to afford the product (0.782 g, 1.10 mmol, 22% yield) as a white solid. Both batches of product were combined to afford product (0.918 g, 1.31 mmol, 26% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 11.98 (s, 1H), 9.04 (d, J = 8.1 Hz, 1H), 8.65 (t, J = 5.4 Hz, 1H), 8.07 (dt, J = 7.8, 1.1 Hz, 1H), 7.95 - 7.87 (m, 2H), 7.80 (dt, J = 8.0, 1.3 Hz, 1H), 7.54 (ddd, J = 7.8, 1.9, 1.0 Hz, 1H), 7.52 - 7.48 (m, 2H), 7.48 - 7.36 (m, 2H), 7.29 (t, J = 7.8 Hz, 1H), 7.23 (d, J = 7.6 Hz, 1H), 7.06 (t, J = 7.7 Hz, 1H), 6.71 (s, 2H), 5.00 (s, 1H), 3.53 - 3.36 (m, 3H), 3.30 (s, 3H), 2.97 (dd, J = 13.8, 10.2 Hz, 1H), 2.16 (s, 3H), 1.91 (s, 2H). UPLC-MS (basic 2 mm): Rt = 0.97 min; m/z = 596.1 for [M+H]+

[0001340] Step 8: N-(2-methoxyethyl)-3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]benzamide

[0001341] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [[3-(2-methoxyethylcarbamoyl)phenyl]sulfonylamino]ethyl]phen yl]methylene]amino] acetate (0.918 g, 25.9 mmol, 1.0 eq.) in acetic acid (8 mL) was added zinc (1.69 g, 25.9 mmol, 20.0 eq.).

The reaction mixture was stirred at RT for 65 h. Further zinc (0.846 g, 12.9 mmol, 10.0 eq.) was added and the reaction mixture was stirred for a further 3 h at RT. The reaction mixture was filtered over Celite, washing with copious acetonitrile, EtOH and DCM, and concentrated to dryness. The residue was purified by SFC (Lux C4, 21.2mm x 250mm, 5um) eluting with 50:50 EtOH:CO ₂ to afford product (77.0 mg, 0.138 mmol, 5% yield) as a white solid. UPLC-MS (Reach 2.5 min): Rt = 1.01 min; m/z = 538.2 for [M+H]+

[0001342] Step 9: N-(2-methoxyethyl)-3-[[ l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]benzamide

[0001343] N-(2-methoxy ethy l)-3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]benzamide (77.0 mg, 0.138 mmol, 1.0 eq.) was suspended in 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 57.9 eq.) and stirred at RT for 3 h. The reaction mixture was then concentrated to dryness. The residue was re-suspended in 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 57.9 eq.) and stirred at RT for 4 h before concentrating to dryness. The residue was re-suspended in 4 N HC1 in 1,4-dioxane (1.0 mL, 4.00 eq., 30.0 eq.) and stirred at RT for 2 h. The reaction mixture was concentrated to dryness to afford the product (77.0 mg, 0.138 mmol, assumed quantitative yield) as an off-white solid. Material stored without further analysis due to low purity. UPLC-MS (acidic 6 min): Rt = 2.14 min; m/z = 538.1 for [M+H]+, 73% purity

Example 67: Exemplary synthesis of Compound 239

[0001344] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001345] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (21.0 g, 72.3 mmol, 1.0 eq.) in toluene (420 mL) were added 2- aminothiophenol (8.5 mL, 79.6 mmol, 1.1 eq.), T3P (32.0 mL, 54.3 mmol, 0.8 eq.) and DIPEA (19.0 mL, 109 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min, then at 115 °C for 6 h. The reaction mixture was cooled to RT and stirred for 16.5 h. The reaction mixture was re-dosed with T3P (19.0 mL, 32.6 mmol, 0.5 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction mixture was quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and stirred for 20 min. The phases were separated, and the organics were extracted using EtOAc (3 x 250 mL), combined, washed with brine (250 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-20% EtOAc in DCM to afford the product (9.70 g, 25.6 mmol, 35% yield) as an off-white solid. 1H NMR (400 MHz, DMSO- d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (dt, J = 8.0, 1.0 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.81 (d, J =

I.9 Hz, 1H), 7.71 (dd, J = 7.7, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.17 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8,

I I.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.25 mm; m/z = 380.1 for [M+H]+

[0001346] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001347] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (14.6 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10 mL) was added 4 N HC1 in 1,4-dioxane (150 mL, 600 mmol, 15.6 eq.) and the resultant solution was stirred at RT for 4 h. The reaction mixture was then concentrated to dryness to afford the product (14.0 g, 39.5 mmol, assumed quantitative yield) as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). - residual 1,4-dioxane present (9% wt.). UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.0 for [M+H]+

[0001348] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001349] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (3.00 g, 8.45 mmol, 1.0 eq.) in DMF (30 mL) cooled to 0°C was added triethylamine (4.1 mL, 29.6 mmol, 3.5 eq.) and the reaction mixture was stirred for 10 min. Methyl-3-chlorosulfonylbenzoate (2.38 g, 10.1 mmol, 1.2 eq.) was added portion wise over 10 min and the reaction mixture was allowed to warm to RT and stir for 2 h. The reaction was cooled to 0°C and quenched via the addition of brine (150 mL). The organics were extracted with ethyl acetate (150 mL), washed with aq. saturated Na ₂ CO ₃ (150 mL) and brine (150 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM (ca. 3.5 mL) and filtered to afford product (2.49 g, 5.11 mmol, 60% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.18 (s, 1H), 8.08 (d, J = 8.1 Hz, 1H), 7.93 - 7.89 (m, 2H), 7.87 (t, J = 1.8 Hz, 1H), 7.72 (dt, J = 7.9, 1.5 Hz, 1H), 7.60 (d, J = 2.0 Hz, 1H), 7.54 - 7.47 (m, 2H), 7.47 - 7.39 (m, 3H), 7.21 (t, J = 7.7 Hz, 1H), 5.06 (d, J = 10.3 Hz, 1H), 3.88 (s, 3H), 3.39 (dd, J = 14.0, 4.4 Hz, 1H), 3.00 (dd, J = 13.9, 10.9 Hz, 1H). - residual EtOAc and DCM present. UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 478.1 for [M+H]+

[0001350] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001351] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (2.49 g, 5.11 mmol, 1.0 eq.) in THF (50 mL) was added a solution of lithium hydroxide (0.214 g, 5.11 mmol, 1.0 eq.) in water (15 mL) and the resulting mixture was stirred at RT for 3 h. The reaction mixture was re-dosed with lithium hydroxide (0.429 g, 10.2 mmol, 2.0 eq.) and stirred at RT for 20 h. The reaction volume was reduced by half and the organics were extracted with EtOAc (30 mL). The aqueous phase was acidified to pH 1.0 via the addition of 1 M HC1 (ca. 1 mL), then diluted with EtOAc (130 mL), water (100 mL) and brine (50 mL). The phases were separated, and the organics were re-extracted with DCM (50 mL). The organics were combined, washed with water (150 mL), and re-extracted from the aqueous with EtOAc (4 x 150 mL). The organics were combined and concentrated to dryness. The residue was suspended in EtOAc (200 mL), MeOH (50 mL) and brine (100 mL) and the phases were separated. The organics were re-extracted from the aqueous layer using EtOAc (100 mL) and MeOH (50 mL). All organics were combined and concentrated to dryness to afford the product (2.40 g, 5.02 mmol, 98% yield) as a white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.15 (d, J = 8.5 Hz, 1H), 8.08 (d, J = 8.0 Hz, 1H), 7.95 - 7.88 (m, 3H), 7.65 (d, J = 7.8 Hz, 1H), 7.60 (s, 1H), 7.51 (t, J =

[0001352] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001353] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (8.14 g, 28.0 mmol, 1.0 eq.) in toluene (167.0 mL) were added DIPEA (7.3 mL, 42.0 mmol, 3.0 eq.), 2-Aminothiophenol (3.86 g, 30.8 mmol, 1.1 eq.) and T3P (20.0 mL, 33.0 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min then at reflux for 16 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (200 mL). The organics were then extracted with EtOAc (3 x 125 mL), washed with brine (125 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-30% ethyl acetate in heptane to afford product (4.50 g, 11.9 mmol, 42% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.92 (d, J = 8.8 Hz, 1H), 7.82 (s, 1H), 7.72 (dd, J = 7.7, 1.7 Hz, 2H), 7.53 (ddd, J = 9.5, 5.6, 2.5 Hz, 2H), 7.48 - 7.41 (m, 1H), 5.17 (ddd, J = 10.9, 8.7, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.4 Hz, 1H), 3.14 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 7H). UPLC- MS (basic 2 min) Rt = 1.22 min. m/z = 380.1 for [M+H] ⁺

[0001354] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001355] A magnetically stirred mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (4.50 g, 11.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (45.0 mL, 180 mmol, 15.2 eq.) was stirred at RT for 18 h. The reaction mixture was concentrated to dryness to afford product (2.94 g, 9.32 mmol, 79%), as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.13 (d, J = 5.4 Hz, 3H), 8.18 - 8.13 (m, 1H), 8.08 - 8.03 (m, 1H), 7.84 - 7.81 (m, 1H), 7.74 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.55 (m, 2H), 7.54 - 7.46 (m, 2H), 5.39 - 5.29 (m, 1H), 3.55 (dd, J = 13.8, 6.1 Hz, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 280.0 for [M+H] ⁺

[0001356] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001357] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (2.28 g, 7.23 mmol, 1.0 eq.) in DMF (25.0 mL) was added triethylamine (3.0 mL, 21.6 mmol, 3.0 eq.) and the reaction mixture was cooled to 0 °C. Methyl 3 -chlorosulfonylbenzoate (2.04 g, 8.67 mmol, 1.2 eq.) was added portion wise at 0 °C over 10 min and the reaction mixture was allowed to warm to RT for 4 h. The reaction was quenched via the addition of water (100 mL) and extracted with ethyl acetate (150 mL). The combined organics were then washed with water (3 x 100 mL) and concentrated to dryness. The residue was suspended in DCM (5 mL) and filtered, washing with further DCM (5 mL) afford product

(2.46 g, 5.15 mmol, 71% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.15 (s, 1H), 8.10 - 8.03 (m, 1H), 7.94 - 7.82 (m, 3H), 7.73 (dt, J = 8.0, 1.3 Hz, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.55 - 7.40 (m, 5H), 7.22 (t, J = 7.7 Hz, 1H), 5.07 (d, J = 10.5 Hz, 1H), 3.88 (s, 3H), 3.39 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.13 mm. m/z = 478.0 for [M+H] ⁺

[0001358] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001359] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (2.46 g, 5.05 mmol, 1.0 eq.) in THF (50.0 mb) was added a solution of lithium hydroxide (635 mg, 15.1 mmol, 3.0 eq.) in water (15.0 mL) and the resulting mixture stirred at RT for 5 h. After 5 h, the reaction mixture was concentrated under reduced pressure and the residue was diluted with EtOAc (50 mL). The organics were washed with water (50 mL), re-extracted with EtOAc (50 mL) and washed again with water (50 mL). The aqueous phase was acidified with 1 M HC1 (25 mL) and the organics were extracted into EtOAc (100 mL). The phases were separated and the organics were extracted into EtOAc (250 mL)/MeOH (20 mL). The organics were washed with brine (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The emulsion 'phase' was isolated and extracted with EtOAc (250 mL), followed by dilution with water (100 mL) and subsequent addition of 3: 1 DCM/MeOH (100 mL). The emulsion did not separate, therefore the mixture was concentrated until only water remained and the solid precipitate was filtered off. All crude material was combined to afford product (1.51 g, 2.90 mmol, 57% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 13.31 (s, 1H), 9.16 - 9.06 (m, 1H), 8.11 - 8.04 (m, 1H), 7.92 (dq, J = 2.8, 1.6 Hz, 2H), 7.90 (q, J = 1.4 Hz, 1H), 7.69 - 7.64 (m, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.54 - 7.48 (m, 2H), 7.46 - 7.37 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 5.06 (ddd, J = 10.8, 8.5, 4.4 Hz, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 0.87 min. m/z = 464.0 for [M+H] ⁺

[0001360] Step 5: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]-N- tetrahydropyran-4-yl-benzamide

[0001361] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (500 mg, 0.960 mmol, 1.0 eq.) in DMF (5.0 mL) was added 4-aminotetrahydropyran (117 mg, 1.15 mmol, 1.2 eq.), DIPEA (0.50 mL, 2.88 mmol, 3.0 eq.) and HATU (548 mg, 1.44 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 19 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (24 g cartridge) eluting with 0-100% EtO Ac: heptane to afford product (590 mg, 0.982 mmol, assumed quantitative yield) as a white solid. 1H NMR (400 MHz, DMSO- d6) 5 9.08 (dd, J = 8.4, 2.2 Hz, 1H), 8.41 (d, J = 2.1 Hz, 1H), 8.09 (d, J = 1.8 Hz, 1H), 7.95 - 7.91 (m, 3H), 7.61 - 7.55 (m, 2H), 7.53 - 7.36 (m, 5H), 7.18 (td, J = 7.8, 2.1 Hz, 1H), 5.08 (tdd, J = 8.5, 4.2, 2.1 Hz, 1H), 4.08 - 3.97 (m, 1H), 3.91 (d, J = 11.4 Hz, 2H), 3.45 - 3.35 (m, 3H), 3.02 - 2.93 (m, 1H), 1.86 - 1.75 (m, 2H), 1.70 - 1.55 (m, 2H). UPLC-MS (basic 2 mm) Rt = 1.04 min. m/z = 547.3 for [M+H] ⁺

[0001362] Step 6: 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]-N-tetrahydropyr an-4-yl-benzamide

[0001363] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]-N-tetrahydropyran-4-yl-benzamid e (590 mg, 0.982 mmol, 1.0 eq.) in EtOH (6.0 mL) were added hydroxylamine hydrochloride (136 mg, 1.96 mmol, 2.0 eq.) and DIPEA (0.51 mL, 2.95 mmol, 3.0 eq.). The reaction mixture was stirred at reflux for 16 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (686 mg, 1.14 mmol, assumed quantitative yield), as a yellow solid, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.98 min. m/z = 580.2 for [M+H] ⁺

[0001364] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(tetrahydropyran -4- ylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]methylene]amin o] acetate

[0001365] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]-N-tetrahydropyr an-4-yl-benzamide (686 mg, 1.18 mmol, 1.0 eq.) in acetic acid (7.0 mL) was added acetic anhydride (0.56 mL, 5.92 mmol, 5.0 eq.) and the resulting mixture was stirred at RT. Additional acetic anhydride (0.56 mL, 5.92 mmol, 5.0 eq.) was added after 24 h. After a further 72 h the reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (24 g cartridge) eluting with 0-100% EtO Ac: isohexane to afford product (77 mg, 0.160 mmol, 77% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.99 (d, J = 8.0 Hz, 1H), 8.37 (d, J = 7.7 Hz, 1H), 8.02 (d, J = 8.0 Hz, 1H), 7.87 (d, J = 7.4 Hz, 2H), 7.78 (d, J = 8.0 Hz, 1H), 7.53 (d, J = 7.9 Hz, 1H), 7.49 - 7.43 (m, 2H), 7.42 - 7.34 (m, 2H), 7.26 (t, J = 7.8 Hz, 1H), 7.20 (d, J = 7.6 Hz, 1H), 7.03 (t, J = 7.6 Hz, 1H), 4.95 (s, 1H), 3.97 (s, 1H), 3.91 - 3.81 (m, 2H), 3.17 - 3.07 (m, 1H), 2.93 (t, J = 12.0 Hz, 1H), 2.15 - 2.12 (m, 3H), 1.80 - 1.70 (m, 2H), 1.65 - 1.50 (m, 2H). UPLC-MS (basic 2 min): Rt = 1.04 min; m/z = 622.3 for [M+H] ⁺

[0001366] Step 8: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylphenyl)ethyl ]sulfamoyl]- N-tetrahydropyran-4-yl-benzamide

[0001367] To a magnetically stirred solution [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- (tetrahydropyran-4-ylcarbamoyl)phenyl]sulfonylamino]ethyl]ph enyl]methylene]amino] acetate (21 mg, 0.208 mmol, 1.0 eq.) in acetic acid (2.0 mL) was added zinc (407 mg, 6.22 mmol, 30 eq.). The reaction mixture was stirred at RT for 20 h. After 3.5 h, the reaction mixture was filtered, washing with copious acetonitrile, ethanol and DCM and concentrated to dryness. The residue was submitted to Reach for chiral purification. Purification was achieved using SFC on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the 1 ^st eluting enantiomer of the product (21 mg, 0.0369 mmol, 18%) as a white solid and the 2 ^nd eluting enantiomer of the product (20 mg, 0.0355 mmol, 17%) as a white solid. Approximately 4 mg of each enantiomer was combined, dissolved in MeCN/water, concentrated and dried in a vacuum oven to afford the racemic product as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.40 (d, J = 7.4 Hz, 1H), 7.95 (d, J = 7.9 Hz, 1H), 7.90 (s, 1H), 7.82 (d, J = 8.1 Hz, 1H), 7.73 - 7.67 (m, 1H), 7.58 (s, 1H), 7.51 (d, J = 7.8 Hz, 1H), 7.44 - 7.37 (m, 2H), 7.33 (t, J = 7.6 Hz, 1H),

[0001368] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001369] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (8.14 g, 28.0 mmol, 1.0 eq.) in toluene (167.0 mL) were added DIPEA (7.3 mL, 42.0 mmol, 3.0 eq.), 2-Aminothiophenol (3.86 g, 30.8 mmol, 1.1 eq.) and T3P (20.0 mL, 33.0 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min then at reflux for 16 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (200 mL). The organics were then extracted with EtOAc (3 x

125 mL), washed with brine (125 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-30% ethyl acetate in heptane to afford product (4.50 g, 11.9 mmol, 42% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.92 (d, J = 8.8 Hz, 1H), 7.82 (s, 1H), 7.72 (dd, J = 7.7, 1.7 Hz, 2H), 7.53 (ddd, J = 9.5, 5.6, 2.5 Hz, 2H), 7.48 - 7.41 (m, 1H), 5.17 (ddd, J = 10.9, 8.7, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.4 Hz, 1H), 3.14 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 7H). UPLC- MS (basic 2 min) Rt = 1.22 min. m/z = 380.1 for [M+H] ⁺

[0001370] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001371] A magnetically stirred mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (4.50 g, 11.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (45.0 mL, 180 mmol, 15.2 eq.) was stirred at RT for 18 h. The reaction mixture was concentrated to dryness to afford product (2.94 g, 9.32 mmol, 79%), as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.13 (d, J = 5.4 Hz, 3H), 8.18 - 8.13 (m, 1H), 8.08 - 8.03 (m, 1H), 7.84 - 7.81 (m, 1H), 7.74 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.55 (m, 2H), 7.54 - 7.46 (m, 2H), 5.39 - 5.29 (m, 1H), 3.55 (dd, J = 13.8, 6.1 Hz, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 280.0 for [M+H] ⁺

[0001372] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001373] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (2.28 g, 7.23 mmol, 1.0 eq.) in DMF (25.0 mL) was added triethylamine (3.0 mL, 21.6 mmol, 3.0 eq.) and the reaction mixture was cooled to 0 °C. Methyl 3 -chlorosulfonylbenzoate (2.04 g, 8.67 mmol, 1.2 eq.) was added portion wise at 0 °C over 10 min and the reaction mixture was allowed to warm to RT for 4 h. The reaction was quenched via the addition of water (100 mL) and extracted with ethyl acetate (150 mL). The combined organics were then washed with water (3 x 100 mL) and concentrated to dryness. The residue was suspended in DCM (5 mL) and filtered, washing with further DCM (5 mL) afford product (2.46 g, 5.15 mmol, 71% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.15 (s, 1H), 8.10 - 8.03 (m, 1H), 7.94 - 7.82 (m, 3H), 7.73 (dt, J = 8.0, 1.3 Hz, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.55 - 7.40 (m, 5H), 7.22 (t, J = 7.7 Hz, 1H), 5.07 (d, J = 10.5 Hz, 1H), 3.88 (s, 3H), 3.39 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.13 mm. m/z = 478.0 for [M+H] ⁺

[0001374] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001375] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (2.46 g, 5.05 mmol, 1.0 eq.) in THF (50.0 mL) was added a solution of lithium hydroxide (635 mg, 15.1 mmol, 3.0 eq.) in water (15.0 mL) and the resulting mixture stirred at RT for 5 h. After 5 h, the reaction mixture was concentrated under reduced pressure and the residue was diluted with EtOAc (50 mL). The organics were washed with water (50 mL), re-extracted with EtOAc (50 mL) and washed again with water (50 mL). The aqueous phase was acidified with 1 M HC1 (25 mL) and the organics were extracted into EtOAc (100 mL). The phases were separated and the organics were extracted into EtOAc (250 mL)/MeOH (20 mL). The organics were washed with brine (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The emulsion 'phase' was isolated and extracted with EtOAc (250 mL), followed by dilution with water (100 mL) and subsequent addition of 3: 1 DCM/MeOH (100 mL). The emulsion did not separate, therefore the mixture was concentrated until only water remained and the solid precipitate was filtered off. All crude material was combined to afford product (1.51 g, 2.90 mmol, 57% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 13.31 (s, 1H), 9.16 - 9.06 (m, 1H), 8.11 - 8.04 (m, 1H), 7.92 (dq, J = 2.8, 1.6 Hz, 2H), 7.90 (q, J = 1.4 Hz, 1H), 7.69 - 7.64 (m, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.54 - 7.48 (m, 2H), 7.46 - 7.37 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 5.06 (ddd, J = 10.8, 8.5, 4.4 Hz, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 0.87 min. m/z = 464.0 for [M+H] ⁺

[0001376] Step 5: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]-N- tetrahydropyran-4-yl-benzamide

[0001377] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (500 mg, 0.960 mmol, 1.0 eq.) in DMF (5.0 mL) was added 4-aminotetrahydropyran (117 mg, 1.15 mmol, 1.2 eq.), DIPEA (0.50 mL, 2.88 mmol, 3.0 eq.) and HATU (548 mg, 1.44 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 19 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (24 g cartridge) eluting with 0-100% EtO Ac: heptane to afford product (590 mg, 0.982 mmol, assumed quantitative yield) as a white solid. 1H NMR (400 MHz, DMSO- d6) 5 9.08 (dd, J = 8.4, 2.2 Hz, 1H), 8.41 (d, J = 2.1 Hz, 1H), 8.09 (d, J = 1.8 Hz, 1H), 7.95 - 7.91 (m, 3H), 7.61 - 7.55 (m, 2H), 7.53 - 7.36 (m, 5H), 7.18 (td, J = 7.8, 2.1 Hz, 1H), 5.08 (tdd, J = 8.5, 4.2, 2.1 Hz, 1H), 4.08 - 3.97 (m, 1H), 3.91 (d, J = 11.4 Hz, 2H), 3.45 - 3.35 (m, 3H), 3.02 - 2.93 (m, 1H), 1.86 - 1.75 (m, 2H), 1.70 - 1.55 (m, 2H). UPLC-MS (basic 2 mm) Rt = 1.04 min. m/z = 547.3 for [M+H] ⁺

[0001378] Step 6: 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]-N-tetrahydropyr an-4-yl-benzamide

[0001379] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]-N-tetrahydropyran-4-yl-benzamid e (590 mg, 0.982 mmol, 1.0 eq.) in EtOH (6.0 mL) were added hydroxylamine hydrochloride (136 mg, 1.96 mmol, 2.0 eq.) and DIPEA (0.51 mL, 2.95 mmol, 3.0 eq.). The reaction mixture was stirred at reflux for 16 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (686 mg, 1.14 mmol, assumed quantitative yield), as a yellow solid, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.98 min. m/z = 580.2 for [M+H] ⁺

[0001380] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(tetrahydropyran -4- ylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]methylene]amin o] acetate

[0001381] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]-N-tetrahydropyr an-4-yl-benzamide (686 mg, 1.18 mmol, 1.0 eq.) in acetic acid (7.0 mL) was added acetic anhydride (0.56 mL, 5.92 mmol, 5.0 eq.) and the resulting mixture was stirred at RT. Additional acetic anhydride (0.56 mL, 5.92 mmol, 5.0 eq.) was added after 24 h. After a further 72 h the reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (24 g cartridge) eluting with 0-100% EtO Ac: isohexane to afford product (77 mg, 0.160 mmol, 77% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.99 (d, J = 8.0 Hz, 1H), 8.37 (d, J = 7.7 Hz, 1H), 8.02 (d, J = 8.0 Hz, 1H), 7.87 (d, J = 7.4 Hz, 2H), 7.78 (d, J = 8.0 Hz, 1H), 7.53 (d, J = 7.9 Hz, 1H), 7.49 - 7.43 (m, 2H), 7.42 - 7.34 (m, 2H), 7.26 (t, J = 7.8 Hz, 1H), 7.20 (d, J = 7.6 Hz, 1H), 7.03 (t, J = 7.6 Hz, 1H), 4.95 (s, 1H), 3.97 (s, 1H), 3.91 - 3.81 (m, 2H), 3.17 - 3.07 (m, 1H), 2.93 (t, J = 12.0 Hz, 1H), 2.15 - 2.12 (m, 3H), 1.80 - 1.70 (m, 2H), 1.65 - 1.50 (m, 2H). UPLC-MS (basic 2 min): Rt = 1.04 min; m/z = 622.3 for [M+H] ⁺

[0001382] Step 8: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylphenyl)ethyl ]sulfamoyl]- N-tetrahydropyran-4-yl-benzamide

[0001383] To a magnetically stirred solution [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- (tetrahydropyran-4-ylcarbamoyl)phenyl]sulfonylamino]ethyl]ph enyl]methylene]amino] acetate (21 mg, 0.208 mmol, 1.0 eq.) in acetic acid (2.0 mL) was added zinc (407 mg, 6.22 mmol, 30 eq.). The reaction mixture was stirred at RT for 20 h. After 3.5 h, the reaction mixture was filtered, washing with copious acetonitrile, ethanol and DCM and concentrated to dryness. The residue was submitted to Reach for chiral purification. Purification was achieved using SFC on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the 1 ^st eluting enantiomer of the product (21 mg, 0.0369 mmol, 18% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.40 (d, J = 7.6 Hz, 1H), 7.95 - 7.88 (m, 2H), 7.81 (d, J = 8.1 Hz, 1H), 7.68 (d, J = 7.8 Hz, 1H), 7.58 (s, 1H), 7.49 (d, J = 7.9 Hz, 1H), 7.39 (t, J = 7.9 Hz, 2H), 7.31 (t, J = 7.6 Hz, 1H), 7.21 (t, J = 7.8 Hz, 2H), 7.11 (t, J = 7.9 Hz, 1H), 4.75 (s, 1H), 3.94 (s, 1H), 3.84 (d, J = 11.5 Hz, 2H), 2.93 (t, J = 11.2 Hz, 1H), 1.76 - 1.66 (m, 2H), 1.64 - 1.49 (m, 2H) UPLC-MS (acidic 6 min): Rt = 2.07 min; m/z = 564.3 for [M+H] ⁺ , 99% purity.

Example 70: Exemplary synthesis of Compound 240

[0001384] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001385] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (8.14 g, 28.0 mmol, 1.0 eq.) in toluene (167.0 mL) were added DIPEA (7.3 mL, 42.0 mmol, 3.0 eq.), 2-Aminothiophenol (3.86 g, 30.8 mmol, 1.1 eq.) and T3P (20.0 mL, 33.0 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min then at reflux for 16 h. The reaction mixture was cooled to RT and then quenched via the addition of 10% (w/v) aqueous citric acid solution (200 mL). The organics were then extracted with EtOAc (3 x 125 mL), washed with brine (125 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-30% ethyl acetate in heptane to afford product

(4.50 g, 11.9 mmol, 42% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.92 (d, J = 8.8 Hz, 1H), 7.82 (s, 1H), 7.72 (dd, J = 7.7, 1.7 Hz, 2H), 7.53 (ddd, J = 9.5, 5.6, 2.5 Hz, 2H), 7.48 - 7.41 (m, 1H), 5.17 (ddd, J = 10.9, 8.7, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.4 Hz, 1H), 3.14 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 7H). UPLC- MS (basic 2 min) Rt = 1.22 min. m/z = 380.1 for [M+H] ⁺

[0001386] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001387] A magnetically stirred mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (4.50 g, 11.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (45.0 mL, 180 mmol, 15.2 eq.) was stirred at RT for 18 h. The reaction mixture was concentrated to dryness to afford product (2.94 g, 9.32 mmol, 79%), as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.13 (d, J = 5.4 Hz, 3H), 8.18 - 8.13 (m, 1H), 8.08 - 8.03 (m, 1H), 7.84 - 7.81 (m, 1H), 7.74 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.55 (m, 2H), 7.54 - 7.46 (m, 2H), 5.39 - 5.29 (m, 1H), 3.55 (dd, J = 13.8, 6.1 Hz, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 280.0 for [M+H] ⁺

[0001388] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001389] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (2.28 g, 7.23 mmol, 1.0 eq.) in DMF (25.0 mL) was added triethylamine (3.0 mL, 21.6 mmol, 3.0 eq.) and the reaction mixture was cooled to 0 °C. Methyl 3 -chlorosulfonylbenzoate (2.04 g, 8.67 mmol, 1.2 eq.) was added portion wise at 0 °C over 10 min and the reaction mixture was allowed to warm to RT for 4 h. The reaction was quenched via the addition of water (100 mL) and extracted with ethyl acetate (150 mL). The combined organics were then washed with water (3 x 100 mL) and concentrated to dryness. The residue was suspended in DCM (5 mL) and filtered, washing with further DCM (5 mL) afford product (2.46 g, 5.15 mmol, 71% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.15 (s, 1H), 8.10 - 8.03 (m, 1H), 7.94 - 7.82 (m, 3H), 7.73 (dt, J = 8.0, 1.3 Hz, 1H), 7.60 (d, J = 1.7 Hz,

1H), 7.55 - 7.40 (m, 5H), 7.22 (t, J = 7.7 Hz, 1H), 5.07 (d, J = 10.5 Hz, 1H), 3.88 (s, 3H), 3.39 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.13 min. m/z = 478.0 for [M+H] ⁺

[0001390] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001391] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (2.46 g, 5.05 mmol, 1.0 eq.) in THF (50.0 mb) was added a solution of lithium hydroxide (635 mg, 15.1 mmol, 3.0 eq.) in water (15.0 mL) and the resulting mixture stirred at RT for 5 h. After 5 h, the reaction mixture was concentrated under reduced pressure and the residue was diluted with EtOAc (50 mL). The organics were washed with water (50 mL), re-extracted with EtOAc (50 mL) and washed again with water (50 mL). The aqueous phase was acidified with 1 M HC1 (25 mL) and the organics were extracted into EtOAc (100 mL). The phases were separated and the organics were extracted into EtOAc (250 mL)/MeOH (20 mL). The organics were washed with brine (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The emulsion 'phase' was isolated and extracted with EtOAc (250 mL), followed by dilution with water (100 mL) and subsequent addition of 3: 1 DCM/MeOH (100 mL). The emulsion did not separate, therefore the mixture was concentrated until only water remained and the solid precipitate was filtered off. All crude material was combined to afford product (1.51 g, 2.90 mmol, 57% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 13.31 (s, 1H), 9.16 - 9.06 (m, 1H), 8.11 - 8.04 (m, 1H), 7.92 (dq, J = 2.8, 1.6 Hz, 2H), 7.90 (q, J = 1.4 Hz, 1H), 7.69 - 7.64 (m, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.54 - 7.48 (m, 2H), 7.46 - 7.37 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 5.06 (ddd, J = 10.8, 8.5, 4.4 Hz, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min) Rt = 0.87 min. m/z = 464.0 for [M+H] ⁺

[0001392] Step 5: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]-N- tetrahydropyran-4-yl-benzamide

[0001393] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (500 mg, 0.960 mmol, 1.0 eq.) in DMF (5.0 mL) was added 4-aminotetrahydropyran (117 mg, 1.15 mmol, 1.2 eq.), DIPEA (0.50 mL, 2.88 mmol, 3.0 eq.) and HATU (548 mg, 1.44 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 19 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (24 g cartridge) eluting with 0-100% EtO Ac: heptane to afford product (590 mg, 0.982 mmol, assumed quantitative yield) as a white solid. 1H NMR (400 MHz, DMSO- d6) 5 9.08 (dd, J = 8.4, 2.2 Hz, 1H), 8.41 (d, J = 2.1 Hz, 1H), 8.09 (d, J = 1.8 Hz, 1H), 7.95 - 7.91 (m, 3H), 7.61 - 7.55 (m, 2H), 7.53 - 7.36 (m, 5H), 7.18 (td, J = 7.8, 2.1 Hz, 1H), 5.08 (tdd, J = 8.5, 4.2, 2.1 Hz, 1H), 4.08 - 3.97 (m, 1H), 3.91 (d, J = 11.4 Hz, 2H), 3.45 - 3.35 (m, 3H), 3.02 - 2.93 (m, 1H), 1.86 - 1.75 (m, 2H), 1.70 - 1.55 (m, 2H). UPLC-MS (basic 2 mm) Rt = 1.04 min. m/z = 547.3 for [M+H] ⁺

[0001394] Step 6: 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]-N-tetrahydropyr an-4-yl-benzamide

[0001395] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]-N-tetrahydropyran-4-yl-benzamid e (590 mg, 0.982 mmol, 1.0 eq.) in EtOH (6.0 mL) were added hydroxylamine hydrochloride (136 mg, 1.96 mmol, 2.0 eq.) and DIPEA (0.51 mL, 2.95 mmol, 3.0 eq.). The reaction mixture was stirred at reflux for 16 h. The reaction mixture was cooled down to RT and then concentrated to dryness to afford product (686 mg, 1.14 mmol, assumed quantitative yield), as a yellow solid, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.98 min. m/z = 580.2 for [M+H] ⁺

[0001396] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(tetrahydropyran -4- ylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]methylene]amin o] acetate

[0001397] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]-N-tetrahydropyr an-4-yl-benzamide (686 mg, 1.18 mmol, 1.0 eq.) in acetic acid (7.0 mL) was added acetic anhydride (0.56 mL, 5.92 mmol, 5.0 eq.) and the resulting mixture was stirred at RT. Additional acetic anhydride (0.56 mL, 5.92 mmol, 5.0 eq.) was added after 24 h. After a further 72 h the reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (24 g cartridge) eluting with 0-100% EtO Ac: isohexane to afford product (77 mg, 0.160 mmol, 77% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.99 (d, J = 8.0 Hz, 1H), 8.37 (d, J = 7.7 Hz, 1H), 8.02 (d, J = 8.0 Hz, 1H), 7.87 (d, J = 7.4 Hz, 2H), 7.78 (d, J = 8.0 Hz, 1H), 7.53 (d, J = 7.9 Hz, 1H), 7.49 - 7.43 (m, 2H), 7.42 - 7.34 (m, 2H), 7.26 (t, J = 7.8 Hz, 1H), 7.20 (d, J = 7.6 Hz, 1H), 7.03 (t, J = 7.6 Hz, 1H), 4.95 (s, 1H), 3.97 (s, 1H), 3.91 - 3.81 (m, 2H), 3.17 - 3.07 (m, 1H), 2.93 (t, J = 12.0 Hz, 1H), 2.15 - 2.12 (m, 3H), 1.80 - 1.70 (m, 2H), 1.65 - 1.50 (m, 2H). UPLC-MS (basic 2 min): Rt = 1.04 min; m/z = 622.3 for [M+H] ⁺

[0001398] Step 8: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylphenyl)ethyl ]sulfamoyl]- N-tetrahydropyran-4-yl-benzamide

[0001399] To a magnetically stirred solution [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- (tetrahydropyran-4-ylcarbamoyl)phenyl]sulfonylamino]ethyl]ph enyl]methylene]amino] acetate (21 mg, 0.208 mmol, 1.0 eq.) in acetic acid (2.0 mL) was added zinc (407 mg, 6.22 mmol, 30 eq.). The reaction mixture was stirred at RT for 20 h. After 3.5 h, the reaction mixture was filtered, washing with copious acetonitrile, ethanol and DCM and concentrated to dryness. The residue was submitted to Reach for chiral purification. Purification was achieved using SFC on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the 2 ^nd eluting enantiomer of the product (20 mg, 0.0355 mmol, 17%) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.40 (d, J = 7.6 Hz, 1H), 7.95 - 7.88 (m, 2H), 7.81 (d, J = 8.1 Hz, 1H), 7.68 (d, J = 7.8 Hz, 1H), 7.58 (s, 1H), 7.49 (d, J = 7.9 Hz, 1H), 7.39 (t, J = 7.9 Hz, 2H), 7.31 (t, J = 7.6 Hz, 1H), 7.21 (t, J = 7.8 Hz, 2H), 7.11 (t, J = 7.9 Hz, 1H), 4.75 (s, 1H), 3.94 (s, 1H), 3.84 (d, J = 11.5 Hz, 2H), 2.93 (t, J = 11.2 Hz, 1H), 1.76 - 1.66 (m, 2H), 1.64 - 1.49 (m, 2H). UPLC- MS (acidic 6 min): Rt = 2.07 min; m/z = 564.3 for [M+H] ⁺ , 100% purity

Example 71: Exemplary synthesis of Compound 236

[0001400] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001401] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (21.0 g, 72.3 mmol, 1.0 eq.) in toluene (420 mL) were added 2- aminothiophenol (8.5 mL, 79.6 mmol, 1.1 eq.), T3P (32.0 mL, 54.3 mmol, 0.8 eq.) and DIPEA (19.0 mL, 109 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min, then at 115 °C for 6 h. The reaction mixture was cooled to RT and stirred for 16.5 h. The reaction mixture was re-dosed with T3P (19.0 mL, 32.6 mmol, 0.5 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction mixture was quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and stirred for 20 min. The phases were separated, and the organics were extracted using EtOAc (3 x 250 mL), combined, washed with brine (250 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-20% EtOAc in DCM to afford the product (9.70 g, 25.6 mmol, 35% yield) as an off-white solid. 1H NMR (400 MHz, DMSO- d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (dt, J = 8.0, 1.0 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.81 (d, J =

I.9 Hz, 1H), 7.71 (dd, J = 7.7, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.17 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8,

I I.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.25 mm; m/z = 380.1 for [M+H]+

[0001402] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001403] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (14.6 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10 mL) was added 4 N HC1 in 1,4-dioxane (150 mL, 600 mmol, 15.6 eq.) and the resultant solution was stirred at RT for 4 h. The reaction mixture was then concentrated to dryness to afford the product (14.0 g, 39.5 mmol, assumed quantitative yield) as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 280.0 for [M+H]+

[0001404] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001405] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (5.00 g, 14.1 mmol, 1.0 eq.) in DMF (50 mL), cooled to 0 °C, was added triethylamine (6.9 mL, 49.3 mmol, 3.5 eq.) and the resultant solution was stirred for 10 min. To the cooled solution was added 3 -nitrobenzenesulfonyl chloride (3.75 g, 16.9 mmol, 1.2 eq.) portionwise over 10-15 min. The resultant mixture was then gently warmed to RT and stirred for 4 h. The organics were then extracted into EtOAc (250 mL), washed with brine (250 mL), aq. saturated Na ₂ CO ₃ (250 mL), and brine again (250 mL). The organics were then dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was triturated with DCM (25 mL) and filtered under vacuum to afford the product (4.42 g, 9.31 mmol, 66% yield) as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.35 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.88 (dddd, J = 7.8, 4.5, 1.6, 0.8 Hz, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.59 (t, J = 8.0 Hz, 1H), 7.55 (dt, J = 7.9, 1.4 Hz, 1H), 7.50 (ddd, J = 8.2, 7.2, 1.4 Hz, 1H), 7.47 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.17 (d, J = 9.9 Hz, 1H), 3.41 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min): Rt = 1.14 min; m/z = 465.1 for [M+H]+

[0001406] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001407] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-nitro-benzenesulfonamide (4.42 g, 9.31 mmol, 1.0 eq.) in ethanol (45 mL) and water (23 mL) were added ammonium chloride (2.49 g, 46.6 mmol, 5.0 eq.) and iron (5.20 g, 93.1 mmol, 10.0 eq.). The reaction mixture was heated to 85 °C and stirred for 24 h. The reaction mixture was then cooled to RT and filtered through a plug of Celite under vacuum, washing with copious EtOH. The filtrate was concentrated to dryness to afford the product (2.61 g, 5.53 mmol, 59% yield) as a white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.71 (s, 1H), 8.11 - 8.06 (m, 1H), 7.97 - 7.93 (m, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 (tt, J = 6.7, 1.2 Hz, 2H), 7.51 - 7.48 (m, 1H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.0 Hz, 1H), 6.61 - 6.56 (m, 2H), 5.40 (s, 2H), 4.90 (dd, J = 9.9, 4.9 Hz, 1H), 3.38 (d, J = 4.9 Hz, 1H), 2.99 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.06 mm; m/z = 435.1 for [M+H]+

[0001408] Step 5: tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidine-1-ca rboxylate

[0001409] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (0.500 g, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added l-tert-Butoxycarbonylpiperidine-4-carboxylic acid (0.317 g, 1.38 mmol, 1.2 eq.), DIPEA (0.6 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 46.5 h. The reaction mixture was re-dosed with 1-tert-

Butoxycarbonylpiperidine-4-carboxylic acid (0.317 g, 1.38 mmol, 1.2 eq.), DIPEA (0.6 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and stirred at RT for 6 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25 mL) again. The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was dissolved in DMF (5 mL) and re-dosed with l-tert-Butoxycarbonylpiperidine-4-carboxylic acid (0.317 g, 1.38 mmol, 1.2 eq.), DIPEA (0.6 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and stirred at RT for 18 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25 mL) again. The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with a gradient of 20-80% EtOAc in iso-hexane to afford the product (0.560 g, 0.870 mmol, 76% yield) as a brown oil. 1H NMR (400 MHz, DMSO-d6) 5 10.04 (s, 1H), 8.95 (d, J = 8.3 Hz, 1H), 8.10 (dt, J = 7.8, 0.8 Hz, 1H), 7.98 - 7.91 (m, 1H), 7.85 (t, J = 2.0 Hz, 1H), 7.58 - 7.52 (m, 2H), 7.52 - 7.47 (m, 2H), 7.47 - 7.45 (m, 1H), 7.45 - 7.43 (m, 1H), 7.42 (dt, J = 2.8, 1.3 Hz, 1H), 7.21 (t, J = 7.8 Hz, 2H), 7.12 (dt, J = 8.1, 1.3 Hz, 1H), 4.93 (ddd, J = 10.7, 8.2, 4.4 Hz, 1H), 3.38 (dd, J = 13.9, 4.3 Hz, 1H), 2.97 (dd, J = 13.9, 10.7 Hz, 1H), 2.79 (s, 3H), 1.87 - 1.73 (m, 3H), 1.51 (d, J = 12.2 Hz, 1H), 1.42 (s, 8H). UPLC- MS (basic 2 min): Rt = 1.20 min; m/z = 644.2 [M-H]-

[0001410] Step 6: tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]carbamoyl ]piperidine-1-carboxylate

[0001411] To a magnetically stirred solution of tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2- (3-cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidine-1 -carboxylate (0.560 g, 0.870 mmol, 1.0 eq.) in EtOH (11 mL) were added hydroxylamine hydrochloride (120 mg, 1.74 mmol, 2.0 eq.) and DIPEA (0.5 mL, 2.61 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 17.5 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (0.790 g, 1.16 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.09 min; m/z = 679.2 for [M+H] ⁺

[0001412] Step 7: tert-butyl 4-[[3-[[2-[3-[(E)-N'-acetoxycarbamimidoyl]phenyl]-l-(l,3- benzothiazol-2-yl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidin e-1-carboxylate

[0001413] To a magnetically stirred solution of tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2- [3-[(E)-N'-hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]pheny l]carbamoyl]piperidine-l- carboxylate (0.790g, 1.16 mmol, 1.0 eq.) in acetic acid (16 mL) was added acetic anhydride (0.30 mL, 3.49 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 19 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 20-80% EtOAc in iso-hexane to afford the product (0.261 g, 0.362 mmol, 31% yield) as a colourless glass. 1H NMR (400 MHz, DMSO-d6) 5 9.96 (d, J = 2.7 Hz, 1H), 8.91 (s, 1H), 8.08 - 8.01 (m, 1H), 7.91 (dd, J = 7.9, 2.4 Hz, 1H), 7.85 (q, J = 1.9 Hz, 1H), 7.55 (d, J = 3.0 Hz, 1H), 7.54 - 7.44 (m, 2H), 7.44 - 7.38 (m, 2H), 7.19 (t, J = 5.4 Hz, 1H), 7.17 - 7.02 (m, 3H), 6.73 - 6.69 (m, 2H), 4.90 (s, 1H), 4.08 - 3.89 (m, 1H), 3.27 (s, 1H), 2.99 (t, J = 11.9 Hz, 1H), 2.77 (s, 2H), 2.47 - 2.41 (m, 1H), 2.18 - 2.12 (m, 3H), 1.78 (d, J = 13.0 Hz, 2H), 1.47 (d, J = 12.6 Hz, 2H), 1.43 - 1.36 (m, 9H), 1.23 (s, 1H). UPLC-MS (basic 2 min): Rt = 1.12 min; m/z = 721.3 for [M+H] ⁺

[0001414] Step 8: tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperid ine-1-carboxylate

[0001415] To a magnetically stirred solution of 4-[[3-[[2-[3-[(E)-N'- acetoxycarbamimidoyl]phenyl]-l-(l,3-benzothiazol-2- yl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidine-l-carboxylate (0.261 g, 0.362 mmol, 1.0 eq.) in acetic acid (5 mL) was added zinc (0.473 g, 7.24 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 40.5 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was then submitted to Reach for chiral purification via SFC on a Lux C4 (21.2mm x 250mm, 5um), eluting with 50:50 EtOH:CO ₂ (+0.2% v/v NH ₃ ) to afford product (22.8 mg, 0.0341 mmol, 9% yield) as a white solid. UPLC- MS (acidic 2.5 min): Rt = 1.26 min; m/z = 663.2 for [M+H] ⁺

[0001416] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]piperidine-4-carb oxamide

[0001417] To tert-butyl 4-[[3-l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperid ine-1-carboxylate (18.0 mg, 0.0269 mmol, 1.0 eq.) was added 4 N HC1 in 1,4-dioxane solution (1.0 mL, 4.00 mmol, 149 eq.) and the reaction mixture was stirred at RT for 4 h. The reaction mixture was concentrated to dryness, resuspended in water, and concentrated to dryness again to afford the product (9.00 mg, 0.0154 mmol, assumed quantitative yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.27 (s, 1H), 9.24 (s, 2H), 9.10 (s, 2H), 8.94 (d, J = 8.7 Hz, 2H), 8.62 (s, 1H), 8.08 (d, J = 8.0 Hz, 1H), 7.92 (d, J = 10.4 Hz, 2H), 7.72 (s, 1H), 7.59 - 7.40 (m, 5H), 7.24 (d, J = 7.9 Hz, 1H), 7.15 (d, J = 10.2 Hz, 2H), 5.00 (s, 1H), 3.63 (s, 1H), 3.05 (d, J = 11.6 Hz, 1H), 2.95 (d, J = 12.0 Hz, 2H), 2.67 (s, 2H), 1.98 (s, 2H), 1.82 (d, J = 13.4 Hz, 2H). UPLC-MS (acidic 6 mm): Rt = 1.46 min; m/z = 563.3 for [M+H] ⁺ , 96% purity.

Example 72: Exemplary synthesis of Compound 236

[0001418] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001419] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (21.0 g, 72.3 mmol, 1.0 eq.) in toluene (420 mL) were added 2- aminothiophenol (8.5 mL, 79.6 mmol, 1.1 eq.), T3P (32.0 mL, 54.3 mmol, 0.8 eq.) and DIPEA (19.0 mL, 109 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min, then at 115 °C for 6 h. The reaction mixture was cooled to RT and stirred for 16.5 h. The reaction mixture was re-dosed with T3P (19.0 mL, 32.6 mmol, 0.5 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction mixture was quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and stirred for 20 min. The phases were separated, and the organics were extracted using EtOAc (3 x 250 mL), combined, washed with brine (250 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-20% EtOAc in DCM to afford the product (9.70 g, 25.6 mmol, 35% yield) as an off-white solid. 1H NMR (400 MHz, DMSO- d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (dt, J = 8.0, 1.0 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.81 (d, J =

I.9 Hz, 1H), 7.71 (dd, J = 7.7, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.17 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8,

I I.1 Hz, 1H), 1.31 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.25 mm; m/z = 380.1 for [M+H]+

[0001420] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001421] To a magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (14.6 g, 38.5 mmol, 1.0 eq.) in 1,4-dioxane (10 mL) was added 4 N HC1 in 1,4-dioxane (150 mL, 600 mmol, 15.6 eq.) and the resultant solution was stirred at RT for 4 h. The reaction mixture was then concentrated to dryness to afford the product (14.0 g, 39.5 mmol, assumed quantitative yield) as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H).

[0001422] UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 280.0 for [M+H]+

[0001423] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001424] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (5.00 g, 14.1 mmol, 1.0 eq.) in DMF (50 mL), cooled to 0 °C, was added triethylamine (6.9 mL, 49.3 mmol, 3.5 eq.) and the resultant solution was stirred for 10 min. To the cooled solution was added 3 -nitrobenzenesulfonyl chloride (3.75 g, 16.9 mmol, 1.2 eq.) portionwise over 10-15 min. The resultant mixture was then gently warmed to RT and stirred for 4 h. The organics were then extracted into EtOAc (250 mL), washed with brine (250 mL), aq. saturated Na ₂ CO ₃ (250 mL), and brine again (250 mL). The organics were then dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was triturated with DCM (25 mL) and filtered under vacuum to afford the product (4.42 g, 9.31 mmol, 66% yield) as an off-white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.35 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.88 (dddd, J = 7.8, 4.5, 1.6, 0.8 Hz, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.59 (t, J = 8.0 Hz, 1H), 7.55 (dt, J = 7.9, 1.4 Hz, 1H), 7.50 (ddd, J = 8.2, 7.2, 1.4 Hz, 1H), 7.47 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.17 (d, J = 9.9 Hz, 1H), 3.41 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.14 mm; m/z = 465.1 for [M+H]+

[0001425] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001426] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-nitro-benzenesulfonamide (4.42 g, 9.31 mmol, 1.0 eq.) in ethanol (45 mL) and water (23 mL) were added ammonium chloride (2.49 g, 46.6 mmol, 5.0 eq.) and iron (5.20 g, 93.1 mmol, 10.0 eq.). The reaction mixture was heated to 85 °C and stirred for 24 h. The reaction mixture was then cooled to RT and filtered through a plug of Celite under vacuum, washing with copious EtOH. The filtrate was concentrated to dryness to afford the product (2.61 g, 5.53 mmol, 59% yield) as a white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.71 (s, 1H), 8.11 - 8.06 (m, 1H), 7.97 - 7.93 (m, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 (tt, J = 6.7, 1.2 Hz, 2H), 7.51 - 7.48 (m, 1H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.93 (t, J = 7.9 Hz, 1H), 6.74 (t, J = 2.0 Hz, 1H), 6.61 - 6.56 (m, 2H), 5.40 (s, 2H), 4.90 (dd, J = 9.9, 4.9 Hz, 1H), 3.38 (d, J = 4.9 Hz, 1H), 2.99 (dd, J = 13.8, 9.9 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.06 mm; m/z = 435.1 for [M+H]+

[0001427] Step 5: tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidine-1-ca rboxylate

[0001428] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (0.500 g, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added l-tert-Butoxycarbonylpiperidine-4-carboxylic acid (0.317 g, 1.38 mmol, 1.2 eq.), DIPEA (0.6 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 46.5 h. The reaction mixture was re-dosed with 1-tert- Butoxycarbonylpiperidine-4-carboxylic acid (0.317 g, 1.38 mmol, 1.2 eq.), DIPEA (0.6 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and stirred at RT for 6 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25 mL) again. The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was dissolved in DMF (5 mL) and re-dosed with l-tert-Butoxycarbonylpiperidine-4-carboxylic acid (0.317 g, 1.38 mmol, 1.2 eq.), DIPEA (0.6 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and stirred at RT for 18 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25 mL) again. The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with a gradient of 20-80% EtOAc in iso-hexane to afford the product (0.560 g, 0.870 mmol, 76% yield) as a brown oil. 1H NMR (400 MHz, DMSO-d6) 5 10.04 (s, 1H), 8.95 (d, J = 8.3 Hz, 1H), 8.10 (dt, J = 7.8, 0.8 Hz, 1H), 7.98 - 7.91 (m, 1H), 7.85 (t, J = 2.0 Hz, 1H), 7.58 - 7.52 (m, 2H), 7.52 - 7.47 (m, 2H), 7.47 - 7.45 (m, 1H), 7.45 - 7.43 (m, 1H), 7.42 (dt, J = 2.8, 1.3 Hz, 1H), 7.21 (t, J = 7.8 Hz, 2H), 7.12 (dt, J = 8.1, 1.3 Hz, 1H), 4.93 (ddd, J = 10.7, 8.2, 4.4 Hz, 1H), 3.38 (dd, J = 13.9, 4.3 Hz, 1H), 2.97 (dd, J = 13.9, 10.7 Hz, 1H), 2.79 (s, 3H), 1.87 - 1.73 (m, 3H), 1.51 (d, J = 12.2 Hz, 1H), 1.42 (s, 8H). UPLC- MS (basic 2 min): Rt = 1.20 min; m/z = 644.2 [M-H]-

[0001429] Step 6: tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]carbamoyl ]piperidine-1-carboxylate

[0001430] To a magnetically stirred solution of tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2- (3-cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidine-1 -carboxylate (0.560 g, 0.870 mmol, 1.0 eq.) in EtOH (11 mL) were added hydroxylamine hydrochloride (120 mg, 1.74 mmol, 2.0 eq.) and DIPEA (0.5 mL, 2.61 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 17.5 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (0.790 g, 1.16 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.09 min; m/z = 679.2 for [M+H] ⁺

[0001431] Step 7: tert-butyl 4-[[3-[[2-[3-[(E)-N'-acetoxycarbamimidoyl]phenyl]-l-(l,3- benzothiazol-2-yl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidin e-1-carboxylate

[0001432] To a magnetically stirred solution of tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2- [3-[(E)-N'-hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]pheny l]carbamoyl]piperidine-l- carboxylate (0.790g, 1.16 mmol, 1.0 eq.) in acetic acid (16 mL) was added acetic anhydride (0.30 mL, 3.49 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 19 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 20-80% EtOAc in iso-hexane to afford the product (0.261 g, 0.362 mmol, 31% yield) as a colourless glass. 1H NMR (400 MHz, DMSO-d6) 5 9.96 (d, J = 2.7 Hz, 1H), 8.91 (s, 1H), 8.08 - 8.01 (m, 1H), 7.91 (dd, J = 7.9, 2.4 Hz, 1H), 7.85 (q, J = 1.9 Hz, 1H), 7.55 (d, J = 3.0 Hz, 1H), 7.54 - 7.44 (m, 2H), 7.44 - 7.38 (m, 2H), 7.19 (t, J = 5.4 Hz, 1H), 7.17 - 7.02 (m, 3H), 6.73 - 6.69 (m, 2H), 4.90 (s, 1H), 4.08 - 3.89 (m, 1H), 3.27 (s, 1H), 2.99 (t, J = 11.9 Hz, 1H), 2.77 (s, 2H), 2.47 - 2.41 (m, 1H), 2.18 - 2.12 (m, 3H), 1.78 (d, J = 13.0 Hz, 2H), 1.47 (d, J = 12.6 Hz, 2H), 1.43 - 1.36 (m, 9H), 1.23 (s, 1H). UPLC-MS (basic 2 min): Rt = 1.12 min; m/z = 721.3 for [M+H] ⁺

[0001433] Step 8: tert-butyl 4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperid ine-1-carboxylate

[0001434] To a magnetically stirred solution of 4-[[3-[[2-[3-[(E)-N'- acetoxycarbamimidoyl]phenyl]-l-(l,3-benzothiazol-2- yl)ethyl]sulfamoyl]phenyl]carbamoyl]piperidine-l-carboxylate (0.261 g, 0.362 mmol, 1.0 eq.) in acetic acid (5 mL) was added zinc (0.473 g, 7.24 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 40.5 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was then submitted to Reach for chiral purification via SEC on a Lux C4 (21.2mm x 250mm, 5um), eluting with 50:50 EtOH:CO ₂

(+0.2% v/v NH ₃ ) to afford product (21.7mg, 0.0324 mmol, 8% yield) as a white solid. UPLC- MS (acidic 2.5 min): Rt = 1.26 min; m/z = 663.2 for [M+H] ⁺

[0001435] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]piperidine-4-carb oxamide

[0001436] To tert-butyl 4-[[3-l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]piperid ine-1-carboxylate (16.0 mg, 0.0239 mmol, 1.0 eq.) was added 4 N HC1 in 1,4-dioxane solution (1.0 mL, 4.00 mmol, 167 eq.) and the reaction mixture was stirred at RT for 4 h. The reaction mixture was concentrated to dryness, resuspended in water, and concentrated to dryness again to afford the product (11.0 mg, 0.0195 mmol, assumed quantitative yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 10.28 (s, 1H), 9.25 (s, 2H), 9.11 (s, 2H), 8.94 (d, J = 8.1 Hz, 1H), 8.63 (s, 1H), 8.11 - 8.05 (m, 1H), 7.95 - 7.88 (m, 2H), 7.72 (d, J = 2.0 Hz, 1H), 7.58 - 7.39 (m, 6H), 7.23 (t, J = 7.7 Hz, 1H), 7.20 - 7.09 (m, 2H), 5.05 - 4.95 (m, 1H), 3.73 - 3.58 (m, 1H), 3.44 - 3.23 (m, 3H), 3.03 (dd, J = 13.9, 10.2 Hz, 1H), 3.00 - 2.88 (m, 2H), 2.68 (t, J = 11.1 Hz, 1H), 2.00 (d, J = 13.8 Hz, 2H), 1.83 (q, J = 12.4 Hz, 2H). UPLC-MS (acidic 6 mm): Rt = 1.46 mm; m/z = 563.3 for [M+H] ⁺ , 100% purity.

Example 73: Exemplary synthesis of Compound 237

[0001437] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001438] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (9.30 g, 27.6 mmol, 1.0 eq.) in toluene (162 mL) were added T3P (16.0 mL, 27.6 mmol, 1.0 eq.), 2-amino-5-methoxy-benzenethiol (4.71 g, 30.3 mmol, 1.1 eq.), and DIPEA (14.0 mL, 82.7 mmol, 3.0 eq.). The resulting mixture was stirred at RT for 30 min, then at 110 °C for 2 h. The reaction mixture was cooled to RT, quenched via the addition of 10% (w/v) aq. citric acid (100 mL) and stirred for 30 min. The phases were separated, and the organics were washed with aq. saturated Na ₂ CO ₃ (200 mL) and brine (200 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in heptane to afford the product (5.25 g, 12.8 mmol, 47% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4

Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.22 min; m/z =410.0 for [M+H]+

[0001439] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride

[0001440] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (5.25 g, 12.8 mmol, 1.0 eq.) in DCM (50 mb) was added trifluoroacetic acid (50.0 mL, 653 mmol, 51.0 eq.) and the resultant solution was stirred at RT for 1 h. The reaction mixture was concentrated to dryness. The residue was suspended in DCM (50 mL) and to it was added K ₂ CO ₃ (12.3 g) in water (50 mL) portionwise over 10 min. The reaction mixture was stirred at RT for 30 min. The phases were separated, and the organics were extracted with DCM (3 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was suspended in DCM (20 mL), and to it was added K ₂ CO ₃ (7.80 g) in water (20 mL) and the resultant mixture was stirred at RT for 2 h. The phases were separated, and the organics were extracted with DCM (3 x 20 mL) and dried over anhydrous sodium sulfate before being filtered and concentrated to dryness to afford the product (3.97 g, 12.1 mmol, 94% yield) as a brown oil, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 7.83 - 7.72 (m, 2H), 7.67 (d, J = 7.8 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.09 - 7.02 (m, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.2 Hz, 3H), 3.37 (dd, J = 13.6, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 309.9 for [M+H]+

[0001441] 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile (2.49 g, 7.57 mmol) was suspended in 4 N HC1 in 1,4-dioxane (10.0 mL, 40.0 mmol, 5.3 eq.) and the suspension was stirred at RT for 2 h. The reaction mixture was then triturated with diethyl ether (30 mL), before filtering and rinsing with copious diethyl ether to afford the product (2.11 g, 5.19 mmol, 69% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.01 (s, 3H), 7.93 (d, J = 9.0 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.75 (dt, J = 7.6, 1.4 Hz, 1H), 7.72 (d, J = 2.6 Hz, 1H), 7.58 (dt, J = 8.0, 1.5 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 7.15 (dd, J = 9.0, 2.6 Hz, 1H), 5.27

(s, 1H), 3.83 (s, 3H), 3.50 (dd, J = 13.9, 6.1 Hz, 1H), 3.43 - 3.30 (m, 1H). UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 310.0 for [M+H]+

[0001442] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-oxo-4H- 1 ,4-benzoxazine-6-sulfonamide

[0001443] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (600 mg, 1.73 mmol, 1.0 eq.) in DMF (12 mL) was added triethylamine (0.73 mL, 5.20 mmol, 3.0 eq.) and the resultant mixture was cooled to 0 °C. 3-oxo-4H-l,4- benzoxazine-6-sulfonyl chloride (516 mg, 2.08 mmol, 1.2 eq.) was added portionwise over 10 min, and the reaction mixture was allowed to gradually warm to RT for 4 h. The reaction was then quenched via the addition of water (50 mL) and diluted with ethyl acetate (75 mL). After separation of the phases, the organic was washed with saturated aqueous Na ₂ CO ₃ solution (50 mL) and brine (50 mL). The organics were then dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude was then dissolved in the minimum amount of DCM and upon addition of iso-hexane, a precipitate formed. The solid was collected and dried in air to afford the product (229 mg, 0.442 mmol, 25% yield) as a beige solid. ¹ H NMR (400 MHz, DMSO-d6) 5 10.77 (s, 1H), 8.85 (s, 1H), 7.80 (dd, J = 9.0, 4.4 Hz, 1H), 7.65 (s, 1H), 7.60 (s, 1H), 7.55 (d, J = 7.9 Hz, 2H), 7.36 - 7.29 (m, 1H), 7.08 (d, J = 9.0 Hz, 1H), 6.97 (d, J = 5.9 Hz, 1H), 6.92 (s, 1H), 6.74 (dd, J = 8.4, 4.5 Hz, 1H), 4.86 (s, 1H), 4.66 - 4.51 (m, 2H), 3.82 (d, J = 4.3 Hz, 3H), 2.98 (t, J = 13.2 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.02 mm; m/z = 521.2 for [M+H] ⁺

[0001444] Step 4: N'-hydroxy-3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(3-oxo- 4H-l,4- benzoxazin-6-yl)sulfonylamino]ethyl]benzamidine

[0001445] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-oxo-4H-l,4-benzoxazine-6-sulfonam ide (229 mg, 0.440 mmol, 1.0 eq.) in ethanol (4 mL) was added hydroxylammonium chloride (61.1 mg, 0.880 mmol, 2.0 eq.) and DIPEA (0.23 mL, 1.32, 3.0 eq.) with the resultant mixture heated to 85 °C for 18 h. The mixture was cooled to RT and concentrated to dryness under reduced pressure to afford the product (414 mg, 0.748 mmol, assumed quantitative yield) as a pale yellow solid which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.94 min; m/z = 554.2 for [M+H] ⁺

[0001446] Step 5 ^: [(E)-[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(3-ox o-4H-l,4- benzoxazin-6-yl)sulfonylamino]ethyl]phenyl]methylene]amino] acetate

[0001447] To a magnetically stirred solution of N'-hydroxy-3-[2-(6-methoxy-l,3-benzothiazol- 2-yl)-2-[(3-oxo-4H-l,4-benzoxazin-6-yl)sulfonylamino]ethyl]b enzamidine (243 mg, 0.439 mmol, 1.0 eq.) in acetic acid (5 mL) was added acetic anhydride (0.12 mL, 1.32 mmol, 3.0 eq.) and the resultant mixture was stirred at RT for 18 h. The reaction mixture was concentrated before the residue was purified by normal phase column chromatography (20 g cartridge) eluting with a gradient of 0-75% EtOAc in DCM followed by 75% EtOAc in 4: 1 DCM:MeOH, to afford the product (116 mg, 0.195 mmol, 44% yield) as a yellow oil. ^! H NMR (400 MHz, DMSO-d6) 5 10.67 (s, 1H), 8.80 (s, 1H), 7.77 (t, J = 8.6 Hz, 1H), 7.60 (t, J = 7.7 Hz, 2H), 7.48 (s, 1H), 7.29 - 7.17 (m, 2H), 7.06 (s, 1H), 7.01 - 6.93 (m, 2H), 6.71 (d, J = 8.0 Hz, 3H), 4.83 (s, 1H), 4.51 (t, J = 8.2 Hz, 2H), 3.82 (d, J = 8.4 Hz, 3H), 3.02 (s, 1H), 2.15 (d, J = 8.1 Hz, 3H). UPLC-MS (basic 2 min): Rt = 1.01 min; m/z = 596.1 for [M+H] ⁺

[0001448] Step 6: 3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(3-oxo-4H-l,4-benz oxazin-6- yl)sulfonylamino]ethyl]benzamidine

[0001449] To a magnetically stirred solution of [(E)-[amino-[3-[2-(6-methoxy-l,3- benzothiazol-2-yl)-2-[(3-oxo-4H-l,4-benzoxazin-6- yl)sulfonylamino]ethyl]phenyl]methylene]amino] acetate (116 mg, 0.195 mmol, 1.0 eq.) in acetic acid (10 mL) was added zinc (255 mg, 3.89 mmol, 20.0 eq.) and the resultant suspension was stirred at RT for 72 h. The reaction was redosed with zinc (127 mg, 1.95 mmol, 10.0 eq.) three times and stirred at RT for 18 h after each redose. The reaction was redosed a final time with zinc (255 mg, 3.89 mmol, 20.0 eq.) and stirred at RT for 18 h. The reaction mixture was then filtered through Celite, washing with copious acetonitrile, ethanol and DCM before concentrating to dryness. The residue was then submitted to Reach for chiral purification via

SFC on a Lux C2 (20 mm x 250 mm, 5 um), eluting with 60:40 MeOH:CO ₂ (0.2% v/v NH ₃ ) to afford the product (41 mg, 0.0768 mmol, 40% yield) as a white solid. UPLC-MS (acidic 6 min): Rt = 1.83 mm; m/z = 538.3 for [M+H] ⁺

[0001450] Step 7: 3-[rac-(2R)-2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(3-oxo-4H -l,4- benzoxazin-6-yl)sulfonylamino]ethyl]benzamidine hydrochloride

[0001451] To a magnetically stirred solution of 3-[rac-(2R)-2-(6-methoxy-l,3-benzothiazol-2- yl)-2-[(3-oxo-4H-l,4-benzoxazin-6-yl)sulfonylamino]ethyl]ben zamidine (41.0 mg, 0.0768 mmol, 1.0 eq) in 1,4-Dioxane (2.0 mL) was added hydrogen chloride 4 N in 1,4-dioxane (1.0 mL, 28.8 mmol, 375 eq.) and the resultant suspension was stirred at RT for 1 h. This was repeated 2 more times before being concentrated under reduced pressure a final time. The wet product was dissolved in water/MeCN (40:60) and concentrated under reduced pressure, before being dried in the vacuum oven overnight to afford the product (30.0 mg, 0.0558 mmol, 73% yield) as a beige solid. ¹ H NMR (400 MHz, DMSO-d6) 5 10.72 (s, 1H), 9.18 (s, 2H), 8.87 (s, 2H), 8.77 (d, J = 8.4 Hz, 1H), 7.78 - 7.73 (m, 2H), 7.61 (dd, J = 7.2, 2.1 Hz, 2H), 7.50 (d, J = 7.6 Hz, 1H), 7.38 (t, J = 7.7 Hz, 1H), 7.09 - 7.05 (m, 1H), 6.99 - 6.93 (m, 2H), 6.69 (d, J = 7.9 Hz, 1H), 4.93 (td, J = 9.6, 5.1 Hz, 1H), 4.57 - 4.45 (m, 2H), 3.82 (s, 3H), 3.06 (dd, J = 13.6, 9.8 Hz, 1H). UPLC-MS (acidic 6 min): Rt = 1.82 min; m/z = 538.3 for [M+H] ⁺ , 97% purity.

Example 74: Exemplary synthesis of Compound 237

[0001452] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001453] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (9.30 g, 27.6 mmol, 1.0 eq.) in toluene (162 mL) were added T3P (16.0 mL, 27.6 mmol, 1.0 eq.), 2-amino-5-methoxy-benzenethiol (4.71 g, 30.3 mmol, 1.1 eq.), and DIPEA (14.0 mL, 82.7 mmol, 3.0 eq.). The resulting mixture was stirred at RT for 30 min, then at 110 °C for 2 h. The reaction mixture was cooled to RT, quenched via the addition of 10% (w/v) aq. citric acid (100 mL) and stirred for 30 min. The phases were separated, and the organics were washed with aq. saturated Na ₂ CO ₃ (200 mL) and brine (200 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in heptane to afford the product (5.25 g, 12.8 mmol, 47% yield) as a beige solid. 1H NMR (400 MHz, DMSO-d6) 5 7.84 (d, J = 8.9 Hz, 2H), 7.78 (s, 1H), 7.72 - 7.62 (m, 3H), 7.51 (t, J = 7.7 Hz, 1H), 7.09 (dd, J = 8.9, 2.6 Hz, 1H), 5.18 - 4.96 (m, 1H), 3.82 (s, 3H), 3.51 (dd, J = 13.8, 4.4 Hz, 1H), 3.10 (dd, J = 13.8, 11.0 Hz, 1H), 1.29 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.22 mm; m/z =410.0 for [M+H]+

[0001454] Step 2: 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride

[0001455] To a magnetically stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy- l,3-benzothiazol-2-yl)ethyl]carbamate (5.25 g, 12.8 mmol, 1.0 eq.) in DCM (50 mb) was added trifluoroacetic acid (50.0 mL, 653 mmol, 51.0 eq.) and the resultant solution was stirred at RT for 1 h. The reaction mixture was concentrated to dryness. The residue was suspended in DCM (50 mL) and to it was added K ₂ CO ₃ (12.3 g) in water (50 mL) portionwise over 10 min. The reaction mixture was stirred at RT for 30 min. The phases were separated, and the organics were extracted with DCM (3 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was suspended in DCM (20 mL), and to it was added K ₂ CO ₃ (7.80 g) in water (20 mL) and the resultant mixture was stirred at RT for 2 h. The phases were separated, and the organics were extracted with DCM (3 x 20 mL) and dried over anhydrous sodium sulfate before being filtered and concentrated to dryness to afford the product (3.97 g, 12.1 mmol, 94% yield) as a brown oil, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 7.83 - 7.72 (m, 2H), 7.67 (d, J = 7.8 Hz, 1H), 7.64 - 7.55 (m, 2H), 7.47 (t, J = 7.7 Hz, 1H), 7.09 - 7.02 (m, 1H), 4.42 (dd, J = 8.7, 4.8 Hz, 1H), 3.82 (d, J = 1.2 Hz, 3H), 3.37 (dd, J = 13.6, 4.8 Hz, 1H), 2.99 (dd, J = 13.6, 8.7 Hz, 1H), 2.35 (s, 2H). UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 309.9 for [M+H]+

[0001456] 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2-yl)ethyl]benzonit rile (2.49 g, 7.57 mmol) was suspended in 4 N HC1 in 1,4-dioxane (10.0 mL, 40.0 mmol, 5.3 eq.) and the suspension was stirred at RT for 2 h. The reaction mixture was then triturated with diethyl ether (30 mL), before filtering and rinsing with copious diethyl ether to afford the product (2.11 g, 5.19 mmol, 69% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 9.01 (s, 3H), 7.93 (d, J = 9.0 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.75 (dt, J = 7.6, 1.4 Hz, 1H), 7.72 (d, J = 2.6 Hz, 1H), 7.58 (dt, J = 8.0, 1.5 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 7.15 (dd, J = 9.0, 2.6 Hz, 1H), 5.27 (s, 1H), 3.83 (s, 3H), 3.50 (dd, J = 13.9, 6.1 Hz, 1H), 3.43 - 3.30 (m, 1H). UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 310.0 for [M+H]+

[0001457] Step 3: N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2-yl)ethy l]-3-oxo-4H- 1 ,4-benzoxazine-6-sulfonamide

[0001458] To a magnetically stirred solution of 3-[2-amino-2-(6-methoxy-l,3-benzothiazol-2- yl)ethyl]benzonitrile (600 mg, 1.73 mmol, 1.0 eq.) in DMF (12 mL) was added triethylamine (0.73 mL, 5.20 mmol, 3.0 eq.) and the resultant mixture was cooled to 0 °C. 3-oxo-4H-l,4- benzoxazine-6-sulfonyl chloride (516 mg, 2.08 mmol, 1.2 eq.) was added portionwise over 10 min, and the reaction mixture was allowed to gradually warm to RT for 4 h. The reaction was then quenched via the addition of water (50 mL) and diluted with ethyl acetate (75 mL). After separation of the phases, the organic was washed with saturated aqueous Na ₂ CO ₃ solution (50 mL) and brine (50 mL). The organics were then dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude was then dissolved in the minimum amount of DCM and upon addition of iso-hexane, a precipitate formed. The solid was collected and dried in air to afford the product (229 mg, 0.442 mmol, 25% yield) as a beige solid. (400 MHz, DMSO-d6) 5 10.77 (s, 1H), 8.85 (s, 1H), 7.80 (dd, J = 9.0, 4.4 Hz, 1H), 7.65 (s, 1H), 7.60 (s, 1H), 7.55 (d, J = 7.9 Hz, 2H), 7.36 - 7.29 (m, 1H), 7.08 (d, J = 9.0 Hz, 1H), 6.97 (d, J = 5.9 Hz, 1H), 6.92 (s, 1H), 6.74 (dd, J = 8.4, 4.5 Hz, 1H), 4.86 (s, 1H), 4.66 - 4.51 (m, 2H), 3.82 (d, J = 4.3 Hz, 3H), 2.98 (t, J = 13.2 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.02 mm; m/z = 521.2 for [M+H] ⁺

[0001459] Step 4: N'-hydroxy-3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(3-oxo- 4H-l,4- benzoxazin-6-yl)sulfonylamino]ethyl]benzamidine

[0001460] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3- benzothiazol-2-yl)ethyl]-3-oxo-4H-l,4-benzoxazine-6-sulfonam ide (229 mg, 0.440 mmol, 1.0 eq.) in ethanol (4 mL) was added hydroxylammonium chloride (61.1 mg, 0.880 mmol, 2.0 eq.) and DIPEA (0.23 mL, 1.32, 3.0 eq.) with the resultant mixture heated to 85 °C for 18 h. The mixture was cooled to RT and concentrated to dryness under reduced pressure to afford the product (414 mg, 0.748 mmol, assumed quantitative yield) as a pale yellow solid which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.94 min; m/z = 554.2 for [M+H] ⁺

[0001461] Step 5: [(E)-[amino-[3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(3-ox o-4H-l,4- benzoxazin-6-yl)sulfonylamino]ethyl]phenyl]methylene]amino] acetate

To a magnetically stirred solution of N'-hydroxy-3-[2-(6-methoxy-l,3-benzothiazol-2-yl)-2-[(3- oxo-4H-l,4-benzoxazin-6-yl)sulfonylamino]ethyl]benzamidine (243 mg, 0.439 mmol, 1.0 eq.) in acetic acid (5 mL) was added acetic anhydride (0.12 mL, 1.32 mmol, 3.0 eq.) and the resultant mixture was stirred at RT for 18 h. The reaction mixture was concentrated before the residue was purified by normal phase column chromatography (20 g cartridge) eluting with a gradient of 0- 75% EtOAc in DCM followed by 75% EtOAc in 4: 1 DCM:MeOH, to afford the product (116 mg, 0.195 mmol, 44% yield) as a yellow oil. ¹ H NMR (400 MHz, DMSO-d6) 5 10.67 (s, 1H), 8.80 (s, 1H), 7.77 (t, J = 8.6 Hz, 1H), 7.60 (t, J = 7.7 Hz, 2H), 7.48 (s, 1H), 7.29 - 7.17 (m, 2H), 7.06 (s, 1H), 7.01 - 6.93 (m, 2H), 6.71 (d, J = 8.0 Hz, 3H), 4.83 (s, 1H), 4.51 (t, J = 8.2 Hz, 2H), 3.82 (d, J = 8.4 Hz, 3H), 3.02 (s, 1H), 2.15 (d, J = 8.1 Hz, 3H). UPLC-MS (basic 2 mm): Rt = 1.01 min; m/z = 596.1 for [M+H] ⁺

Step 6: 3- [2-(6-methoxy- 1 , 3 -benzothiazol-2-yl)-2- [(3 -oxo-4H- 1 ,4-benzoxazin-6- yl)sulfonylamino]ethyl]benzamidine

[0001462] To a magnetically stirred solution of [(E)-[amino-[3-[2-(6-methoxy-l,3- benzothiazol-2-yl)-2-[(3-oxo-4H-l,4-benzoxazin-6- yl)sulfonylamino]ethyl]phenyl]methylene]amino] acetate (116 mg, 0.195 mmol, 1.0 eq.) in acetic acid (10 mL) was added zinc (255 mg, 3.89 mmol, 20.0 eq.) and the resultant suspension was stirred at RT for 72 h. The reaction was redosed with zinc (127 mg, 1.95 mmol, 10.0 eq.) three times and stirred at RT for 18 h after each redose. The reaction was redosed a final time with zinc (255 mg, 3.89 mmol, 20.0 eq.) and stirred at RT for 18 h. The reaction mixture was then filtered through Celite, washing with copious acetonitrile, ethanol and DCM before concentrating to dryness. The residue was then submitted to Reach for chiral purification via

SFC on a Lux C2 (20 mm x 250 mm, 5 um), eluting with 60:40 MeOH:CO ₂ (0.2% v/v NH ₃ ) to afford the product (34 mg, 0.0623 mmol, 32% yield) as a white solid.

[0001463] ¹ H NMR (400 MHz, DMSO-d6) 5 10.72 (s, 1H), 9.19 (s, 2H), 8.90 (s, 2H), 8.77 (d, J = 8.3 Hz, 1H), 7.77 - 7.74 (m, 2H), 7.61 (dd, J = 6.6, 2.4 Hz, 2H), 7.50 (d, 1H), 7.37 (t, J = 7.7 Hz, 1H), 7.07 (dd, J = 8.9, 2.6 Hz, 1H), 6.99 - 6.96 (m, 2H), 6.69 (d, 1H), 4.98 - 4.88 (m, 1H), 4.57 - 4.45 (m, 2H), 3.82 (s, 3H), 3.36 - 3.33 (m, 1H), 3.06 (dd, J = 13.9, 9.9 Hz, 1H). - mono- HC1 salt

[0001464] UPLC-MS (acidic 6 min): Rt = 1.82 min; m/z = 538.3 for [M+H] ⁺ , 90% purity.

Example 75: Exemplary synthesis of Compound 241

[0001465] Step 1 : tert-butyl N-[2-(3-cyanophenyl)-l-(6-methoxy-l,3-benzothiazol-2- y 1) ethyl] carbamate

[0001466] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (8.14 g, 28.0 mmol, 1.0 eq.) in toluene (167 mL) were added T3P (20.0 mL, 33.6 mmol, 1.2 eq.), 2-aminothiphenol (3.3 mL, 30.8 mmol, 1.1 eq.) and DIPEA (7.3 mL, 42.0 mmol, 1.5 eq.). The resulting mixture was stirred at RT for 20 min then at reflux for 16 h. The reaction mixture was cooled to RT and then acidified to pH 2-3 via the addition of 10% (w/v) aqueous citric acid (ca. 200 mL). The organics were then extracted with EtOAc (3 x 125 mL), washed with brine (125 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-30% EtOAc in DCM to afford the product (4.50 g, 11.9 mmol, 42% yield) as a pale-yellow solid. 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.99 (d, J = 8.1 Hz, 1H), 7.92 (d, J = 8.8 Hz, 1H), 7.82 (s, 1H), 7.72 (dd, J = 7.7, 1.7 Hz, 2H), 7.53 (ddd, J = 9.5, 5.6, 2.5 Hz, 2H), 7.48 - 7.41 (m, 1H), 5.17 (ddd, J = 10.9, 8.7, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.4 Hz, 1H), 3.14 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 7H). UPLC- MS (basic 2 min) Rt = 1.22 min. m/z = 380.1 for [M+H]+

[0001467] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001468] To tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e (4.50 g, 11.9 mmol, 1.0 eq.) was added 4 N HC1 in 1,4-dioxane (45.0 mL, 180 mmol, 15.2 eq.) and the reaction mixture was stirred at RT for 18 h. The reaction mixture was then concentrated to dryness to afford the product (2.94 g, 9.32 mmol, 79% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.13 (d, J = 5.4 Hz, 3H), 8.18 - 8.13 (m, 1H), 8.08 - 8.03 (m, 1H), 7.84 - 7.81 (m, 1H), 7.74 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.55 (m, 2H), 7.54 - 7.46 (m, 2H), 5.39 - 5.29 (m, 1H), 3.55 (dd, J = 13.8, 6.1 Hz, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H). UPLC-MS (basic 2 min) Rt = 1.03 min. m/z = 280.0 for [M+H] ⁺

[0001469] Step 3: methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001470] A magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (2.28 g, 7.23 mmol, 1.0 eq.) and triethylamine (3 mL, 21.7 mmol, 3.0 eq.) in DMF (25 mL) was cooled to 0 °C and stirred for 10 min. To the reaction mixture was added methyl 3 -chlorosulfonylbenzoate (2.04 g, 8.67 mmol, 1.2 eq.) portionwise over 10 min. The resulting suspension was stirred at 0 °C for 30 min, then gently warmed to RT and stirred for 4 h. The reaction mixture was quenched via the addition of water (100 mL) and diluted with ethyl acetate (150 mL). After separation of the phases, the organics were washed with further water (3 x 100 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was then triturated with DCM, filtered, and allowed to air dry to afford the product (2.46 g, 5.15 mmol, 71% yield). 1H NMR (400 MHz, DMSO-d6) 5 9.15 (s, 1H), 8.10 - 8.03 (m, 1H), 7.94 - 7.82 (m, 3H), 7.73 (dt, J = 8.0, 1.3 Hz, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.55 - 7.40 (m, 5H), 7.22 (t, J = 7.7 Hz, 1H), 5.07 (d, J = 10.5 Hz, 1H), 3.88 (s, 3H), 3.39 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.14 mm. m/z = 478.0 for [M+H]+

[0001471] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001472] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (2.46 g, 5.05 mmol, 1.0 eq.) in THF (50 mL) was added a solution of lithium hydroxide (0.640 g, 15.1 mmol, 3.0 eq.) in water (15 mL) and the resulting mixture was stirred at RT for 5 h. The reaction mixture was concentrated to dryness and the residue was diluted with ethyl acetate (50 mL) and water (50 mL). The organics were extracted into EtOAc (50 mL) and washed with water (50 mL). The aqueous phases were combined and acidified to pH 2.0 by the addition of 1 M HC1 (ca. 25 mL), extracted with ethyl acetate (100 mL) and EtOAc (250 mL)/MeOH (20 mL). The organics were washed with brine (250 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The emulsion that remained in the aqueous phase was isolated and extracted with EtOAc (250 mL), followed by dilution with water (100 mL) and subsequent addition of 3:1 DCM/MeOH (100 mL). The biphasic mixture was concentrated to remove the organics, then the precipitate from the aqueous phase was filtered. All solid product was combined to afford the product (1.51 g, 2.90 mmol, 57% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 13.31 (s, 1H), 9.16 - 9.06 (m, 1H), 8.11 - 8.04 (m, 1H), 7.92 (dq, J = 2.8, 1.6 Hz, 2H), 7.90 (q, J = 1.4 Hz, 1H), 7.69 - 7.64 (m, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.54 - 7.48 (m, 2H), 7.46 - 7.37 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 5.06 (ddd, J = 10.8, 8.5, 4.4 Hz, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 0.87 mm. m/z = 464.0 for [M+H]+

[0001473] Step 5: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]-N-(2- methoxyethyl)-N-methyl-benzamide

[0001474] To a magnetically stirred solution of 33-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (500 mg, 1.8 mmol, 1.0 eq.) in DMF (5mL) were added N-(2-Methoxyethyl)methylamine (0.1 mL, 1.29 mmol, 1.2 eq.), DIPEA (0.5 mL, 2.67 mmol, 3.0 eq.) and HATU (615 mg, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 4.5 h. The reaction mixture was diluted with ethyl acetate (25 mL), washed with brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25mL). The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 60-100% EtOAc in iso-hexane to afford product (420 mg, 0.768 mmol, 71% yield) as a colourless glass. 1H NMR (400 MHz, DMSO-d6) 5 9.07 (s, 1H), 8.04 (d, J = 8.0 Hz, 1H), 7.91 (d, J = 8.1 Hz, 1H), 7.68 (s, 1H), 7.60 - 7.46 (m, 5H), 7.42 (d, J = 7.1 Hz, 2H), 7.33 (d, J = 9.1 Hz, 2H), 5.05 (s, 1H), 3.55 (s, 3H), 3.17 (s, 3H), 3.04 (t, J = 12.1 Hz, 2H), 2.95 (s, 2H), 2.75 (s, 2H). UPLC-MS (basic 2 mm) Rt = 1.10 mm. m/z = 535.1 for [M+H]+

[0001475] Step 6: 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]-N-(2-methoxyeth yl)-N-methyl-benzamide

[0001476] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]-N-(2-methoxyethyl)-N-methyl-ben zamide (415 mg, 0.768 mmol, 1.0 eq.) in EtOH (10 mL) were added hydroxylamine hydrochloride (0.107 g, 1.54 mmol, 2.0 eq.) and DIPEA (0.4 mL, 2.31 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for

18 h. The reaction mixture was cooled to RT and then concentrated to dryness to afford product (720 mg, 1.27 mmol, assumed quantitative yield) as a colourless oil, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 0.98 min. m/z = 568.2 for [M+H]+

[0001477] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[2- methoxyethyl(methyl)carbamoyl]phenyl]sulfonylamino]ethyl]phe nyl]methylene]amino] acetate

[0001478] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]-N-(2-methoxyeth yl)-N-methyl-benzamide (720 mg, 1.27 mmol, 1.0 eq.) in acetic acid (7 mL) was added acetic anhydride (0.4 mL, 3.80 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 6 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in DCM, followed by addition of 0-25% 8:2 DCM/MeOH to afford product (171 mg, 0.272 mmol, 21% yield) as a colourless glass. 1H NMR (400 MHz, DMSO-d6) 5 9.06 (s, 1H), 8.02 (d, J = 7.9 Hz, 1H), 7.91 (d, J = 8.0 Hz, 1H), 7.61 (s, 1H), 7.56 (d, J = 21.4 Hz, 1H), 7.51 - 7.44 (m, 3H), 7.41 (t, J = 7.9 Hz, 2H), 7.27 (t, J = 7.7 Hz, 2H), 7.16 (t, J = 7.7 Hz, 1H), 6.75 (s, 2H), 5.02 (s, 1H), 3.55 (s, 2H), 3.30 (d, J = 0.8 Hz, 4H), 3.17 (s, 2H), 3.04 (dd, J = 13.9, 9.7 Hz, 1H), 2.94 (s, 1H), 2.72 (s, 1H), 2.14 (s, 3H). UPLC-MS (basic 2 min): Rt = 0.99 min; m/z = 610.2 for [M+H]+

[0001479] Step 8: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylphenyl)ethyl ]sulfamoyl]- N-(2-methoxyethyl)-N-methyl-benzamide

[0001480] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [[3-[2-methoxyethyl(methyl)carbamoyl]phenyl]sulfonylamino]et hyl]phenyl]methylene]amino] acetate (171 mg, 0.272 mmol, 1.0 eq.) in acetic acid (4 mL) was added zinc (356 mg, 5.44 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 18 h, then re-dosed with zinc (356 mg, 5.44 mmol, 20.0 eq.) and stirred at RT for 27.5 h. The reaction mixture was re-dosed again with zinc (356 mg, 5.44 mmol, 20.0 eq.) and stirred at RT for 17.5 h. The reaction mixture was filtered through Celite, washing with copious MeCN and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative-HPLC using C2 XB ridge BEH C18 eluting with 5- 100% MeCN (+ 0.1% NH ₄ OH) in water (10 mM NH ₄ CO ₃ + 0.1% NH ₃ ) to afford the product (54.0 mg, 0.0940 mmol, 35% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6, VT) 5 7.94 (dd, J = 7.8, 1.3 Hz, 1H), 7.89 - 7.82 (m, 1H), 7.68 (s, 1H), 7.59 (s, 1H), 7.56 (d, J = 7.5 Hz, 1H), 7.51 (d, J = 7.7 Hz, 1H), 7.44 (ddd, J = 8.2, 7.2, 1.3 Hz, 1H), 7.38 - 7.24 (m, 4H), 7.20 (t, J = 7.6 Hz, 1H), 4.97 (dd, J = 8.5, 5.5 Hz, 1H), 3.45 (s, 4H), 3.30 (dd, J = 13.8, 5.5 Hz, 1H), 3.24 (s, 3H), 3.10 (dd, J = 13.6, 8.5 Hz, 1H), 2.85 (s, 3H). UPLC-MS (acidic 6 mm): Rt = 2.04 min; m/z = 552.3 for [M+H]+, 96% purity

Example 76: Exemplary synthesis of Compound 242

[0001481] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001482] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (16.0 g, 55.1 mmol, 1.0 eq.) and 2- Aminothiophenol (6.5 mL, 60.6 mmol, 1.1 eq.) in Toluene (300 mL) was added DIPEA (14.0 mL, 82.7 mmol, 1.5 eq.) and T3P (25.0 mL, 41.3 mmol, 0.75 eq.). The reaction was heated to 115 °C and stirred for 8.5 h. The reaction mixture was re-dosed with T3P (25.0 mL, 41.3 mmol, 0.75 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction was concentrated to dryness to give a residue, which was dissolved in EtOAc (200 mL). The resulting solution was washed sequentially with aq. saturated Na ₂ CO ₃ (2 x 100 mL) and brine (100 mL). The organic fraction was dried over anhydrous MgSCU and concentrated to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (7.12 g, 18.8 mmol, 34% yield) as a brown solid. UPLC-MS (basic 2 min): Rt = 1.23 mm; m/z = 280.0 for [M-Boc]+ 1H NMR (400 MHz, DMSO-d6) 5 8.05 (d, 1H), 7.94 (dt, J = 8.0, 1.1 Hz, 1H), 7.88 (d, J = 8.7 Hz, 1H), 7.77 (t, J = 1.8 Hz, 1H), 7.67 (dd, J = 7.8, 1.7 Hz, 2H), 7.52 - 7.45 (m, 2H), 7.40 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.12 (ddd, J = 11.1, 8.8, 4.3 Hz, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.10 - 3.05 (m, 1H), 1.26 (s, 9H).

[0001483] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001484] Tert-butyl N-[l -(1 ,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamate (7.12 g, 18.8 mmol, 1.0 eq.) was dissolved in 4 N HC1 in 1,4-dioxane (35.0 mL, 18.8 mmol, 1.0 eq.) and the resultant solution was stirred at RT for 21 h. The reaction mixture was then concentrated to dryness to afford the product (6.24 g, 19.8 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 3H), 8.15 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 8.05 (ddd, J = 8.2, 1.2, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.43 (m, 2H), 5.32 (s, 1H), 3.53 (s, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.01 mm; m/z = 280.0 for [M+H]+

[0001485] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001486] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (6.24 g, 19.8 mmol, 1.0 eq.) in DMF (62 mL), cooled to 0 °C, was added triethylamine (9.6 mL, 69.2 mmol, 3.5 eq.) and the resultant solution was stirred for 10 min. To the cooled solution was added 3 -nitrobenzenesulfonyl chloride (5.25 g, 23.7 mmol, 1.2 eq.) portionwise over 10-15 min. The resultant mixture was then gently warmed to RT and stirred for 2 h. The organics were then extracted into EtOAc (300 mL), washed with aq. saturated Na ₂ CO ₃ (250 mL), and water (250 mL). The organics were then dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated to dryness. The residue was triturated with DCM (25 mL) and filtered under vacuum to afford the product (3.83 g, 7.09 mmol, 36% yield) as a beige solid, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.17 mm; m/z = 465.0 for [M+H]+ 1H NMR (400 MHz, DMSO-d6) 5 9.37 (s, 1H), 8.22 - 8.15 (m, 1H), 8.11 - 8.04 (m, 3H), 7.88 (t, J = 6.9 Hz, 2H), 7.64 (d, J = 2.1 Hz, 1H), 7.61 - 7.46 (m, 3H), 7.46 - 7.38 (m, 2H), 7.24 (td, J = 7.8, 2.0 Hz, 1H), 5.17 (d, J = 10.5 Hz, 1H), 3.41 (d, J = 14.2 Hz, 1H), 3.03 (t, J = 12.5 Hz, 1H).

[0001487] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001488] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-nitro-benzenesulfonamide (3.83 g, 7.09 mmol, 1.0 eq.) in ethanol (38 mL) and water (19 mL), under N2, were added ammonium chloride (1.90 g, 35.5 mmol, 5.0 eq.) and iron (3.96 g, 70.9 mmol, 10.0 eq.). The reaction mixture was heated to 85 °C and stirred for 4 h. The reaction mixture was then cooled to RT and filtered through a plug of Celite under vacuum, washing with copious EtOH. The crude solid was dissolved in DCM (60 mL) and washed with aq. saturated Na ₂ CO ₃ (60 mL). The organics were extracted with DCM (2 x 60 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude was re- suspended in EtOH (24 mL) and water (12 mL), followed by addition of iron (1.98 g, 35.5 mmol, 5.0 eq.) and ammonium chloride (0.95 g, 17.7 mmol, 2.5 eq.) at RT. The resultant mixture was heated to 85 °C and stirred for 4.5 h before being cooled to RT. After 18 h of stirred at RT, the reaction mixture was filtered over Celite, rinsed with copious EtOH and DCM and concentrated under reduced pressure. The residue was suspended in EtOAc (50 mL) and washed with aq. saturated Na ₂ CO ₃ (50 mL). The organics were extracted with EtOAc (2 x 50 mL), combined, dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to afford the product (2.13 g, 4.08 mmol, 57% yield) as a brown foam. UPLC-MS (basic 2 min): Rt = 1.09 mm; m/z = 435.1 for [M+H]+ 1H NMR (400 MHz, DMSO-d6) 5 8.73 (s, 1H), 8.11 - 8.06 (m, 1H), 8.00 - 7.88 (m, 1H), 7.57 (d, J = 1.7 Hz, 1H), 7.56 - 7.46 (m, 3H), 7.46 - 7.40 (m, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.54 (m, 2H),

5.40 (s, 2H), 4.93 - 4.86 (m, 1H), 3.40 - 3.32 (m, 1H), 2.98 (dd, J = 13.8, 9.8 Hz, 1H).

[0001489] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl]phenyl]- 2-methoxy-acetamide

[0001490] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (10 mL) was added methoxyacetic acid (0.11 mL, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 5 h. The reaction mixture was concentrated to dryness under reduced pressure and the residue was purified by normal-phase column chromatography over silica (20 g cartridge) eluting with a gradient of EtOAc (40% to 100%; v/v) in iso-hexane to afford the product (397 mg, 0.784 mmol, 68% yield) as a beige solid. UPLC-MS (basic 2 min): Rt = 1.13 min; m/z = 507.0 [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.90 (s, 1H), 8.99 (s, 1H), 8.14 - 8.08 (m, 1H), 7.97 - 7.94 (m, 1H), 7.92 (t, J = 2.0 Hz, 1H), 7.65 (ddd, J = 8.2, 2.2, 1.1 Hz, 1H), 7.57 (t, J = 1.7 Hz, 1H), 7.54 -

7.41 (m, 4H), 7.21 (td, J = 7.8, 4.6 Hz, 2H), 7.16 - 7.12 (m, 1H), 4.95 (d, J = 7.1 Hz, 1H), 4.03 (d, J = 1.0 Hz, 2H), 3.41 (s, 3H), 3.38 - 3.35 (m, 1H), 2.97 (dd, J = 14.0, 10.7 Hz, 1H).

[0001491] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-2-methox y-acetamide

[0001492] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]-2-methoxy-acetamide (397 mg, 0.784 mmol, 1.0 eq.) in EtOH (6 mL) were added hydroxylamine hydrochloride (109 mg, 1.57 mmol, 2.0 eq.) and

DIPEA (0.41 mL, 2.35 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (0.423 g, 0.784 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 0.99 min; m/z = 540.1 for [M+H] ⁺

[0001493] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[(2- methoxyacetyl)amino]phenyl]sulfonylamino]ethyl]phenyl]methyl ene]amino] acetate

[0001494] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-2-methox y-acetamide (423 mg, 0.784 mmol, 1.0 eq.) in acetic acid (5 mL) was added acetic anhydride (0.074 mL, 0.784 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 72 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in iso- hexane to afford the product (272 mg, 0.468 mmol, 60% yield) as a beige glass. UPLC-MS (basic 2 min): Rt = 1.06 min; m/z = 582.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.82 (s, 1H), 8.92 (s, 1H), 8.05 (dd, 1H), 7.96 (t, J = 2.0 Hz, 1H), 7.92 (dd, 1H), 7.60 (dt, J = 7.9, 1.8 Hz, 1H), 7.56 (t, J = 2.1 Hz, 1H), 7.45 (dtd, 4H), 7.22 - 7.06 (m, 5H), 4.93 (s, 1H), 3.99 (s, 2H), 3.38 (s, 3H), 3.29 (dd, 1H), 2.99 (dd, J = 14.0, 9.6 Hz, 1H), 2.15 (s, 3H).

[0001495] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-2-methoxy-acetam ide

[0001496] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [ [3 - [(2-methoxyacetyl)amino]pheny 1] sulfonylamino] ethyl] phenyl] methylene]amino] acetate (272 mg, 0.468 mmol, 1.0 eq.) in acetic acid (10 mL) was added zinc (611 mg, 9.35 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 16 h. The reaction was redosed with Zinc (611 mg, 9.35 mmol, 20.0 eq.) and stirred for 160 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was then submitted to Reach for achiral purification via reverse phase preparative HPLC on a Gemini NX C18 (30mm x

150mm, 5um), eluting with 25-100% MeCN in water (+0.2% v/v NH ₃ ) to afford the product (103 mg, 0.197 mmol, 42% yield) as a white solid. UPLC-MS (acidic 6 min): Rt = 1.94 min; m/z = 524.2 for [M+H] ⁺ , 99% purity 1H NMR (400 MHz, DMSO-d6) 5 7.99 (d, J = 7.8 Hz, 1H), 7.87 (d, J = 8.0 Hz, 2H), 7.62 (s, 1H), 7.60 - 7.56 (m, 1H), 7.47 - 7.42 (m, 2H), 7.36 (t, J = 7.3 Hz, 1H), 7.22 (d, J = 7.4 Hz, 1H), 7.15 - 7.09 (m, 3H), 4.82 (s, 1H), 3.99 (s, 2H), 2.99 (dd, J = 13.7, 8.9 Hz, 1H).

Example 77: Exemplary synthesis of Compound 243

[0001497] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001498] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (16.0 g, 55.1 mmol, 1.0 eq.) in toluene (300 mL) were added 2- aminothiophenol (6.5 mL, 60.6 mmol, 1.1 eq.), T3P (25.0 mL, 41.3 mmol, 0.75 eq.) and DIPEA (14.0 mL, 82.7 mmol, 1.5 eq.). The resulting mixture was stirred at 115 °C for 3.5 h. The reaction mixture was cooled to RT and stirred for 1 h and then a further 5 h at 115 °C. The reaction mixture was re-dosed with T3P (25.0 mL, 41.3 mmol, 0.75 eq.) and stirred at 115 °C for 21 h before being cooled to RT. The reaction mixture was concentrated to dryness and the residue was dissolved in EtOAc (250 mL), washed with aq. saturated Na ₂ CO ₃ (2 x 100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0- 100% EtOAc in DCM, followed by a second purification via normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in DCM, to afford the product (7.12 g, 18.8 mmol, 34% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 8.05 (d, 1H), 7.94 (dt, J = 8.0, 1.1 Hz, 1H), 7.88 (d, J = 8.7 Hz, 1H), 7.77 (t, J = 1.8 Hz, 1H), 7.67 (dd, J =

7.8, 1.7 Hz, 2H), 7.52 - 7.45 (m, 2H), 7.40 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.12 (ddd, J = 11.1,

8.8, 4.3 Hz, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.10 - 3.05 (m, 1H), 1.26 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 280.0 for [M-Boc+H]+

[0001499] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001500] A magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (7.12 g, 18.8 mmol, 1.0 eq.) in 4 N HC1 in 1,4-dioxane (35.0 mL, 140 mmol, 7.4 eq.) and the resultant solution was stirred at RT for 21 h. The reaction mixture was then concentrated to dryness to afford the product (6.24 g, 19.8 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.12 - 8.99 (m, 3H), 8.15 - 8.08 (m, 1H), 8.01 (d, J = 8.0 Hz, 1H), 7.78 (s, 1H), 7.69 (d, J = 7.6 Hz, 1H), 7.57 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.28 (s, 1H), 3.50 (dd,

J = 13.9, 6.3 Hz, 1H), 3.39 - 3.28 (m, 1H). UPLC-MS (basic 2 min): Rt = 1.01 min; m/z = 280.0 for [M+H]+

[0001501] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001502] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (3.00 g, 9.50 mmol, 1.0 eq.) in DMF (25 mL) cooled to 0 °C was added tri ethylamine (4.0 mL, 28.5 mmol, 3.0 eq.) and the reaction mixture was stirred for 10 min. Methyl-3-chlorosulfonylbenzoate (2.67 g, 11.4 mmol, 1.2 eq.) was added portion wise over 10 min and the reaction mixture was allowed to warm to RT and stir for 17 h. The reaction was quenched via the addition of water (100 mL). The organics were extracted with ethyl acetate (3 x 50 mL), washed with aq. saturated Na ₂ CO ₃ (50 mL) and brine (50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, filtered, rinsing with DCM and iso-hexane, and air dried to afford product (2.28 g, 4.77 mmol, 50% yield) as a white solid. 1H NMR (400 MHz, DMSO-D6) 5 9.15 (s, 1H), 8.07 (s, 1H), 7.89 (d, J = 8.6 Hz, 3H), 7.72 (s, 1H), 7.59 (s, 1H), 7.50 (s, 2H), 7.46 - 7.40 (m, 3H), 7.22 (d, J = 8.2 Hz, 1H), 5.07 (s, 1H), 3.88 (d, J = 8.0 Hz, 3H), 3.01 (s, 1H). UPLC-MS (basic 2 min) Rt = 1.20 min. m/z = 478.0 for [M+H]+

[0001503] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001504] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (2.88 g, 6.03 mmol, 1.0 eq.) in THF (50 mL) was added a solution of lithium hydroxide (0.760 g, 18.1 mmol, 3.0 eq.) in water (15 mL) and the resulting mixture was stirred at RT for 4 h. The reaction volume was reduced by half and the reaction was diluted with EtOAc (50 mL) and water (50 mL). The phases were separated, and the aqueous phase was acidified to pH 1.0 via the addition of 1 M HC1 (30 mL). The precipitate was collected by filtration, washing with water, and air dried to afford product (2.18 g, 4.70 mmol, 78% yield) as a white solid, which was used in the next step without further purification. 1H NMR (400

MHz, DMSO-d6) 5 13.33 (s, 1H), 9.13 (d, J = 8.5 Hz, 1H), 8.11 - 8.04 (m, 1H), 7.94 - 7.91 (m, 2H), 7.90 (t, J = 1.4 Hz, 1H), 7.66 (dt, J = 7.9, 1.5 Hz, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.54 - 7.47 (m, 2H), 7.46 - 7.41 (m, 2H), 7.39 (d, J = 7.8 Hz, 1H), 7.23 (t, J = 7.7 Hz, 1H), 5.11 - 5.01 (m, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 4 min) Rt = 1.26 min. m/z = 464.0 for [M+H] ⁺

[0001505] Step 5: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]-N-(3- methoxypropyl)benzamide

[0001506] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (0.500 g, 1.08 mmol, 1.0 eq.) in DMF (7 mL) were added 3 -methoxypropylamine (0.120 g, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.24 mmol, 3.0 eq.) and HATU (0.620 g, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 20 h. The reaction was re-dosed with further 3 -methoxy propylamine (60.0 mg, 0.645 mmol, 0.6 eq.), DIPEA (0.28 mL, 1.62 mmol, 1.5 eq.) and HATU (0.310 g, 0.810 mmol, 0.75 eq.) and stirred at RT for 3 h. The reaction mixture was diluted with EtOAc (50 mL) and water (50 mL). After separation of the phases, the organic fraction was washed with aq. saturated Na ₂ CO ₃ (50 mL) and water (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to dryness to afford the product (666 mg, 1.25 mmol, assumed quantitative yield) as a pale yellow solid that was used without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.08 (d, J = 8.3 Hz, 1H), 8.57 (t, J = 5.6 Hz, 1H), 8.09 (ddd, J = 7.9, 1.4, 0.6 Hz, 1H), 7.97 - 7.92 (m, 3H), 7.88 (ddd, J = 7.8, 1.8, 1.1 Hz, 1H), 7.60 - 7.55 (m, 2H), 7.54 - 7.34 (m, 5H), 7.21 - 7.11 (m, 1H), 5.08 (ddd, J = 10.8, 8.2, 4.2 Hz, 1H), 3.40 (t, J = 6.3 Hz, 2H), 3.33 - 3.29 (m, 1H), 3.26 (s, 3H), 2.97 (dd, J = 13.9, 10.8 Hz, 1H), 1.85 - 1.75 (m, 2H). UPLC-MS (basic 2 mm) Rt = 1.10 mm. m/z = 535.1 for [M+H]+

[0001507] Step 6: 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]-N-(3-methoxypro pyl)benzamide

[0001508] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]-N-(3-methoxypropyl)benzamide (666 mg, 1.25 mmol, 1.0 eq.) in

EtOH (15 mL) were added DIPEA (0.65 mL, 3.74 mmol, 3.0 eq.) and hydroxylamine hydrochloride (0.173 g, 2.49 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 18 h, then cooled to RT and concentrated to dryness to afford product (0.707 g, 1.25 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 568.1 for [M+H]+

[0001509] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(3- methoxypropylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]met hylene]amino] acetate

[0001510] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]-N-(3-methoxypro pyl)benzamide (0.710 g, 1.25 mmol, 1.0 eq.) in acetic acid (6 mL) was added acetic anhydride (0.35 mL, 3.74 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 4 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 10-100% EtOAc in iso-hexane followed by a gradient of 0-50% 4:1 DCM:methanol in ethyl acetate to afford product (0.380 g, 0.623 mmol, 50% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.03 (d, J = 7.6 Hz, 1H), 8.56 (t, J = 5.6 Hz, 1H), 8.06 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.93 - 7.87 (m, 2H), 7.83 - 7.75 (m, 1H), 7.55 (ddd, J = 7.8, 1.9, 1.1 Hz, 1H), 7.53 - 7.47 (m, 2H), 7.45 - 7.41 (m, 1H), 7.41 - 7.35 (m, 1H), 7.34 - 7.27 (m, 1H), 7.23 (d, J = 7.5 Hz, 1H), 7.06 (t, J = 7.7 Hz, 1H), 6.71 (s, 2H), 4.99 (s, 1H), 3.39 (t, J = 6.3 Hz, 2H), 3.32 - 3.29 (m, 3H), 3.25 (s, 3H), 2.98 (dd, J = 13.9, 10.2 Hz, 1H), 2.16 (s, 3H), 1.78 (p, J = 6.6 Hz, 2H) UPLC-MS (basic 2 min): Rt = 0.99 min; m/z = 610.1 for [M+H]+

[0001511] Step 8: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylphenyl)ethyl ]sulfamoyl]- N-(3-methoxypropyl)benzamide

[0001512] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(3- methoxypropylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]met hylene]amino] acetate (0.380 g, 0.623 mmol, 1.0 eq.) in acetic acid (8.4 mL) was added zinc (0.815 g, 12.5 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 20 h. Lurther zinc (0.815 g, 12.5 mmol, 20.0 eq.) and acetic acid (4 mL) were added and the reaction mixture was stirred for a further 20 h at RT. The reaction mixture was filtered over Celite, washing with copious acetonitrile, EtOH and DCM, and concentrated to dryness. The residue was purified by SFC (Lux Cl, 21.2mm x 250mm, 5um) eluting with 35:65 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the 1 ^st eluting enantiomer of the product (93 mg, 0.169 mmol, 27%) as a white solid and the 2 ^nd eluting enantiomer of the product (120 mg, 0.218 mmol, 35%) as a white solid. Each isolated enantiomer was separately achirally repurified via SFC before being suspended in 4 N HC1 in 1,4-dioxane (1.0 mL), stirred for 1 min and concentrated to dryness. This process was repeated twice more before redissolving in MeCN/water, concentrating to dryness and drying in a vacuum oven. 5 mg of each enantiomer was then combined, dissolved in MeCN/water, concentrated and dried in a vacuum oven to afford the racemic product as a white solid. UPLC-MS (acidic 6 min): Rt = 2.00 min; m/z = 552.3 for [M+H]+, 100% purity. 1H NMR (400 MHz, DMSO-d6) 5 9.15 (s, 2H), 9.02 (d, J = 8.2 Hz, 1H), 8.91 (s, 2H), 8.58 (t, J = 5.6 Hz, 1H), 8.13 - 8.05 (m, 1H), 7.94 - 7.88 (m, 2H), 7.82 (d, J = 7.9 Hz, 1H), 7.70 (s, 1H), 7.59 - 7.39 (m, 5H), 7.31 (t, J = 7.8 Hz, 1H), 7.19 (t, J = 7.7 Hz, 1H), 5.13 - 5.02 (m, 1H), 3.40 (m, 3H), 3.31 (q, J = 6.6 Hz, 2H), 3.26 (s, 3H), 3.03 (dd, J = 13.9, 10.4 Hz, 1H), 1.78 (p, J = 6.6 Hz, 2H). HC1 salt.

Example 78: Exemplary synthesis of Compound 243

[0001513] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001514] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (16.0 g, 55.1 mmol, 1.0 eq.) in toluene (300 mL) were added 2- aminothiophenol (6.5 mL, 60.6 mmol, 1.1 eq.), T3P (25.0 mL, 41.3 mmol, 0.75 eq.) and DIPEA (14.0 mL, 82.7 mmol, 1.5 eq.). The resulting mixture was stirred at 115 °C for 3.5 h. The reaction mixture was cooled to RT and stirred for 1 h and then a further 5 h at 115 °C. The reaction mixture was re-dosed with T3P (25.0 mL, 41.3 mmol, 0.75 eq.) and stirred at 115 °C for 21 h before being cooled to RT. The reaction mixture was concentrated to dryness and the residue was dissolved in EtOAc (250 mL), washed with aq. saturated Na ₂ CO ₃ (2 x 100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0- 100% EtOAc in DCM, followed by a second purification via normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in DCM, to afford the product (7.12 g, 18.8 mmol, 34% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 8.05 (d, 1H), 7.94 (dt, J = 8.0, 1.1 Hz, 1H), 7.88 (d, J = 8.7 Hz, 1H), 7.77 (t, J = 1.8 Hz, 1H), 7.67 (dd, J =

7.8, 1.7 Hz, 2H), 7.52 - 7.45 (m, 2H), 7.40 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.12 (ddd, J = 11.1,

8.8, 4.3 Hz, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.10 - 3.05 (m, 1H), 1.26 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 280.0 for [M-boc+H]+

[0001515] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001516] A magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (7.12 g, 18.8 mmol, 1.0 eq.) in 4 N HC1 in 1,4-dioxane (35.0 mL, 140 mmol, 7.4 eq.) and the resultant solution was stirred at RT for 21 h. The reaction mixture was then concentrated to dryness to afford the product (6.24 g, 19.8 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.12 - 8.99 (m, 3H), 8.15 - 8.08 (m, 1H), 8.01 (d, J = 8.0 Hz, 1H), 7.78 (s, 1H), 7.69 (d, J = 7.6 Hz, 1H), 7.57 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.28 (s, 1H), 3.50 (dd, J = 13.9, 6.3 Hz, 1H), 3.39 - 3.28 (m, 1H). UPLC-MS (basic 2 mm): Rt = 1.01 mm; m/z = 280.0 for [M+H]+

[0001517] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001518] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (3.00 g, 9.50 mmol, 1.0 eq.) in DMF (25 mL) cooled to 0 °C was added tri ethylamine (4.0 mL, 28.5 mmol, 3.0 eq.) and the reaction mixture was stirred for 10 min. Methy 1-3 -chlorosulfonylbenzoate (2.67 g, 11.4 mmol, 1.2 eq.) was added portionwise over 10 min and the reaction mixture was allowed to warm to RT and stir for 17 h. The reaction was quenched via the addition of water (100 mL). The organics were extracted with ethyl acetate (3 x 50 mL), washed with aq. saturated Na ₂ CO ₃ (50 mL) and brine (50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, filtered, rinsing with DCM and iso-hexane, and air dried to afford product (2.28 g, 4.77 mmol, 50% yield) as a white solid. 1H NMR analysis (400 MHz, DMSO-D6) 5 9.15 (s, 1H), 8.07 (s, 1H), 7.89 (d, J = 8.6 Hz, 3H), 7.72 (s, 1H), 7.59 (s, 1H), 7.50 (s, 2H), 7.46 - 7.40 (m, 3H), 7.22 (d, J = 8.2 Hz, 1H), 5.07 (s, 1H), 3.88 (d, J = 8.0 Hz, 3H), 3.01 (s, 1H). UPLC-MS (basic 2 min) Rt = 1.20 min. m/z = 478.0 for [M+H]+

[0001519] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001520] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (2.88 g, 6.03 mmol, 1.0 eq.) in THF (50 mL) was added a solution of lithium hydroxide (0.760 g, 18.1 mmol, 3.0 eq.) in water (15 mL) and the resulting mixture was stirred at RT for 4 h. The reaction volume was reduced by half and the reaction was diluted with EtOAc (50 mL) and water (50 mL). The phases were separated and the aqueous phase was acidified to pH 1.0 via the addition of 1 M HC1 (30 mL). The precipitate was collected by filtration, washing with water, and air dried to afford product (2.18 g, 4.70 mmol, 78% yield) as a white solid, which was used in the next step without further purification. 1H NMR analysis (400 MHz, DMSO-d6) 5 13.33 (s, 1H), 9.13 (d, J = 8.5 Hz, 1H), 8.11 - 8.04 (m, 1H), 7.94 - 7.91 (m, 2H), 7.90 (t, J = 1.4 Hz, 1H), 7.66 (dt, J = 7.9, 1.5 Hz, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.54 - 7.47 (m, 2H), 7.46 - 7.41 (m, 2H), 7.39 (d, J = 7.8 Hz, 1H), 7.23 (t, J = 7.7 Hz, 1H), 5.11 - 5.01 (m, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 4 min) Rt = 1.26 min. m/z = 464.0 for [M+H] ⁺

[0001521] Step 5: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]-N-(3- methoxypropyl)benzamide

[0001522] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (0.500 g, 1.08 mmol, 1.0 eq.) in DMF (7 mL) were added 3 -methoxypropylamine (0.120 g, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.24 mmol, 3.0 eq.) and HATU (0.620 g, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 20 h. The reaction was redosed with further 3-methoxypropylamine (60.0 mg, 0.645 mmol, 0.6 eq.), DIPEA (0.28 mL, 1.62 mmol, 1.5 eq.) and HATU (0.310 g, 0.810 mmol, 0.75 eq.) and stirred at RT for 3 h. The reaction mixture was diluted with EtOAc (50 mL) and water (50 mL). After separation of the phases, the organic fraction was washed with aq. saturated Na ₂ CO ₃ (50 mL) and water (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to dryness to afford the product (666 mg, 1.25 mmol, assumed quantitative yield) as a pale yellow solid that was used without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.08 (d, J = 8.3 Hz, 1H), 8.57 (t, J = 5.6 Hz, 1H), 8.09 (ddd, J = 7.9, 1.4, 0.6 Hz, 1H), 7.97 - 7.92 (m, 3H), 7.88 (ddd, J = 7.8, 1.8, 1.1 Hz, 1H), 7.60 - 7.55 (m, 2H), 7.54 - 7.34 (m, 5H), 7.21 - 7.11 (m, 1H), 5.08 (ddd, J = 10.8, 8.2, 4.2 Hz, 1H), 3.40 (t, J = 6.3 Hz, 2H), 3.33 - 3.29 (m, 1H), 3.26 (s, 3H), 2.97 (dd, J = 13.9, 10.8 Hz, 1H), 1.85 - 1.75 (m, 2H). UPLC-MS (basic 2 mm) Rt = 1.10 mm. m/z = 535.1 for [M+H]+

[0001523] Step 6: 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]-N-(3-methoxypro pyl)benzamide

[0001524] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]-N-(3-methoxypropyl)benzamide (666 mg, 1.25 mmol, 1.0 eq.) in EtOH (15 mL) were added DIPEA (0.65 mL, 3.74 mmol, 3.0 eq.) and hydroxylamine hydrochloride (0.173 g, 2.49 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 18 h, then cooled to RT and concentrated to dryness to afford product (0.707 g, 1.25 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 568.1 for [M+H]+

[0001525] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(3- methoxypropylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]met hylene]amino] acetate

[0001526] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]-N-(3-methoxypro pyl)benzamide (0.710 g, 1.25 mmol, 1.0 eq.) in acetic acid (6 mL) was added acetic anhydride (0.35 mL, 3.74 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 4 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 10-100% EtOAc in iso-hexane followed by a gradient of 0-50% 4:1 DCM:methanol in ethyl acetate to afford product (0.380 g, 0.623 mmol, 50% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.03 (d, J = 7.6 Hz, 1H), 8.56 (t, J = 5.6 Hz, 1H), 8.06 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.93 - 7.87 (m, 2H), 7.83 - 7.75 (m, 1H), 7.55 (ddd, J = 7.8, 1.9, 1.1 Hz, 1H), 7.53 - 7.47 (m, 2H), 7.45 - 7.41 (m, 1H), 7.41 - 7.35 (m, 1H), 7.34 - 7.27 (m, 1H), 7.23 (d, J = 7.5 Hz, 1H), 7.06 (t, J = 7.7 Hz, 1H), 6.71 (s, 2H), 4.99 (s, 1H), 3.39 (t, J = 6.3 Hz, 2H), 3.32 - 3.29 (m, 3H), 3.25 (s, 3H), 2.98 (dd, J = 13.9, 10.2 Hz, 1H), 2.16 (s, 3H), 1.78 (p, J = 6.6 Hz, 2H) UPLC-MS (basic 2 min): Rt = 0.99 min; m/z = 610.1 for [M+H]+

[0001527] Step 8: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylphenyl)ethyl ]sulfamoyl]- N-(3-methoxypropyl)benzamide

[0001528] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(3- methoxypropylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]met hylene]amino] acetate (0.380 g, 0.623 mmol, 1.0 eq.) in acetic acid (8.4 mL) was added zinc (0.815 g, 12.5 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 20 h. Further zinc (0.815 g, 12.5 mmol, 20.0 eq.) and acetic acid (4 mL) were added and the reaction mixture was stirred for a further 20 h at RT. The reaction mixture was filtered over Celite, washing with copious acetonitrile, EtOH and DCM, and concentrated to dryness. The residue was purified by SFC (Lux Cl, 21.2mm x 250mm, 5um) eluting with 35:65 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the 1 ^st eluting enantiomer of the product (93 mg, 0.169 mmol, 27%) as a white solid. The material was then purified again via SFC (Chiralpak IA, 21 mm x 250 mm, 5 um) eluting with 45:55 MeOH:CO ₂ (0.2% v/v NH ₃ ). The material was then suspended in 4 N HC1 in 1,4-dioxane (1.0 mL), stirred for 1 min and concentrated to dryness. This process was repeated twice more before redissolving in MeCN/water, concentrating to dryness and drying in a vacuum oven. This afforded the product (18.0 mg, 0.0326 mmol, 5% yield) as a white solid. UPLC-MS (acidic 6 min): Rt = 2.00 min; m/z = 552.3 for [M+H]+, 100% purity. 1H NMR (400 MHz, DMSO-d6) 5 9.15 (s, 2H), 9.02 (d, J

= 8.2 Hz, 1H), 8.91 (s, 2H), 8.58 (t, J = 5.6 Hz, 1H), 8.13 - 8.05 (m, 1H), 7.94 - 7.88 (m, 2H), 7.82 (d, J = 7.9 Hz, 1H), 7.70 (s, 1H), 7.59 - 7.39 (m, 5H), 7.31 (t, J = 7.8 Hz, 1H), 7.19 (t, J = 7.7 Hz, 1H), 5.13 - 5.02 (m, 1H), 3.40 (m, 3H), 3.31 (q, J = 6.6 Hz, 2H), 3.26 (s, 3H), 3.03 (dd, J = 13.9, 10.4 Hz, 1H), 1.78 (p, J = 6.6 Hz, 2H). HC1 salt.

Example 79: Exemplary synthesis of Compound 243

[0001529] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001530] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (16.0 g, 55.1 mmol, 1.0 eq.) in toluene (300 mL) were added 2- aminothiophenol (6.5 mL, 60.6 mmol, 1.1 eq.), T3P (25.0 mL, 41.3 mmol, 0.75 eq.) and DIPEA (14.0 mL, 82.7 mmol, 1.5 eq.). The resulting mixture was stirred at 115 °C for 3.5 h. The reaction mixture was cooled to RT and stirred for 1 h and then a further 5 h at 115 °C. The reaction mixture was re-dosed with T3P (25.0 mL, 41.3 mmol, 0.75 eq.) and stirred at 115 °C for 21 h before being cooled to RT. The reaction mixture was concentrated to dryness and the residue was dissolved in EtOAc (250 mL), washed with aq. saturated Na ₂ CO ₃ (2 x 100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0- 100% EtOAc in DCM, followed by a second purification via normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in DCM, to afford the product (7.12 g, 18.8 mmol, 34% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 8.05 (d, 1H), 7.94 (dt, J = 8.0, 1.1 Hz, 1H), 7.88 (d, J = 8.7 Hz, 1H), 7.77 (t, J = 1.8 Hz, 1H), 7.67 (dd, J =

7.8, 1.7 Hz, 2H), 7.52 - 7.45 (m, 2H), 7.40 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.12 (ddd, J = 11.1,

8.8, 4.3 Hz, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.10 - 3.05 (m, 1H), 1.26 (s, 9H). UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 280.0 for [M-boc+H]+

[0001531] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001532] A magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (7.12 g, 18.8 mmol, 1.0 eq.) in 4 N HC1 in 1,4-dioxane (35.0 mL, 140 mmol, 7.4 eq.) and the resultant solution was stirred at RT for 21 h. The reaction mixture was then concentrated to dryness to afford the product (6.24 g, 19.8 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.12 - 8.99 (m, 3H), 8.15 - 8.08 (m, 1H), 8.01 (d, J = 8.0 Hz, 1H), 7.78 (s, 1H), 7.69 (d, J = 7.6 Hz, 1H), 7.57 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.28 (s, 1H), 3.50 (dd, J = 13.9, 6.3 Hz, 1H), 3.39 - 3.28 (m, 1H). UPLC-MS (basic 2 mm): Rt = 1.01 mm; m/z = 280.0 for [M+H]+

[0001533] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001534] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (3.00 g, 9.50 mmol, 1.0 eq.) in DMF (25 mL) cooled to 0 °C was added tri ethylamine (4.0 mL, 28.5 mmol, 3.0 eq.) and the reaction mixture was stirred for 10 min. Methy 1-3 -chlorosulfonylbenzoate (2.67 g, 11.4 mmol, 1.2 eq.) was added portionwise over 10 min and the reaction mixture was allowed to warm to RT and stir for 17 h. The reaction was quenched via the addition of water (100 mL). The organics were extracted with ethyl acetate (3 x 50 mL), washed with aq. saturated Na ₂ CO ₃ (50 mL) and brine (50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, filtered, rinsing with DCM and iso-hexane, and air dried to afford product (2.28 g, 4.77 mmol, 50% yield) as a white solid. 1H NMR analysis (400 MHz, DMSO-D6) 5 9.15 (s, 1H), 8.07 (s, 1H), 7.89 (d, J = 8.6 Hz, 3H), 7.72 (s, 1H), 7.59 (s, 1H), 7.50 (s, 2H), 7.46 - 7.40 (m, 3H), 7.22 (d, J = 8.2 Hz, 1H), 5.07 (s, 1H), 3.88 (d, J = 8.0 Hz, 3H), 3.01 (s, 1H).

UPLC-MS (basic 2 min) Rt = 1.20 min. m/z = 478.0 for [M+H]+

[0001535] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001536] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (2.88 g, 6.03 mmol, 1.0 eq.) in THF (50 mL) was added a solution of lithium hydroxide (0.760 g, 18.1 mmol, 3.0 eq.) in water (15 mL) and the resulting mixture was stirred at RT for 4 h. The reaction volume was reduced by half and the reaction was diluted with EtOAc (50 mL) and water (50 mL). The phases were separated and the aqueous phase was acidified to pH 1.0 via the addition of 1 M HC1 (30 mL). The precipitate was collected by filtration, washing with water, and air dried to afford product (2.18 g, 4.70 mmol, 78% yield) as a white solid, which was used in the next step without further purification. 1H NMR analysis (400 MHz, DMSO-d6) 5 13.33 (s, 1H), 9.13 (d, J = 8.5 Hz, 1H), 8.11 - 8.04 (m, 1H), 7.94 - 7.91 (m, 2H), 7.90 (t, J = 1.4 Hz, 1H), 7.66 (dt, J = 7.9, 1.5 Hz, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.54 -

7.47 (m, 2H), 7.46 - 7.41 (m, 2H), 7.39 (d, J = 7.8 Hz, 1H), 7.23 (t, J = 7.7 Hz, 1H), 5.11 - 5.01 (m, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 4 min) Rt = 1.26 min. m/z = 464.0 for [M+H] ⁺

[0001537] Step 5: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]-N-(3- methoxypropyl)benzamide

[0001538] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (0.500 g, 1.08 mmol, 1.0 eq.) in DMF (7 mL) were added 3 -methoxypropylamine (0.120 g, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.24 mmol, 3.0 eq.) and HATU (0.620 g, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 20 h. The reaction was redosed with further 3-methoxypropylamine (60.0 mg, 0.645 mmol, 0.6 eq.), DIPEA (0.28 mL, 1.62 mmol, 1.5 eq.) and HATU (0.310 g, 0.810 mmol, 0.75 eq.) and stirred at RT for 3 h. The reaction mixture was diluted with EtOAc (50 mL) and water (50 mL). After separation of the phases, the organic fraction was washed with aq. saturated Na ₂ CO ₃ (50 mL) and water (50 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to dryness to afford the product (666 mg, 1.25 mmol, assumed quantitative yield) as a pale yellow solid that was used without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.08 (d, J = 8.3 Hz, 1H), 8.57 (t, J = 5.6 Hz, 1H), 8.09 (ddd, J = 7.9, 1.4, 0.6 Hz, 1H), 7.97 - 7.92 (m, 3H), 7.88 (ddd, J = 7.8, 1.8, 1.1 Hz, 1H), 7.60 - 7.55 (m, 2H), 7.54 - 7.34 (m, 5H), 7.21 - 7.11 (m, 1H), 5.08 (ddd, J = 10.8, 8.2, 4.2 Hz, 1H), 3.40 (t, J = 6.3 Hz, 2H), 3.33 - 3.29 (m, 1H), 3.26 (s, 3H), 2.97 (dd, J = 13.9, 10.8 Hz, 1H), 1.85 - 1.75 (m, 2H). UPLC-MS (basic 2 mm) Rt = 1.10 mm. m/z = 535.1 for [M+H]+

[0001539] Step 6: 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]-N-(3-methoxypro pyl)benzamide

[0001540] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]-N-(3-methoxypropyl)benzamide (666 mg, 1.25 mmol, 1.0 eq.) in EtOH (15 mL) were added DIPEA (0.65 mL, 3.74 mmol, 3.0 eq.) and hydroxylamine hydrochloride (0.173 g, 2.49 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 18 h, then cooled to RT and concentrated to dryness to afford product (0.707 g, 1.25 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.00 min. m/z = 568.1 for [M+H]+

[0001541] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(3- methoxypropylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]met hylene]amino] acetate

[0001542] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]-N-(3-methoxypro pyl)benzamide (0.710 g, 1.25 mmol, 1.0 eq.) in acetic acid (6 mL) was added acetic anhydride (0.35 mL, 3.74 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 4 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 10-100% EtOAc in iso-hexane followed by a gradient of 0-50% 4:1 DCM:methanol in ethyl acetate to afford product (0.380 g, 0.623 mmol, 50% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.03 (d, J = 7.6 Hz, 1H), 8.56 (t, J = 5.6 Hz, 1H), 8.06 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.93 - 7.87 (m, 2H), 7.83 - 7.75 (m, 1H), 7.55 (ddd, J = 7.8, 1.9, 1.1 Hz, 1H), 7.53 - 7.47 (m, 2H), 7.45 - 7.41 (m, 1H), 7.41 - 7.35 (m, 1H), 7.34 - 7.27 (m, 1H), 7.23 (d, J = 7.5 Hz, 1H), 7.06 (t, J = 7.7 Hz, 1H), 6.71 (s, 2H), 4.99 (s, 1H), 3.39 (t, J = 6.3 Hz, 2H), 3.32 - 3.29 (m, 3H), 3.25 (s, 3H), 2.98 (dd, J = 13.9, 10.2 Hz, 1H), 2.16 (s, 3H), 1.78 (p, J = 6.6 Hz, 2H) UPLC-MS (basic 2 min): Rt = 0.99 min; m/z = 610.1 for [M+H]+

[0001543] Step 8: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylphenyl)ethyl ]sulfamoyl]- N-(3-methoxypropyl)benzamide

[0001544] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(3- methoxypropylcarbamoyl)phenyl]sulfonylamino]ethyl]phenyl]met hylene]amino] acetate (0.380 g, 0.623 mmol, 1.0 eq.) in acetic acid (8.4 mL) was added zinc (0.815 g, 12.5 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 20 h. Lurther zinc (0.815 g, 12.5 mmol, 20.0 eq.) and acetic acid (4 mL) were added and the reaction mixture was stirred for a further 20 h at RT. The reaction mixture was filtered over Celite, washing with copious acetonitrile, EtOH and DCM, and concentrated to dryness. The residue was purified by SEC (Lux Cl, 21.2mm x 250mm, 5um) eluting with 35:65 EtOKCCh (0.2% v/v NH ₃ ) to afford the 2 ^nd eluting enantiomer of the product (120 mg, 0.218 mmol, 35%) as a white solid. The material was then purified again via SFC (Lux C4, 4.6 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (0.2% v/v NH ₃ ). The material was then suspended in 4 N HC1 in 1,4-dioxane (1.0 mL), stirred for 1 min and concentrated to dryness. This process was repeated twice more before redissolving in MeCN/water, concentrating to dryness and drying in a vacuum oven. This afforded the product (39.0 mg, 0.0707 mmol, 11% yield) as a white solid. UPLC-MS (acidic 6 min): Rt = 1.99 min; m/z = 552.3 for [M+H]+, 100% purity. 1H NMR (400 MHz, DMSO-d6) 5 9.17 (s, 2H), 9.03 (d, J = 8.2 Hz, 1H), 8.97 (s, 2H), 8.59 (t, J = 5.6 Hz, 1H), 8.08 (dd, J = 7.6, 1.3 Hz, 1H), 7.97 - 7.87 (m, 2H), 7.83 (d, J = 7.7 Hz, 1H), 7.71 (s, 1H), 7.63 - 7.40 (m, 5H), 7.31 (t, J = 7.8 Hz, 1H), 7.18 (t, J = 7.8 Hz, 1H), 5.14 - 5.04 (m, 1H), 3.40 (t, J = 6.3 Hz, 3H), 3.31 (q, J = 6.7 Hz, 2H), 3.26 (s, 3H), 3.03 (dd, J = 13.8, 10.4 Hz, 1H), 1.78 (p, J = 6.7 Hz, 2H).

Example 80: Exemplary synthesis of Compound 257

[0001545] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001546] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (16.0 g, 55.1 mmol, 1.0 eq.) in toluene (300 mL) was added 2- aminothiophenol (6.5 mL, 60.6 mmol, 1.1 eq.), T3P (24.6 mL, 41.3 mmol, 0.75 eq.) and DIPEA (14.4 mL, 82.7 mmol, 1.5 eq.). The resulting mixture was stirred at 115 °C for 9.5 h and additional T3P (25 mL, 42.0 mmL, 0.76 eq.) was added. The reaction was stirred at 115 °C for 21 h then cooled to RT and concentrated to dryness. The residue was purified by normal phase column chromatography (330 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (11.45 g, 30.2 mmol, 54.8% yield) as a brown solid. 1H NMR (400 MHz, DMSO-d6) 5 8.05 (d, 1H), 7.94 (dt, J = 8.0, 1.1 Hz, 1H), 7.88 (d, J = 8.7 Hz, 1H), 7.77 (t, J = 1.8 Hz, 1H), 7.67 (dd, J = 7.8, 1.7 Hz, 2H), 7.52 - 7.45 (m, 2H), 7.40 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.12 (ddd, J = 11.1, 8.8, 4.3 Hz, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.10 - 3.05 (m, 1H), 1.26 (s, 9H). UPLC- MS (basic 2 min): Rt = 1.23 min, m/z = 280.0 [M-Boc+H] ⁺

[0001547] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001548] A magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (7.12 g, 18.8 mmol, 1.0 eq.) in 4 N HC1 in 1,4-dioxane (35.0 mb, 140 mmol, 7.4 eq.) was stirred at RT for 21 h. The reaction mixture was then concentrated to dryness to afford the product (6.24 g, 19.8 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.12 - 8.99 (m, 3H), 8.15 - 8.08 (m, 1H), 8.01 (d, J = 8.0 Hz, 1H), 7.78 (s, 1H), 7.69 (d, J = 7.6 Hz, 1H), 7.57 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.28 (s, 1H), 3.50 (dd, J = 13.9, 6.3 Hz, 1H), 3.39 - 3.28 (m, 1H). UPLC-MS (basic 2 mm): Rt = 1.01 mm, m/z = 280.0 [M+H] ⁺

[0001549] Step 3: methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001550] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (3.00 g, 9.50 mmol, 1.0 eq.) in DMF (25 mL), cooled to 0 °C, was added triethylamine (4.0 mL, 28.5 mmol, 3.0 eq.) and the reaction mixture was stirred for 10 min. Methyl-3 -chlorosulfonylbenzoate (2.67 g, 11.4 mmol, 1.2 eq.) was added portionwise over 10 min and the reaction mixture was allowed to warm to RT and stir for 17 h. The reaction was quenched via the addition of water (50 mL). The organics were extracted with ethyl acetate (3 x 50 mL) and brine (50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The crude solid was triturated with DCM, filtered, rinsed with DCM and hexane and air dried. The solids were combined to afford product (1.30 g, 2.72 mmol, 53% yield) as a yellow solid. 1H NMR (400 MHz, DMSO-d6) 5 9.15 (s, 1H), 8.07 (s, 1H), 7.89 (d, J = 8.6 Hz, 3H), 7.72 (s, 1H), 7.59 (s, 1H), 7.50 (s, 2H), 7.46 - 7.40 (m, 3H), 7.22

(d, J = 8.2 Hz, 1H), 5.07 (s, 1H), 3.88 (d, J = 8.0 Hz, 3H), 3.01 (s, 1H). One CH not observed. UPLC-MS (basic 2 min) Rt = 1.20 min, m/z = 478.0 [M+H] ⁺

[0001551] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001552] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (2.88 g, 6.03 mmol, 1.0 eq.) in THF (50 mL) was added a solution of lithium hydroxide (0.760 g, 0.617 mmol, 3.0 eq.) in water (15 mL) and the resulting mixture was stirred at RT for 4 h. The reaction was diluted with EtOAc (50 mL) and water (50 mL). The phases were separated, and the aqueous phase was acidified to pH 3 via the addition of 1 M HC1. The precipitate was collected by filtration, washing with water, and air dried to afford product (2.18 g, 4.70 mmol, 78% yield) as a white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 13.33 (s, 1H), 9.13 (d, J = 8.5 Hz, 1H), 8.11 - 8.04 (m, 1H), 7.94 - 7.91 (m, 2H), 7.90 (t, J = 1.4 Hz, 1H), 7.66 (dt, J = 7.9, 1.5 Hz, 1H), 7.60 (d, J = 1.7 Hz, 1H), 7.54 - 7.47 (m, 2H), 7.46 - 7.41 (m, 2H), 7.39 (d, J = 7.8 Hz, 1H), 7.23 (t, J = 7.7 Hz, 1H), 5.11 - 5.01 (m, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 4 mm): Rt = 1.26 mm, m/z = 464.0 [M+H] ⁺

[0001553] Step 5: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]-N-(2- hydroxyethyl)benzamide

[0001554] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (0.500 g, 0.96 mmol, 1.0 eq.) in DMF (5 mL) were added ethanolamine (0.17 mL, 2.88 mmol, 3.0 eq.), DIPEA (0.50 mL, 2.88 mmol, 3.0 eq.) and HATU (0.548 g, 1.44 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 19 h. Additional ethanolamine (0.17 mL, 2.88 mmol, 3.0 eq.), DIPEA (0.50 mL, 2.88 mmol, 3.0 eq.) and HATU (0.548 g, 1.44 mmol, 1.5 eq.) were added and the reaction mixture was left to stir for 24 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography over silica (24 g cartridge) eluting with 0-10% MeOH in DCM to afford product (227 mg, 0.448 mmol, 47% yield) as a white solid. 1H NMR (400 MHz, DMSO- d6) 5 9.07 (d, J = 8.4 Hz, 1H), 8.55 (t, J = 5.6 Hz, 1H), 8.12 - 8.08 (m, 1H), 7.96 - 7.93 (m, 2H), 7.90 (dt, J = 7.9, 1.3 Hz, 1H), 7.59 - 7.56 (m, 2H), 7.54 - 7.49 (m, 1H), 7.49 - 7.44 (m, 2H), 7.43 - 7.35 (m, 2H), 7.18 (t, J = 7.7 Hz, 1H), 5.13 - 5.06 (m, 1H), 3.56 (q, J = 6.1 Hz, 2H), 3.44 - 3.34 (m, 3H), 2.97 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 min): Rt = 1.03 min, m/z = 507.2 [M+H] ⁺

[0001555] Step 6: 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]-N-(2-hydroxyeth yl)benzamide

[0001556] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]-N-(2-hydroxyethyl)benzamide (227 mg, 0.448 mmol, 1.0 eq.) in EtOH (3 mL) were added DIPEA (0.23 mL, 1.34 mmol, 3.0 eq.) and hydroxylamine hydrochloride (62 mg, 0.896 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 91 h and additional hydroxylamine hydrochloride (140 mg, 2.02 mmol, 4.5 eq). After a further 22 h the reaction mixture was then concentrated to dryness to afford product (676 mg, 1.25 mmol, assumed quantitative yield), as yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min): rt = 0.95 min, m/z = 540.1 [M+H] ⁺

[0001557] Step 7: 2-[[3-[[2-[3-[(E)-N'-acetoxycarbamimidoyl]phenyl]-l-(l,3-ben zothiazol-2- yl)ethyl]sulfamoyl]benzoyl]amino]ethyl acetate

[0001558] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]-N-(2-hydroxyeth yl)benzamide (676 mg, 1.25 mmol, 1.0 eq.) in acetic acid (7 mL) was added acetic anhydride (0.21 mL, 224 mmol, 1.79 eq.) and the resulting mixture was stirred at RT for 19 h. Additional acetic anhydride (0.22 mL, 235 mmol, 1.88 eq.), and stirred for 24 h. A final addition of acetic anhydride (0.22 mL, 235 mmol, 1.88 eq.) was added and the reaction was stirred for 120 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography over silica (24 g cartridge) eluting with 0-10% MeOH in DCM to afford product (180 mg, 0.289 mmol, 23% yield) as a white solid. UPLC-MS (2 min, basic): Rt = 0.97 min, m/z = 624.3 [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.00 (d, J = 8.2 Hz, 1H), 8.67 (t, J = 5.6 Hz, 1H),

8.04 - 8.00 (m, 1H), 7.91 - 7.86 (m, 1H), 7.77 - 7.73 (m, 1H), 7.52 (dt, J = 7.8, 1.4 Hz, 1H), 7.42 - 7.39 (m, 1H), 7.39 - 7.35 (m, 1H), 7.26 (t, J = 7.8 Hz, 1H), 7.20 (d, J = 7.6 Hz, 1H), 7.15 (td, J = 7.8, 2.5 Hz, 1H), 7.02 (t, J = 7.7 Hz, 1H), 6.66 (s, 2H), 4.99 - 4.92 (m, 1H), 4.15 - 4.09 (m, 3H), 3.50 - 3.45 (m, 2H), 3.13 (d, J = 5.1 Hz, 1H), 2.97 - 2.90 (m, 1H), 2.12 (s, 3H), 1.99 (s, 3H).

[0001559] Step 8: 2-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]benzoyl]amino]ethyl acetate

[0001560] To a magnetically stirred solution of 2-[[3-[[2-[3-[(E)-N'- acetoxycarbamimidoyl]phenyl]-l-(l,3-benzothiazol-2-yl)ethyl] sulfamoyl]benzoyl]amino]ethyl acetate (180 mg, 0.289 mmol, 1.0 eq.) in acetic acid (2 mL) was added zinc (566 mg, 8.66 mmol, 30.0 eq.). The reaction mixture was stirred at RT for 67 h. The reaction mixture was filtered, washing with copious MeCN and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative HPLC on a Gemini NX C18 (30 mm x 150 mm, 5 um) eluting with 10-100% MeCN in water (0.5% v/v NH ₃ ) to afford the product (14.0 mg, 0.0407 mmol, 14% yield) as a white solid. UPLC-MS (basic 18 min): Rt = 7.38 min, m/z = 565.8 [M+H] ⁺

[0001561] Step 9: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-carbamimidoylphenyl)ethyl ]sulfamoyl]- N-(2-hydroxyethyl)benzamide

[0001562] 2- [ [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-y l)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]benzoyl]amino]ethyl acetate (23 mg, 0.0407 mmol, 1.0 eq.) was dissolved in 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 197 eq.) and the solution was stirred at RT for 16 h. Additional 4 N HC1 in 1,4-dioxane (2 mL) was added and the reaction was stirred for 48 h before being concentrated under vacuum. The material was redissolved in 4 N HC1 in 1,4-dioxane (2 mL) and stirred at RT for 24 h. The reaction was then filtered, concentrated under vacuum and the residue was purified by reverse phase preparative HPLC on a Gemini NX C18 (30 mm x 150 mm, 5 um) eluting with 5-100% MeCN in water (0.5% v/v NH ₃ ) to afford the product (7.0 mg, 0.0131 mmol, 32% yield) as a white solid. UPLC-MS (basic 6 mm): Rt = 1.70 mm, m/z = 524.2 [M+H] ⁺ 99% purity. 1H NMR (400 MHz, DMSO-d6) 5 8.56

(s, 1H), 8.47 (s, 1H), 8.02 (d, J = 8.0 Hz, 1H), 7.95 - 7.91 (m, 1H), 7.87 (d, J = 8.2 Hz, 1H), 7.80 (d, J = 8.1 Hz, 1H), 7.60 (s, 1H), 7.50 - 7.39 (m, 4H), 7.38 - 7.32 (m, 2H), 7.25 (t, J = 7.8 Hz, 1H), 7.14 (t, J = 7.6 Hz, 1H), 4.98 (s, 1H), 3.51 (t, J = 6.1 Hz, 3H), 3.01 - 2.91 (m, 1H). 2 aliphatic protons not observed. Grease impurity present. 1H NMR - D2O (400 MHz, DMSO-d6) 5 8.38 (s, 1H), 7.99 (d, J = 7.7 Hz, 1H), 7.86 - 7.84 (m, 2H), 7.78 - 7.73 (m, 1H), 7.59 - 7.54 (m, 1H), 7.51 (d, J = 8.5 Hz, 1H), 7.44 (d, J = 8.5 Hz, 1H), 7.42 - 7.39 (m, 2H), 7.38 - 7.33 (m, 2H), 7.29 - 7.24 (m, 1H), 7.17 - 7.10 (m, 1H), 4.94 (s, 1H), 3.50 (t, J = 6.1 Hz, 2H), 3.32 - 3.28 (m, 3H). Final proton at 2.96 cannot be integrated accurately due to baseline noise. Grease impurity present.

Example 81: Exemplary synthesis of Compound 258

[0001563] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001564] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (16.2 g, 55.8 mmol, 1.0 eq.) in toluene (300 mL) were added 2- aminothiophenol (6.6 mL, 61.4 mmol, 1.1 eq.), T3P (25.0 mL, 41.9 mmol, 0.75 eq.) and DIPEA (15.0 mL, 83.7 mmol, 1.5 eq.). The resulting mixture was stirred at 115 °C for 53 h. The reaction mixture was cooled to RT and concentrated to dryness. The residue was purified by normal phase column chromatography (330 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (9.55 g, 22.4 mmol, 40% yield) as a red solid. 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (d, J = 8.1 Hz, 1H), 7.89 (d, J = 8.9 Hz, 1H), 7.77 (s, 1H), 7.70 - 7.65 (m, 2H), 7.52 - 7.45 (m, 2H), 7.43 - 7.37 (m, 1H), 5.17 - 5.06 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.08 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 8H). UPLC-MS (basic 2 mm): Rt = 1.23 min; m/z = 380.1 for [M+H] ⁺

[0001565] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001566] A magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (9.55 g, 25.2 mmol, 1.0 eq.) in 4 N HC1 in 1,4-dioxane (50.0 mL, 200 mmol, 7.9 eq.) was stirred at RT for 18 h. The reaction mixture was then concentrated to dryness to afford the product (9.91 g, 25.4 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 8.98 (s, 3H), 8.14 - 8.09 (m, 1H), 8.02 (d, J = 8.1 Hz, 1H), 7.80 - 7.76 (m, 1H), 7.73 - 7.68 (m, 1H), 7.54 (ddq, J = 8.3, 5.6, 1.7 Hz, 2H), 7.46 (tt, J = 7.7, 1.6 Hz, 2H), 5.30 (s, 1H), 3.46 (dd, J = 14.2, 6.4 Hz, 1H), 3.34 (dd, J = 13.9, 8.4 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 280.0 for [M+H] ⁺

[0001567] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001568] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (1.62 g, 5.13 mmol, 1.0 eq.) in DMF (15 mL) cooled to 0 °C was added tri ethylamine (2.1 mL, 15.4 mmol, 3.0 eq.) and the reaction mixture was stirred for 10 min. Methy 1-3 -chlorosulfonylbenzoate (1.44 g, 6.16 mmol, 1.2 eq.) was added portion wise over 10 min and the reaction mixture was allowed to warm to RT and stir for 2 h. The reaction was quenched via the addition of water (50 mL). The organics were extracted with ethyl acetate (100 mL), washed with water (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, filtered and air dried. The filtrate was concentrated to dryness and triturated with DCM, filtered and air dried. The solids were combined to afford product (1.30 g, 2.72 mmol, 53% yield) as a white solid. 1H NMR (400 MHz, DMSO-d6) 5 9.16 (d, J = 8.4 Hz, 1H), 8.07 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 7.94 - 7.85 (m, 3H), 7.72 (ddd, J = 7.9, 2.0, 1.2 Hz, 1H), 7.61 (t, J = 1.7 Hz, 1H), 7.55 - 7.40 (m, 5H), 7.22 (t, J = 7.7 Hz, 1H), 5.07 (ddd, J = 10.8, 8.5, 4.3 Hz, 1H), 3.88 (s, 3H), 3.39 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.9 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 mm. m/z = 478.2 for [M+H ^]+

[0001569] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001570] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (1.30 g, 2.72 mmol, 1.0 eq.) in THF (23 mL) was added a solution of lithium hydroxide (0.342 g, 8.15 mmol, 3.0 eq.) in water (7 mL) and the resulting mixture was stirred at RT for 3 h. The reaction volume was reduced by half and the reaction was diluted with EtOAc (50 mL) and water (50 mL). The phases were separated, and the aqueous phase was acidified to pH 3 via the addition of 1 M HC1. The precipitate was collected by filtration, washing with water, and air dried to afford product (1.42 g, 3.07 mmol, assumed quantitative yield) as a white solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 13.29 (s, 1H), 9.13 (d, J = 8.5 Hz, 1H), 8.08 (d, J = 7.9 Hz, 1H), 7.96 - 7.89 (m, 3H), 7.70 - 7.63 (m, 1H), 7.60(s, 1H), 7.51 (t, J = 8.3 Hz, 2H), 7.48 - 7.36 (m, 3H), 7.23 (t, J = 7.7 Hz, 1H), 5.11 - 5.00 (m, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 0.82 mm. m/z = 464.2 for [M+H] ⁺

[0001571] Step 5: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-[4-(2 - methoxyethyl)piperazine-1-carbonyl]benzenesulfonamide

[0001572] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (0.500 g, 1.08 mmol, 1.0 eq.) in DMF (5 mL) was added l-(2-methoxyethyl)piperazine (187 mg, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.24 mmol, 3.0 eq.) and HATU (0.620 g, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 23 h. The reaction mixture was concentrated under vacuum then diluted with EtOAc (25 mL) and washed with water (2 x 25 mL), aq. saturated Na ₂ CO ₃ (50 mL) and brine (50 mL). The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness to afford the product (0.420 g, 0.787 mmol, 73% yield) as a yellow oil that was used without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.04 (d, J = 8.6 Hz, 1H), 8.00 (dt, J = 7.9, 0.9 Hz, 1H), 7.89 - 7.85 (m, 1H), 7.68 - 7.64 (m, 1H), 7.55 - 7.49 (m, 4H), 7.48 - 7.43 (m, 1H), 7.42 - 7.36 (m, 2H), 7.30 (q, J = 7.7 Hz, 2H), 5.07 (ddd, J = 10.1, 8.4, 4.8 Hz, 1H), 3.62 - 3.43 (m, 2H), 3.43 - 3.32 (m, 4H), 3.20 (s, 3H), 3.01 (dd, J = 13.9, 10.3 Hz, 3H), 2.26 (s, 2H). UPLC- MS (2 min, basic): Rt = 1.04 min, m/z = 590.3 [M+H] ⁺

[0001573] Step 6: 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[4-(2-methoxyethyl)pipera zine-l- carbonyl]phenyl]sulfonylamino]ethyl]-N'-hydroxy-benzamidine

[0001574] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-[4-(2-methoxyethyl)piperazine-l-carbony l]benzenesulfonamide (511 mg, 0.867 mmol, 1.0 eq.) in EtOH (5 mL) were added DIPEA (0.45 mL, 2.60 mmol, 3.0 eq.) and hydroxylamine hydrochloride (120 mg, 1.73 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 22 h, then concentrated to dryness to afford product (859 mg, 1.38 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (2 mm, basic): Rt = 0.93 mm, m/z = 623.4 [M+H] ⁺

[0001575] Step 7: [amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[4-(2-methoxyethy l)piperazine-l- carbonyl]phenyl]sulfonylamino]ethyl]phenyl]methylene]amino] acetate

[0001576] To a magnetically stirred solution of 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[4-(2- methoxyethyl)piperazine-l-carbonyl]phenyl]sulfonylamino]ethy l]-N'-hydroxy-benzamidine (859 mg, 1.38 mmol, 1.0 eq.) in acetic acid (10 mb) was added acetic anhydride (0.65 mL, 6.90 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 22 h. Additional acetic anhydride (0.65 mL, 6.0 mmol, 3.0 eq.) was added and the reaction was stirred at RT for 20 h before it was concentrated to dryness and the residue was purified by normal phase column chromatography over silica (40 g cartridge) eluting with 0-20% MeOH in DCM to afford product (220 mg, 0.331 mmol, 24% yield) as a yellow oil. UPLC-MS (2 min, basic): Rt = 0.96 min, m/z = 665.4 [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.05 - 8.00 (m, 1H), 7.94 - 7.87 (m, 1H), 7.63 (t, J = 1.8 Hz, 1H), 7.55 - 7.52 (m, 2H), 7.52 - 7.49 (m, 1H), 7.49 - 7.44 (m, 2H), 7.40 (ddt, J = 15.4, 8.1, 1.3 Hz, 2H), 7.32 - 7.25 (m, 2H), 7.16 (t, J = 7.7 Hz, 1H), 6.76 (s, 2H), 5.09 - 5.00 (m, 1H), 4.10 (q, J = 5.3 Hz, 2H), 3.63 - 3.50 (m, 3H), 3.44 (t, J = 5.7 Hz, 3H), 3.25 (s, 3H), 3.05 (dd, J = 13.9, 9.6 Hz, 4H), 2.37 - 2.22 (m, 2H), 2.15 (s, 3H)

[0001577] Step 8: 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[4-(2-methoxyethyl)pipera zine-l- carbonyl]phenyl]sulfonylamino]ethyl]benzamidine

[0001578] To a magnetically stirred solution of [amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[4- (2-methoxyethyl)piperazine-l-carbonyl]phenyl]sulfonylamino]e thyl]phenyl]methylene]amino] acetate (220 mg, 0.331 mmol, 1.0 eq.) in acetic acid (3 mL) was added zinc (216 mg, 3.31 mmol, 10.0 eq.). The reaction mixture was stirred at RT for 96 h. The reaction mixture was filtered, washing with copious MeCN and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative HPLC on a Gemini NX C18 (30 mm x 150 mm, 5 um) eluting with 10-100% MeCN in water (0.5% v/v NH ₃ ) to afford the product (26.0 mg, 0.0420 mmol, 13% yield) as a white solid. UPLC-MS (basic 6 min): Rt = 2.10 min; m/z = 607.3 for [M+H] ⁺ , 98% purity. 1H NMR (400 MHz, DMSO-d6) 5 8.45 (s, OH), 7.91 (d, J = 7.9 Hz, 1H), 7.81 (d, J = 8.1 Hz, 1H), 7.70 (s, 1H), 7.52 - 7.46 (m, 2H), 7.45 - 7.41 (m, 1H), 7.41 - 7.35 (m, 2H), 7.31 (t, J = 7.6 Hz, 1H), 7.26 - 7.21 (m, 3H), 4.92 - 4.80 (m, 1H), 3.38 (t, J = 5.8 Hz, 2H), 3.29 - 3.22 (m, 1H), 3.20 (s, 3H), 2.99 (dd, J = 13.4, 8.8 Hz, 2H), 2.42 (t, J = 5.7 Hz, 2H), 2.16 (s, 2H). One exchangeable partially observed, 4 aliphatic protons obscured by water peak. 1H NMR - D2O

(400 MHz, DMSO-d6) 5 7.87 (d, J = 7.9 Hz, 1H), 7.79 (d, J = 8.0 Hz, 1H), 7.65 (s, 1H), 7.49 (ddd, J = 5.7, 3.6, 1.8 Hz, 1H), 7.47 - 7.43 (m, 1H), 7.43 - 7.37 (m, 2H), 7.37 - 7.28 (m, 2H), 7.24 - 7.19 (m, 3H), 4.82 (dd, J = 8.9, 4.7 Hz, 1H), 3.49 (s, 2H), 3.21 (dd, J = 13.7, 4.6 Hz, 1H), 3.17 (s,3H), 3.02 - 2.94 (m, 3H), 2.40 (t, J = 5.7 Hz, 4H). Grease impurity observed.

Example 82: Exemplary synthesis of Compound 259

[0001579] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001580] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2- Aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in Toluene (245 mL) was added DIPEA (22.0 mb, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirring for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H). Purity appears to be ca. 90%

[0001581] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001582] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid. 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 -

8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). One CH not observed. 0.5 eq. of residual 1,4-dioxane present. UPLC-MS (basic 2 min): Rt = 1.03 mm; m/z = 280.1 for [M+H] ⁺

[0001583] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001584] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001585] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001586] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (3.40 g, 6.29 mmol, 1.0 eq.), iron (3.52 g, 62.9 mmol, 10.0 eq.) and ammonium chloride (1.68 g, 31.5 mmol, 5.0 eq.) in ethanol (35 mL) and water (17.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL), water (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.53 g as a yellow solid. The Celite was re-extracted with further ethanol (100 ml) and DCM (100 mL). The filtrate was concentrated in vacuo, resuspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL) and water (100 ml), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.09 g as a yellow oil. These were combined to afford the product (2.62 g, 6.04 mmol, 96% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 435.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001587] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl]phenyl]- 1 H-py razole- 5 - carboxamide

[0001588] To a stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) and lH-pyrazole-3- carboxylic acid (155 mg, 1.38 mmol, 1.2 eq.) in DMF (5 mL) was added N,N- diisopropylethylamine (DIPEA) (0.60 mL, 3.45 mmol, 3.0 eq.) and O-(7-Azabenzotriazol-l-yl)- N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) (656 mg, 1.73 mmol, 1.5 eq.) and the reaction was stirred at RT for 18 h. The reaction mixture was then concentrated in vacuo and purified via normal phase column chromatography (24 g cartridge) eluting with 0-20% methanol in DCM to afford the product (337 mg, 0.638 mmol, 55% yield) as a yellow oil. UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 529.2 [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 10.17 (s, 1H), 8.94 (d, J = 8.2 Hz, 1H), 8.72 (ddd, J = 4.3, 1.4, 0.6 Hz, 1H), 8.49 (ddd, J = 8.4, 1.4, 0.6 Hz, 1H), 8.12 (s, 1H), 8.05 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 7.93 - 7.86 (m, 5H), 7.79 (ddd, J = 8.2,

2.1, 1.1 Hz, 1H), 7.57 - 7.53 (m, 1H), 7.49 - 7.43 (m, 3H), 7.42 - 7.36 (m, 2H), 7.24 - 7.10 (m, 3H), 4.95 (ddd, J = 10.4, 8.2, 4.4 Hz, 1H), 3.38 - 3.35 (m, 1H), 3.09 (dd, J = 7.3, 3.9 Hz, 1H). Overlapping impurities present in aromatic and aliphatic regions, leading to increased atom count.

[0001589] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-lH-pyraz ole-5-carboxamide

[0001590] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]-lH-pyrazole-5-carboxamid e (337 mg, 0.638 mmol, 1.0 eq.), hydroxylammonium chloride (89 mg, 1.28 mmol, 2.0 eq.) and N,N-diisopropylethylamine (DIPEA) (0.33 mL, 1.91 mmol, 3.0 eq.) in ethanol (12.8 mL) was stirred at reflux for 20 h. The resulting mixture was then concentrated in vacuo to afford the product (358 mg, 0.637 mmol, assumed quantitative yield) as a white oily-solid. UPLC-MS (basic 2 min): Rt = 0.93 min; m/z = 562.2 [M+H] ⁺

[0001591] Step 7: [(E)-[[3-[2-[[3-[(2-acetylpyrazole-3-carbonyl)amino]phenyl]s ulfonylamino]- 2-(l,3-benzothiazol-2-yl)ethyl]phenyl]-amino-methylene]amino ] acetate

[0001592] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-lH-pyraz ole-5-carboxamide (358 mg, 0.637 mmol, 1.0 eq.) and acetic anhydride (0.060 mL, 0.637 mmol, 1.0 eq.) in acetic acid (6.4 mL) was stirred at RT for 2 h. Further acetic anhydride (0.060 mL, 0.637 mmol, 1.0 eq.) was added and the resulting mixture stirred at RT for 2 h. Further acetic anhydride (0.060 mL, 0.637 mmol, 1.0 eq.) was added and the resulting mixture stirred at RT for 20 h. The reaction mixture was concentrated in vacuo and purification was attempted via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in isohexane to afford the product (264 mg, 0.409 mmol, 64% yield) as a colourless oil. UPLC-MS (basic 2 min): Rt = 1.05 min; m/z = 646.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 10.31 (s, 1H), 8.96 (d, J = 7.5 Hz, 1H), 8.54 (dd, J = 2.9, 0.6 Hz, 1H), 8.09 - 8.02 (m, 2H), 7.92 (ddt, J = 8.2, 1.3, 0.6 Hz, 1H), 7.85 - 7.79 (m, 1H), 7.56 (d, J = 2.1 Hz, 1H), 7.50 - 7.37 (m, 3H), 7.29 - 7.15 (m, 3H), 7.14 - 7.05

(m, 2H), 6.67 (s, 2H), 4.96 (s, 1H), 3.32 - 3.29 (m, 1H), 3.01 (dd, J = 13.9, 9.8 Hz, 1H), 2.81 (d, J = 0.7 Hz, 3H), 2.12 (d, J = 0.7 Hz, 3H).

[0001593] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-lH-pyrazole-5-ca rboxamide hydrochloride

[0001594] A mixture of [(E)-[[3-[2-[[3-[(2-acetylpyrazole-3- carbonyl)amino]phenyl] sulfonylamino] -2-( 1 ,3 -benzothiazol-2-yl)ethyl] phenyl] -amino- methylene]amino] acetate (264 mg, 0.409 mmol, 1.0 eq.) and zinc (535 mg, 8.18 mmol, 20.0 eq.) in acetic acid (8.2 mL) was stirred at RT for 20 h.The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM, and concentrated in vacuo. The residue was then submitted for purification via prep-HPLC on a C2 XBridge BEH C18 eluting with 20-100% MeCN in water (0.2% TFA) which afforded the TFA salt of the product. The residue was suspended in 4 N HC1 in 1,4-dioxane (2.0 mL) and stirring for 1 min before being concentrated in vacuo. This process was repeated twice more before dissolving the residue in MeCN/water, concentrating in vacuo and drying in a vacuum oven overnight. The resalting process was then repeated a further 2 times, with the stir time increased to 5 min. On the last dose of HC1, 6 drops of water were added to the suspension to aid with solubility. The residue was dissolved in MeCN/water and concentrated twice before drying in a vacuum oven overnight to afford the product (81 mg, 0.148 mmol, 45% yield) as a yellow solid. UPLC-MS (acidic 6 mm): Rt = 2.28 mm; m/z = 546.2 for [M+H] ⁺ , 98% purity. 1H NMR (400 MHz, DMSO-d6) 5 10.18 (s, 1H), 9.15 (s, 2H), 8.97 - 8.90 (m, 3H), 8.11 (t, J = 1.9 Hz, 1H), 8.08 - 8.02 (m, 1H), 7.92 - 7.85 (m, 2H), 7.72 (dt, J = 8.0, 1.7 Hz, 1H), 7.68 (d, J = 1.8 Hz, 1H), 7.51 - 7.43 (m, 3H), 7.39 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 7.23 - 7.06 (m, 3H), 6.83 (d, J = 2.2 Hz, 1H), 4.99 (ddd, J = 9.9, 8.0, 4.6 Hz, 1H), 3.43 - 3.28 (m, 1H), 3.09 - 2.89 (m, 1H). Mono-HCl salt. 1 exchangeable not visible

Example 83: Exemplary synthesis of Compound 260

[0001595] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001596] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2- Aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in Toluene (245 mL) was added DIPEA (22.0 mb, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirring for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H). Purity appears to be ca. 90%

[0001597] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001598] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid. 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). One CH not observed. 0.5 eq. of residual 1,4-dioxane. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺

[0001599] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001600] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001601] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001602] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (3.40 g, 6.29 mmol, 1.0 eq.), iron (3.52 g, 62.9 mmol, 10.0 eq.) and ammonium chloride (1.68 g, 31.5 mmol, 5.0 eq.) in ethanol (35 mL) and water (17.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL), water (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.53 g as a yellow solid. The Celite was re-extracted with further ethanol (100 ml) and DCM (100 mL). The filtrate was concentrated in vacuo, resuspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL) and water (100 ml), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.09 g as a yellow oil. These were combined to afford the product (2.62 g, 6.04 mmol, 96% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 435.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001603] Step 5: tert-butyl N-[4-[[3-[[l-(l, 3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]cyclohexyl]carb amate

[0001604] To a stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) and 4-(tert- butoxycarbonylamino)cyclohexanecarboxylic acid (336 mg, 1.38 mmol, 1.2 eq.) in DMF (5 mL) was added N,N-diisopropylethylamine (DIPEA) (0.60 mL, 3.45 mmol, 3.0 eq.) and O-(7- azabenzotriazol-l-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) (656 mg, 1.73 mmol, 1.5 eq.) and the reaction was left to stir, at RT, for 18 h. The reaction mixture was concentrated in vacuo and the crude material was purified by normal phase column chromatography (24 g cartridge) eluting with a gradient of 0-20% MeOH in DCM to afford the product (1.37 g,2.07 mmol, assumed quantitative yield) as an orange oil. UPLC-MS (basic 2 mm): Rt = 1.20 mm; m/z = 660.4 [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.91 (s, 1H), 8.92 (d, J = 8.3 Hz, 1H), 8.06 (ddd, J = 7.9, 1.3, 0.7 Hz, 2H), 7.96 - 7.86 (m, 6H), 7.80 (t, J = 2.0 Hz, 1H), 7.16 (t, J = 7.9 Hz, 3H), 7.07 (ddd, J = 7.8, 1.9, 1.1 Hz, 1H), 6.71 (d, J = 8.3 Hz, 1H), 4.89 (ddd, J = 10.6, 8.3, 4.4 Hz, 1H), 3.62 - 3.52 (m, 4H), 3.38 - 3.31 (m, 2H), 3.14 - 3.07 (m, 5H), 2.96 - 2.87 (m, 2H), 2.83 - 2.71 (m, 1H), 1.35 - 1.34 (m, 9H).

[0001605] Step 6: tert-butyl N-[4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[rac-(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]carbamoyl ]cyclohexyl]carbamate

[0001606] A mixture of tert-butyl N-[4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]cyclohexyl]carb amate (1.37 g, 2.07 mmol, 1.0 eq.), N,N-diisopropylethylamine (DIPEA) (1.1 mL, 6.22 mmol, 3.0 eq.) and hydroxylammonium chloride (288 mg, 4.15 mmol, 2.0 eq.) in ethanol (20.7 mL) was stirred at reflux for 20 h. The resulting mixture was then concentrated in vacuo to afford the product (1.40 g, 2.02 mmol, assumed quantitative yield) as a yellow oil. UPLC-MS (basic 2 min): Rt = 1.09 min; m/z = 693.3 for [M+H] ⁺

[0001607] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[[4-(tert- butoxycarbonylamino)cyclohexanecarbonyl]amino]phenyl]sulfony lamino]ethyl]phenyl]methyle ne] amino] acetate

[0001608] A mixture of tert-butyl N-[4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[rac-(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]carbamoyl ]cyclohexyl]carbamate (1.40 g, 2.02 mmol, 1.0 eq.) and acetic anhydride (0.57 mL, 6.06 mmol, 3.0 eq.) in acetic acid (10.1 mL) was stirred at RT for 2 h. The resulting mixture was concentrated in vacuo. Purification was then attempted via normal phase column chromatography (20 g cartridge) eluting with 0-100% EtOAc in isohexane to afford the product (499 mg, 0.679 mmol, 34% yield). UPLC-MS (basic 2 mm): Rt = 1.13 mm; m/z = 735.4 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.87 (s, 1H), 8.89 (d, J = 8.1 Hz, 1H), 8.09 - 8.01 (m, 1H), 7.93 - 7.89 (m, 1H), 7.86 (d, J = 2.1 Hz, 1H), 7.55 (s, 1H), 7.52 - 7.38 (m, 4H), 7.23 - 7.04 (m, 4H), 6.74 (d, J = 8.1 Hz, 1H), 6.70 (s, 2H), 4.91 (dd, J = 15.0, 8.0 Hz, 1H), 3.03 - 2.94 (m, 1H), 2.69 (d, J = 0.7 Hz, 2H), 2.15 (d, J = 0.7 Hz, 4H), 1.84 (d, J = 11.4 Hz, 5H), 1.48 - 1.41 (m, 1H), 1.39 (s, 10H), 1.27 - 1.13 (m, 2H)

[0001609] Step 8: tert-butyl N-[4-[[3-[[l-(l, 3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]cyclohe xyl]carbamate trifluoroacetic acid

[0001610] A mixture of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[[4-(tert- butoxycarbonylamino)cyclohexanecarbonyl]amino]phenyl]sulfony lamino]ethyl]phenyl]methyle ne]amino] acetate (499 mg, 0.679 mmol, 1.0 eq.) and zinc (888 mg, 13.6 mmol, 20.0 eq.) in acetic acid (13.6 mL) was stirred at RT for 20 h. Lurther zinc (888 mg, 13.6 mmol, 20.0 eq.) was added and the reaction was stirred at RT for a further 4 h. The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM before concentrating in vacuo. The residue was submitted for purification via prep-HPLC on a Waters XBridge C18 eluting with 38-100% MeCN in water (0.2% TFA) to afford the product (237 mg, 0.350 mmol, 52% yield) as a TFA salt. UPLC-MS (basic 6 min): Rt = 3.74 min; m/z = 677.3 for [M+H] ⁺

[0001611] Step 9: 4-amino-N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]cyclohexanecarbox amide hydrochloride

[0001612] Tert-butyl N-[4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]cyclohe xyl]carbamate (237 mg, 0.350 mmol, 1.0 eq.) was stirred in 4 N HC1 in 1,4-dioxane (2.0 mb, 8.00 mmol, 22.8 eq.) for 1 h. The reaction was concentrated and resuspended in 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 22.8 eq.) and stirred for a further 1 h. The reaction was concentrated and resuspended in HC1 with 6 drops of water added, stirred for 5 min and concentrated in vacuo. The residue was redissolved in water and concentrated before being dried in a vacuum oven. The residue was then stirred with 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 22.8 eq.) for 1 h, and concentrated to dryness. This process was repeated twice, where water was added on the final repeat, and the solution was concentrated to dryness and dried in a vacuum oven overnight to afford the product (134 mg, 0.216 mmol, 62% yield) as a yellow solid. UPLC-MS (acidic 6 min): Rt = 1.58 min; m/z = 577.4 for [M+H] ⁺ , 93% purity. 1H NMR (400 MHz, DMSO-d6) 5 10.23 (s, 1H), 9.26 (s, 2H), 9.19 (s, 2H), 8.95 (d, J = 8.0 Hz, 1H), 8.12 (d, J = 5.0 Hz, 3H), 8.10 - 8.05 (m, 1H), 7.98 - 7.89 (m, 2H), 7.72 (s, 1H), 7.57 (d, J = 7.8 Hz, 1H), 7.56 - 7.35 (m, 3H), 7.28 - 7.19 (m, 1H), 7.18 - 7.06 (m, 2H), 5.03 - 4.93 (m, 1H), 3.42 - 3.33 (m, 1H), 3.03 (dd, J = 13.9, 10.2 Hz, 2H), 2.36 (t, J = 13.4 Hz, 1H), 2.04 (d, J = 11.2 Hz, 2H), 1.92 (d, J = 8.2 Hz, 2H), 1.46 (dp, J = 24.7, 12.5 Hz, 4H). - small aliphatic impurities at 1.76 and 1.23 ppm, integrating to 0.15 and 0.25 respectively, product is mono-HCl salt.

Example 84: Exemplary synthesis of Compound 261

[0001613] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001614] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2- Aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in Toluene (245 mL) was added DIPEA (22.0 mb, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirring for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H). Purity appears to be ca. 90%

[0001615] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001616] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid. 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). One CH not observed. 0.5 eq. of residual 1,4-dioxane. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺

[0001617] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001618] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001619] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001620] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (3.40 g, 6.29 mmol, 1.0 eq.), iron (3.52 g, 62.9 mmol, 10.0 eq.) and ammonium chloride (1.68 g, 31.5 mmol, 5.0 eq.) in ethanol (35 mL) and water (17.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL), water (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.53 g as a yellow solid. The Celite was re-extracted with further ethanol (100 ml) and DCM (100 mL). The filtrate was concentrated in vacuo, resuspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL) and water (100 ml), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.09 g as a yellow oil. These were combined to afford the product (2.62 g, 6.04 mmol, 96% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 435.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001621] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxamide

[0001622] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added oxazole-5-carboxylic acid (156 mg, 1.38 mmol, 1.2 eq.) N,N-diisopropylethylamine (DIPEA) (0.60 mL, 3.45 mmol, 3.0 eq.) and O-(7-Azabenzotriazol-l-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 3.5 h. The reaction mixture was suspended in EtOAc (25 mL) and washed with water (25 mL), aq. saturated NaHCO3 (25 mL), and water (25 mL). The resulting precipitate was filtered away from the organics and washed with EtOAc to afford the product (425 mg, 0.803 mmol, 70% yield) as a beige solid. UPLC-MS (basic 2 min): Rt = 1.05 min; m/z = 530.1 [M+H]- ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 10.51 (s, 1H), 9.04 (s, 1H), 8.70 (d, J = 0.5 Hz, 1H), 8.09 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 8.03 (d, J = 0.3 Hz, 1H), 7.98 - 7.90 (m, 2H), 7.78 (ddd, J = 8.2, 2.2, 1.1 Hz, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 - 7.47 (m, 2H), 7.43 (dddd, J = 8.3, 3.8, 2.9, 1.3 Hz, 2H), 7.28 (t, J = 7.9 Hz, 1H), 7.24 - 7.16 (m, 2H), 4.97 (d, J = 10.5 Hz, 1H), 3.39 (dd, J = 14.5, 5.0 Hz, 1H), 2.99 (dd, J = 13.8, 10.7 Hz, 1H).

[0001623] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]oxazole-5 -carboxamide

[0001624] To a magnetically stirred suspension of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxamide (425 mg, 0.803 mmol, 1.0 eq.) in ethanol (10 mb) was added N,N-diisopropylethylamine (DIPEA) (0.42 mb, 2.41 mmol, 3.0 eq.) and hydroxylammonium chloride (112 mg, 1.61 mmol, 2.0 eq.) and the reaction mixture was heated to 85 °C and stirred for 2.5 h before being cooled to RT and stirred for 72 h. The reaction mixture was then concentrated to afford the product (452 mg, 0.803 mmol, assumed quantitative yield) as an orange foam. UPLC-MS (basic 2 min): Rt = 0.92 min; m/z = 563.2 [M+H] ⁺

[0001625] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(oxazole-5- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate

[0001626] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]oxazole-5 -carboxamide (451 mg, 0.802 mmol, 1.0 eq.) and acetic anhydride (0.23 mL, 2.40 mmol, 3.0 eq.) in acetic acid (4 mL) was stirred at RT for 20 h. The reaction mixture was concentrated in vacuo and purification was attempted via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in ioshexane to afford the product (283 mg, 0.468 mmol, 58% yield) as a colourless oil. UPLC-MS (basic 2 mm): Rt = 0.97 mm; m/z = 605.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO- d6) 5 10.41 (s, 1H), 8.96 (d, J = 8.1 Hz, 1H), 8.68 (s, 1H), 8.09 - 8.03 (m, 1H), 8.00 (s, 1H), 7.97 - 7.89 (m, 2H), 7.72 (dd, J = 8.0, 1.8 Hz, 1H), 7.57 (s, 1H), 7.51 - 7.34 (m, 3H), 7.28 - 7.16 (m, 3H), 7.08 (t, J = 7.7 Hz, 1H), 6.67 (s, 2H), 4.99 - 4.90 (m, 1H), 3.01 (dd, J = 13.8, 9.9 Hz, 1H), 2.12 (d, J = 0.5 Hz, 3H). One aliphatic proton not observed

[0001627] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxa mide hydrochloride

[0001628] A mixture of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(oxazole-5- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate (283 mg, 0.468 mmol, 1.0 eq.) and zinc (612 mg, 9.36 mmol, 20.0 eq.) in acetic acid (9.4 mL) was stirred at RT for 20 h. Further zinc (612 mg, 9.36 mmol, 20.0 eq.) was added and the reaction was stirred at RT for a further 20 h. The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM and the filtrate was concentrated in vacuo. The residue was submitted for purification via prep-HPLC on a Waters XBridge C18 eluting with 25-100% MeCN in water (0.2% TFA) to afford the TFA salt of the procuct. The residue was suspended in 4 N HC1 in 1,4-dioxane (2.0 mL) and stirring for 5 min before being concentrated in vacuo. This process was repeated twice more and on the last repeat, 6 drops of water were added for to aid solubility. The residue was dissolved in MeCN/water, concentrating in vacuo and drying in a vacuum oven overnight. The entire process was then repeated a second time to afford the product (85 mg, 0.145 mmol, 51% yield) as an off-white solid. UPLC-MS (basic 6 min): Rt = 1.97 min; m/z = 547.2 for [M+H] ⁺ , 93% purity. 1H NMR (400 MHz, DMSO-d6) 5 10.54 (s, 1H), 9.18 (s, 2H), 8.98 (d, J = 8.0 Hz, 1H), 8.93 (s, 2H), 8.70 (s, 1H), 8.09 (s, 1H), 8.09 - 8.03 (m, 1H), 7.97 (t, J = 1.9 Hz, 1H), 7.96 - 7.88 (m, 1H), 7.78 - 7.70 (m, 2H), 7.58 - 7.51 (m, 1H), 7.51 - 7.44 (m, 2H), 7.42 (td, J = 7.6, 1.4 Hz, 1H), 7.26 - 7.13 (m, 3H), 5.08 - 4.98 (m, 1H), 3.44 - 3.35 (m, 1H), 3.05 (dd, J = 13.9, 10.2 Hz, 1H). - 0.7 wt.% residual 1,4-dioxane present, aliphatic impurity assumed to be grease at 1.23 ppm integrates to 0.30, product is mono-HCl salt

Example 85: Exemplary synthesis of Compound 262

[0001629] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001630] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (11.3 g, 38.9 mmol, 1.0 eq.) in toluene (230 mL) were added 2- aminothiophenol (4.6 mL, 42.7 mmol, 1.1 eq.), T3P (28.0 mL, 46.6 mmol, 1.2 eq.) and DIPEA (14.0 mL, 77.7 mmol, 2.0 eq.). The resulting mixture was stirred at RT for 45 min, then at 115 °C for 5 h. The reaction mixture was cooled to RT, stirred for 17 h, then stirred at 115 °C for 1 h. The reaction mixture was cooled to RT and quenched with aq. saturated Na ₂ CO ₃ (200 mL). The organics were extracted into EtOAc (200 mL), washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was purified by normal phase column chromatography (220 g cartridge) eluting with 0-20% EtOAc in DCM to afford the product (7.50 g, 19.8 mmol, 51% yield) as an off-white solid. 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.98 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.92 (d, J = 8.8 Hz, 1H), 7.81 (d, J = 1.9 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.21 - 5.11 (m, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.12 (dd, J = 13.8,

11.1 Hz, 1H), 1.30 (s, 9H). UPLC-MS (basic 2 mm): Rt = 1.25 mm; m/z = 380.1 for [M+H] ⁺

[0001631] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001632] A magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (7.50 g, 19.8 mmol, 1.0 eq.) in 1,4-dioxane (25 mL) was added 4 N HC1 in 1,4-dioxane (75.0 mL, 300 mmol, 15.2 eq.) and the reaction mixture was stirred at RT for 3 h. The reaction mixture was then concentrated to dryness to afford the product (5.05 g, 15.7 mmol, 79% yield) as a brown solid, which was used in the next step without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.09 (s, 3H), 8.15 (dd, J = 7.8, 1.2 Hz, 1H), 8.05 (dd, J = 8.1,

1.1 Hz, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.74 (dd, J = 7.6, 1.5 Hz, 1H), 7.57 (td, J = 7.7, 1.5 Hz, 2H), 7.53 - 7.45 (m, 2H), 5.32 (t, J = 7.4 Hz, 1H), 3.54 (dd, J = 13.9, 6.3 Hz, 1H), 3.38 (dd, J = 14.0, 8.4 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.02 mm; m/z = 280.2 for [M+H] ⁺

[0001633] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001634] To a magnetically stirred suspension of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (5.05 g, 16.0 mmol, 1.0 eq.) in DMF (40 mL) cooled to 0 °C was added tri ethylamine (6.7 mL, 48.0 mmol, 3.0 eq.) and the reaction mixture was stirred for 10 min. Methy 1-3 -chlorosulfonylbenzoate (4.50 g, 19.2 mmol, 1.2 eq.) was added portionwise over 10 min and the reaction mixture was stirred for 10 min before gently warming to RT and stirring for 2 h. The reaction was quenched via the addition of water (150 mL). The organics were extracted with ethyl acetate (250 mL), washed with water (3 x 200 mL) and dried over anhydrous sodium sulfate, filtered and concentrated to dryness. The residue was triturated with DCM, filtered and air dried to afford product (6.50 g, 13.6 mmol, 85% yield) as an off-white solid. 1H NMR analysis (400 MHz, DMSO-d6) 5 9.17 (d, J = 8.5 Hz, 1H), 8.10 - 8.05 (m, 1H), 7.95 - 7.84 (m, 3H), 7.72 (ddd, J = 7.8, 2.0, 1.1 Hz, 1H), 7.61 (s,lH), 7.51 (ddd, J = 8.0, 6.8, 1.4 Hz, 2H), 7.48 - 7.40 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 5.12 - 5.00 (m, 1H), 3.88 (s, 3H), 3.39 (dd, J = 13.9, 4.3 Hz,lH), 3.01 (dd, J = 13.9, 10.9 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 1.12 mm. m/z =

478.2 for [M+H] ⁺

[0001635] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001636] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (6.50 g, 13.6 mmol, 1.0 eq.) in THF (115 mL) was added a solution of lithium hydroxide (1.71 g, 40.8 mmol, 3.0 eq.) in water (35 mL) and the resulting mixture was stirred at RT for 3 h. The reaction volume was reduced by half and the reaction was diluted with EtOAc (100 mL) and water (150 mL). The phases were separated, and the aqueous phase was acidified to pH 4 via the addition of 1 M HC1. The precipitate was collected by filtration, washing with water, and air dried. The filter was washed with MeOH and the filtrate was concentrated to dryness. The solids were combined to afford product (5.43 g, 11.7 mmol, 86% yield) as a white solid, which was used in the next step without further purification. 1H NMR analysis (400 MHz, DMSO-d6) 5 13.32 (s, 1H), 9.13 (d, J = 8.5 Hz, 1H), 8.07 (dd, J = 7.9, 1.3 Hz, 1H), 7.98 - 7.87 (m, 3H), 7.70 - 7.63 (m, 1H), 7.60 (d, J = 1.8 Hz, 1H), 7.56 - 7.47 (m, 2H), 7.47 - 7.38 (m, 3H), 7.22 (t, J = 7.7 Hz, 1H), 5.06 (ddd, J = 10.6, 8.3, 4.3 Hz, 1H), 3.44 - 3.38 (m, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H). UPLC-MS (basic 2 mm) Rt = 0.82 mm. m/z =

464.2 for [M+H] ⁺

[0001637] Step 5: tert-butyl 4-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoyl]piperazine-1-carboxylate

[0001638] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (500 mg, 1.08 mmol, 1.0 eq.) in DMF (5 mL) were added 1-boc-piperazine (241 mg, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.24 mmol, 3.0 eq.) and

HATU (615 mg, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 4 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25 mL). The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness to afford the product (592 mg, 0.937 mmol, 87% yield) as a beige foam that was used without further purification. 1H NMR (400 MHz, DMSO-d6) 5 9.08 (d, J = 8.5 Hz, 1H), 8.05 (ddd, J = 8.0, 1.3, 0.6 Hz, 1H), 7.94 - 7.88 (m, 1H), 7.69 (d, J = 1.8 Hz, 1H), 7.58 (q, J = 1.5 Hz, 1H), 7.56 (dt, J = 2.8, 1.4 Hz, 1H), 7.55 (d, J = 2.1 Hz, 1H), 7.52 (q, J = 1.4 Hz, 1H), 7.51 - 7.46 (m, 2H), 7.42 (ddd, J = 8.4, 7.2, 1.2 Hz, 1H), 7.34 (q, J = 7.8 Hz, 2H), 5.11 (t, J = 11.6 Hz, 1H), 3.40 (dd, J = 13.9, 4.8 Hz, 1H), 3.05 (dd, J = 13.9, 10.3 Hz, 1H), 2.91 (s, 1H), 2.87 (s, 1H), 1.42 (s, 9H). 6 aliphatic protons not observed. UPLC-MS (basic 2 min) Rt = 1.18 min. m/z = 630.3 for [M-H]'

[0001639] Step 6: tert-butyl 4-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl] ethyl] sulfamoyl] benzoyl] piperazine-1-carboxy late

[0001640] To a magnetically stirred solution of tert-butyl 4-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoyl]piperazine-1-carboxylate (592 mg, 0.937 mmol, 1.0 eq.) in EtOH (12 mL) were added DIPEA (0.49 mL, 2.81 mmol, 3.0 eq.) and hydroxylamine hydrochloride (130 mg, 1.87 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 21 h, then cooled to RT and concentrated to dryness to afford product (623 mg, 0.937 mmol, assumed quantitative yield), as a beige solid, which was used in the next step without further purification. UPLC-MS (basic 2 min) Rt = 1.07 min. m/z = 665.3 for [M+H] ⁺

[0001641] Step 7: tert-butyl 4-[3-[[2-[3-(N'-acetoxycarbamimidoyl)phenyl]-l-(l,3- benzothiazol-2-yl)ethyl]sulfamoyl]benzoyl]piperazine-1-carbo xylate

[0001642] To a magnetically stirred slurry of tert-butyl 4-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3- (N'-hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]benzoyl]pipe razine-1-carboxylate (623 mg, 0.937 mmol, 1.0 eq.) in acetic acid (6 mL) was added acetic anhydride (0.27 mL, 2.81 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 5 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (20 g cartridge) eluting with 0-100% EtOAc in Ao-hexane to afford product (388 mg, 0.549 mmol, 56% yield) as a colourless glass. 1H NMR (400 MHz, DMSO-d6) 5 9.07 (s, 1H), 8.03 (d, J = 8.0 Hz, 1H), 7.90 (dd, J = 8.1, 1.0 Hz, 1H), 7.62 (s, 1H), 7.58 (t, J = 1.8 Hz, 1H), 7.54 - 7.49 (m, 1H), 7.49 - 7.44 (m, 2H), 7.44 - 7.38 (m, 2H), 7.29 (dd, J = 13.9, 7.4 Hz, 2H), 7.16 (t, J = 7.7 Hz, 1H), 6.75 (s, 2H), 5.05 (s, 1H), 3.05 (dd, J = 13.9, 9.6 Hz, 1H), 2.14 (s, 3H), 1.42 (s, 8H). CH not observed. UPLC-MS (basic 2 min): Rt = 1.09 min; m/z = 707.3 for [M+H] ⁺

[0001643] Step 8: 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(piperazine-l- carbonyl)phenyl]sulfonylamino]ethyl]benzamidine

[0001644] To a magnetically stirred solution of tert-butyl 4-[3-[[2-[3-(N'- acetoxycarbamimidoyl)phenyl]-l-(l,3-benzothiazol-2-yl)ethyl] sulfamoyl]benzoyl]piperazine-l- carboxylate (388 mg, 0.549 mmol, 1.0 eq.) in acetic acid (5 mL) was added zinc (359 mg, 5.49 mmol, 10.0 eq.). The reaction mixture was stirred at RT for 66 h. The reaction mixture was then filtered, washing with copious EtOH and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative HPLC on an XSelect CSH C18 (30 mm x 150 mm, 5 um) eluting with 15-100% MeCN in water (0.1% v/v NH ₃ ). The residue was then stirred with 4N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 83.7 eq.) at RT for 4 h before being concentrated to dryness. The residue was triturated with Et ₂ O (2 x ca. 2 mL) and then suspended in MeCN/water before being concentrated to dryness and dried in a vacuum oven to afford the product (44.0 mg, 0.0762 mmol, 14% yield) as an off-white solid. 1H NMR (VT) (400 MHz, DMSO-d6) 5 9.50 (s, 2H), 9.18 (s, 2H), 9.07 (s, 2H), 8.91 (d, J = 8.3 Hz, 1H), 8.02 (ddd, J = 7.9, 1.3, 0.7 Hz, 1H), 7.94 - 7.87 (m, 1H), 7.80 (t, J = 1.8 Hz, 1H), 7.71 (t, J = 1.7 Hz, 1H), 7.62 (dt, J = 8.0, 1.5 Hz, 2H), 7.54 - 7.47 (m, 3H), 7.42 (ddd, J = 8.4, 7.2, 1.3 Hz, 1H), 7.35 (dt, J = 12.1, 7.8 Hz, 2H), 5.15 (td, J = 8.9, 5.5 Hz, 1H), 3.65 (s, 4H), 3.49 - 3.39 (m, 1H), 3.23 - 3.16 (m, 1H), 3.14 (d, J = 6.3 Hz, 4H). - Aliphatic impurity assumed to be grease at 1.26 ppm integrates to 0.19, aliphatic CH not observed, product is bis-HCl salt. UPLC-MS (acidic 6 min): Rt = 1.68 min; m/z = 549.3 for [M+H] ⁺ , 95% purity. 1H NMR - D ₂ O (VT) (400 MHz, DMSO-d6) 5 7.98 (d, J = 8.0 Hz, 1H), 7.87 (d, J = 8.1 Hz, 1H), 7.72 (s, 1H), 7.66 (s, 1H), 7.62 (ddd, J = 7.9, 1.9, 1.1 Hz, 1H), 7.58 (d, J

= 7.7 Hz, 1H), 7.53 - 7.46 (m, 3H), 7.44 - 7.39 (m, 1H), 7.35 (q, J = 7.6 Hz, 2H), 5.11 (dd, J =

9.3, 5.5 Hz, 1H), 3.60 (s, 4H), 3.46 - 3.38 (m, 1H), 3.22 - 3.16 (m, 1H), 3.13 (t, J = 5.2 Hz, 4H).

Example 86: Exemplary synthesis of Compound 263

[0001645] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001646] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2- Aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in Toluene (245 mL) was added DIPEA (22.0 mb, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃

(200 mL) and stirring for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H). Purity appears to be ca. 90%

[0001647] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001648] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid. 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). 1 aliphatic proton not observed, 0.5 eq. of residual dioxane. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺

[0001649] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001650] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001651] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001652] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (3.40 g, 6.29 mmol, 1.0 eq.), iron (3.52 g, 62.9 mmol, 10.0 eq.) and ammonium chloride (1.68 g, 31.5 mmol, 5.0 eq.) in ethanol (35 mL) and water (17.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL), water (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.53 g as a yellow solid. The Celite was re-extracted with further ethanol (100 ml) and DCM (100 mL). The filtrate was concentrated in vacuo, resuspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL) and water (100 ml), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.09 g as a yellow oil. These were combined to afford the product (2.62 g, 6.04 mmol, 96% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 435.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001653] Step 5: tert-butyl N-[4-[[3-[[l-(l, 3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]cyclohexyl]carb amate

[0001654] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (10 mL) was added boc-cis-4-aminocyclohexane carboxylic acid (336 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 18 h. The reaction was redosed with DIPEA (0.30 mL, 1.73 mmol, 1.5 eq.), boc- cis-4-aminocyclohexane carboxylic acid (168 mg, 0.690 mmol, 0.6 eq.) and HATU (328 mg, 0.863 mmol, 0.75 eq.) and stirred at RT for 18 h. The reaction mixture was diluted with ethyl acetate (25 mL) and washed with brine (25 mL), saturated sodium hydrogen carbonate solution (25 mL), and brine again (25 mL). The organics were dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The reaction mixture was concentrated to dryness under reduced pressure and the residue was purified by reverse-phase column chromatography over C18 (45 g cartridge) eluting with a gradient of MeCN (0.1% NH ₃ ) (40% to 80%; v/v) in water (0.1% NH ₃ ) to afford the product (301 mg, 0.456 mmol, 40% yield) as a white solid. UPLC-MS (basic 2 mm): Rt = 1.20 mm; m/z = 660.4 [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.87 (s, 1H), 8.95 (s, 1H), 8.09 (ddd, J = 7.9, 1.3, 0.7 Hz, 1H), 7.98 - 7.91 (m, 1H), 7.85 (t, J = 2.0 Hz, 1H), 7.58 - 7.53 (m, 2H), 7.52 - 7.49 (m, 1H), 7.48 - 7.45 (m, 1H), 7.44 - 7.41 (m, 2H), 7.21 (td, J = 7.9, 6.4 Hz, 2H), 7.10 (ddd, J = 7.8, 1.8, 1.1 Hz, 1H), 6.78 (s, 1H), 4.93 (dd, J = 10.4, 4.1

Hz, 1H), 3.41 - 3.35 (m, 2H), 2.97 (dd, J = 13.9, 10.9 Hz, 1H), 2.40 (dt, J = 8.8, 4.9 Hz, 1H), 1.86 (q, J = 11.2 Hz, 2H), 1.71 (d, J = 4.5 Hz, 2H), 1.64 - 1.47 (m, 4H), 1.39 (s, 9H).

[0001655] Step 6: tert-butyl N-[4-[[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[rac-(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]carbamoyl ]cyclohexyl]carbamate

[0001656] To a magnetically stirred solution of tert-butyl N-[4-[[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]cyclohexyl ]carbamate (301 mg, 0.456 mmol, 1.0 eq.) in EtOH (8 mL) were added hydroxylamine hydrochloride (63 mg, 0.912 mmol, 2.0 eq.) and DIPEA (0.24 mL, 1.37 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (316 mg, 0.456 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.10 min; m/z = 693.4 for [M+H] ⁺

[0001657] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[[4-(tert- butoxycarbonylamino)cyclohexanecarbonyl]amino]phenyl]sulfony lamino]ethyl]phenyl]methyle ne] amino] acetate

[0001658] To a magnetically stirred solution of tert-butyl N-[4-[[3-[[l-(l,3-benzothiazol-2-yl)- 2-[3-[rac-(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]carbamoyl ]cyclohexyl]carbamate (316 mg, 0.456 mmol, 1.0 eq.) in acetic acid (6 mL) was added acetic anhydride (0.043 mL, 0.456 mmol, 1.0 eq.) and the reaction mixture was stirred at RT for 72 h. The reaction was redosed with acetic anhydride (0.043 mL, 0.456 mmol, 1.0 eq.) in acetic acid (6 mL) and stirred for 18 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (20 g cartridge) eluting with 0-100% EtOAc in iso-hexane to afford the product (133 mg, 0.181 mmol, 40% yield) as a colourless glass. UPLC-MS (basic 2 mm): Rt = 1.13 mm; m/z = 735.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.80 (s, 1H), 8.04 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.94 - 7.87 (m, 2H), 7.56 (s, 1H), 7.53 - 7.46 (m, 2H), 7.41 (ddt, J = 8.5, 7.2, 1.0 Hz, 2H), 7.21 (d, J = 7.7 Hz, 1H), 7.17 - 7.05 (m, 3H), 6.78 (s, 1H), 6.70 (s,

2H), 4.91 (dd, J = 9.4, 5.4 Hz, 1H), 3.49 (d, J = 13.4 Hz, 1H), 3.28 (d, J = 6.3 Hz, 1H), 3.00 (dd, J = 13.8, 9.7 Hz, 1H), 2.36 (s, 1H), 2.16 - 2.14 (m, 3H), 2.13 (d, J = 2.3 Hz, 1H), 1.84 (d, J = 0.7 Hz, 1H), 1.80 (d, J = 6.8 Hz, 1H), 1.69 (s, 2H), 1.52 (q, J = 12.8 Hz, 4H), 1.39 (d, J = 0.7 Hz, 9H).

[0001659] Step 8: tert-butyl N-[4-[[3-[[l-(l, 3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]cyclohe xyl]carbamate

[0001660] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [[3-[[4-(tert- butoxycarbonylamino)cyclohexanecarbonyl]amino]phenyl]sulfony lamino]ethyl]phenyl]methyle ne]amino] acetate (133 mg, 0.181 mmol, 1.0 eq.) in acetic acid (4 mL) was added zinc (118 mg, 1.81 mmol, 10.0 eq.). The reaction mixture was stirred at RT for 72 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was submitted for purification via prep-HPLC on a Waters XBridge C18 eluting with 45-100% MeCN in water (0.1% NH ₄ OH) to afford the product (25 mg, 0.0369 mmol, 20% yield) as a white solid. UPLC-MS (acidic 6 min): Rt = 3.02 min; m/z = 677.4 for [M+H] ⁺ , 97% purity

[0001661] Step 9: 4-amino-N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]cyclohexanecarbox amide

[0001662] To a magnetically stirred solution of tert-butyl N-[4-[[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-carbamimidoylphenyl)ethyl] sulfamoyl] phenyl] carbamoyl] cyclohexyl] carbamate (25 mg, 0.0369 mmol, 1.0 eq.) in 1,4-dioxane (1 mL) was added 4 N HC1 in 1,4-dioxane (1.0 mL, 28.8 mmol, 780 eq.) and the resultant suspension was stirred at RT for 18 h. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in water and concentrated under reduced pressure and dried in the vacuum oven overnight to afford the product (25 mg, 0.0433 mmol, assumed quantitative yield) as beige solid flakes. UPLC-MS (acidic 6 min): Rt = 1.52 mm; m/z = 577.4 for [M+H] ⁺ , 92% purity. 1H NMR (400 MHz, DMSO-d6) 5 10.08 (s, 1H), 9.23 (s, 2H), 9.07 (s, 2H), 8.92 (d, J = 8.2 Hz, 1H), 8.10 - 8.05 (m, 1H), 7.97 (t, J = 2.0 Hz, 3H), 7.93 - 7.90 (m, 1H), 7.72 (s, 1H), 7.57 (d, J = 7.9 Hz, 1H), 7.55 - 7.46 (m, 3H), 7.43 (td, J = 7.7, 1.4

Hz, 1H), 7.26 (t, J = 7.7 Hz, 1H), 7.14 (t, J = 7.8 Hz, 1H), 7.09 (dt, J = 7.8, 1.5 Hz, 1H), 5.00 (ddd, 1H), 3.38 (dd, J = 13.4, 5.2 Hz, 1H), 3.22 (s, 1H), 3.05 (dd, J = 13.8, 10.1 Hz, 1H), 1.97 (d, J = 8.2 Hz, 2H), 1.78 (s, 4H), 1.68 (d, J = 9.0 Hz, 2H). - mono-HCl salt, One CH signal not observed. 1H NMR - D ₂ O (400 MHz, DMSO-d6) 5 8.03 - 7.98 (m, 1H), 7.91 - 7.84 (m, 2H), 7.64 (t, J = 1.8 Hz, 1H), 7.53 - 7.50 (m, 1H), 7.49 - 7.45 (m, 2H), 7.41 (ddt, J = 8.3, 3.9, 1.4 Hz, 2H), 7.27 (t, J = 7.9 Hz, 1H), 7.19 - 7.07 (m, 2H), 4.97 (dd, J = 10.1, 5.1 Hz, 1H), 3.38 - 3.32 (m, 1H), 3.18 (t, J = 5.6 Hz, 1H), 3.06 (dd, J = 14.3, 10.0 Hz, 1H), 1.88 (dd, J = 12.4, 5.7 Hz, 2H), 1.79 - 1.71 (m, 4H), 1.68 - 1.61 (m, 2H). - One CH signal not observed. 1H NMR (400 MHz, MeOD-d4) 5 7.95 (d, J = 1.7 Hz, 1H), 7.88 - 7.81 (m, 2H), 7.70 (s, 1H), 7.60 (d, J = 7.8 Hz, 1H), 7.54 (d, J = 7.7 Hz, 1H), 7.49 - 7.45 (m, 2H), 7.44 - 7.41 (m, 2H), 7.41 - 7.37 (m, 1H), 7.34 (ddd, J = 7.8, 1.8, 1.0 Hz, 1H), 7.21 - 7.17 (m, 1H), 5.12 (dd, J = 9.1, 5.9 Hz, 1H), 3.48 - 3.42 (m, 1H), 2.58 (t, J = 5.2 Hz, 1H), 2.06 - 1.98 (m, 2H), 1.90 (d, J = 5.6 Hz, 4H), 1.80 (dt, J = 9.5, 4.9 Hz, 2H). One CH signal not observed

Example 87: Exemplary synthesis of Compound 244

[0001663] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001664] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (16.0 g, 55.1 mmol, 1.0 eq.) and 2-aminothiophenol (6.5 mL, 60.6 mmol, 1.1 eq.) in toluene (300 mL) was added DIPEA (14.0 mL, 82.7 mmol, 1.5 eq.) and T3P (25.0 mL, 41.3 mmol, 0.8 eq.). The reaction was heated to 115 °C and stirred for 8.5 h. The reaction mixture was re-dosed with T3P (25.0 mL, 41.3 mmol, 0.8 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction was concentrated to dryness to give a residue, which was dissolved in EtOAc (200 mL). The resulting solution was washed sequentially with aq. saturated Na ₂ CO ₃ solution (2 x 100 mL) and brine (100 mL). The organic fraction was dried over anhydrous Na ₂ SO ₄ and concentrated to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (7.12 g, 18.8 mmol, 34% yield) as a brown solid. UPLC-MS (basic 2 min): Rt = 1.23 mm; m/z = 280.0 for [M-Boc] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 8.05 (d, 1H), 7.94 (dt, J = 8.0, 1.1 Hz, 1H), 7.88 (d, J = 8.7 Hz, 1H), 7.77 (t, J = 1.8 Hz, 1H), 7.67 (dd, J = 7.8, 1.7 Hz, 2H), 7.52 - 7.45 (m, 2H), 7.40 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.12 (ddd, J = 11.1, 8.8, 4.3 Hz, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.10 - 3.05 (m, 1H), 1.26 (s, 9H).

[0001665] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001666] Tert-butyl N-[l -(1 ,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamate (7.12 g, 18.8 mmol, 1.0 eq.) was dissolved in 4 N HC1 in 1,4-dioxane (35.0 mL, 18.8 mmol, 1.0 eq.) and the resultant solution was stirred at RT for 21 h. The reaction mixture was then concentrated to dryness to afford the product (6.24 g, 19.8 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.01 mm; m/z = 280.0 for [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 9.12 - 8.99 (m, 3H), 8.15 - 8.08 (m, 1H), 8.01 (d, J = 8.0 Hz, 1H), 7.78 (s, 1H), 7.69 (d, J = 7.6 Hz, 1H), 7.57 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.28 (s, 1H), 3.50 (dd, J = 13.9, 6.3 Hz, 1H), 3.39 - 3.28 (m, 1H).

[0001667] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001668] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (6.24 g, 19.8 mmol, 1.0 eq.) in DMF (62 mL), cooled to 0 °C, was added triethylamine (9.6 mL, 69.2 mmol, 3.5 eq.) and the resultant solution was stirred for 10 min. To the cooled solution was added 3 -nitrobenzenesulfonyl chloride (5.25 g, 23.7 mmol, 1.2 eq.) portionwise over 10-15 min. The resultant mixture was then gently warmed to RT and stirred for 2 h. The organics were then extracted into EtOAc (300 mL), washed with aq. saturated Na ₂ CO ₃ solution (250 mL), and water (250 mL). The organics were then dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated to dryness. The residue was triturated with DCM (25 mL) and filtered under vacuum to afford the product (3.83 g, 7.09 mmol, 36% yield) as a beige solid, which was used in the next step without further purification. UPLC-MS (basic 2 mm): Rt = 1.17 mm; m/z = 465.0 for [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 9.37 (s, 1H), 8.22 - 8.15 (m, 1H), 8.11 - 8.04 (m, 3H), 7.88 (t, J = 6.9 Hz, 2H), 7.64 (d, J = 2.1 Hz, 1H), 7.61 - 7.46 (m, 3H), 7.46 - 7.38 (m, 2H), 7.24 (td, J = 7.8, 2.0 Hz, 1H), 5.17 (d, J = 10.5 Hz, 1H), 3.41 (d, J = 14.2 Hz, 1H), 3.03 (t, J = 12.5 Hz, 1H).

[0001669] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001670] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-nitro-benzenesulfonamide (3.83 g, 7.09 mmol, 1.0 eq.) in ethanol (38 mL) and water (19 mL), under N2, were added ammonium chloride (1.90 g, 35.5 mmol, 5.0 eq.) and iron (3.96 g, 70.9 mmol, 10.0 eq.). The reaction mixture was heated to 85 °C and stirred for 4 h. The reaction mixture was then cooled to RT and filtered through a plug of Celite under vacuum, washing with copious EtOH. The crude solid was dissolved in DCM (60 mL) and washed with aq. saturated Na ₂ CO ₃ solution (60 mL). The organics were extracted with DCM (2 x 60 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude was re-suspended in EtOH (24 mL) and water (12 mL), followed by addition of iron (1.98 g, 35.5 mmol) and ammonium chloride (0.95 g, 17.7 mmol) at RT. The resultant mixture was heated to 85 °C and stirred for 4.5 h before being cooled to RT. After 18 h of stirred at RT, the reaction mixture was filtered over Celite, rinsed with copious EtOH and DCM and concentrated under reduced pressure. The residue was suspended in EtOAc (50 mL) and washed with aq. saturated Na ₂ CO ₃ solution (50 mL). The organics were extracted with EtOAc (2 x 50 mL), combined, dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to afford the product (2.13 g, 4.08 mmol, 57% yield) as a brown foam. UPLC-MS (basic 2 min): Rt = 1.09 mm; m/z = 435.1 for [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 8.73 (s, 1H), 8.11 - 8.06 (m,

1H), 8.00 - 7.88 (m, 1H), 7.57 (d, J = 1.7 Hz, 1H), 7.56 - 7.46 (m, 3H), 7.46 - 7.40 (m, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.54 (m, 2H), 5.40 (s, 2H), 4.93 - 4.86 (m, 1H), 3.40 - 3.32 (m, 1H), 2.98 (dd, J = 13.8, 9.8 Hz, 1H).

[0001671] Step 5: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]-N-methyl-c arbamate

[0001672] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (735 mg, 1.69 mmol, 1.0 eq.) in DMF (12 mb) was added N-Boc-sarcosine (384 mg, 2.03 mmol, 1.2 eq.), DIPEA (0.88 mL, 5.07 mmol, 3.0 eq.) and HATU (965 mg, 2.54 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 20 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with brine (25 mL), aq. saturated Na ₂ CO ₃ solution (25 mL), and brine again (25 mL). The organics were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by normal-phase column chromatography over silica (20 g cartridge) eluting with a gradient of EtOAc (40% to 100%; v/v) in iso-hexane to afford the product (635 mg, 1.05 mmol, 62% yield) as a yellow oil. UPLC-MS (basic 2 mm): Rt = 1.15 mm; m/z = 606.2 [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 10.12 (d, J = 10.2 Hz, 1H), 8.99 (s, 1H), 8.09 (s, 1H), 7.95 (d, J = 8.2 Hz, 1H), 7.82 (s, 1H), 7.57 - 7.42 (m, 8H), 7.22 (t, J = 8.0 Hz, 2H), 7.13 (d, J = 8.0 Hz, 1H), 4.93 (s, 1H), 2.92 (s, 2H), 2.88 (s, 2H), 1.43 (s, 5H), 1.33 (s, 5H).

[0001673] Step 6: tert-butyl N-[2-[3-[[l-(l, 3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]anilino]-2-oxo-e thyl]-N-methyl-carbamate

[0001674] To a magnetically stirred solution of tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]-N-met hyl-carbamate (635 mg, 1.05 mmol, 1.0 eq.) in EtOH (6 mL) were added hydroxylamine hydrochloride (146 mg, 2.10 mmol, 2.0 eq.) and DIPEA (0.55 mL, 3.14 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (670 mg, 1.05 mmol, assumed quantitative yield), as an orange oil, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.24 min; m/z = 639.2 for [M+H] ⁺

[0001675] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[[2-[tert- butoxycarbonyl(methyl)amino]acetyl]amino]phenyl]sulfonylamin o]ethyl]phenyl]methylene]ami no] acetate

[0001676] To a magnetically stirred solution of tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)- 2-[3-[(E)-N' -hydroxy carbamimidoyl]phenyl]ethyl]sulfamoyl]anilino]-2-oxo-ethyl]-N -methyl- carbamate (670 mg, 1.05 mmol, 1.0 eq.) in acetic acid (6 mL) was added acetic anhydride (0.10 mL, 1.06 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 18 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (20 g cartridge) eluting with 0-100% EtOAc in iso-hexane to afford the product (483 mg, 0.709 mmol, 68% yield) as a yellow oil. UPLC-MS (basic 2 min): Rt = 1.08 min; m/z = 681.2 for [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 10.04 (d, J = 10.5 Hz, 1H), 8.04 (d, J = 7.2 Hz, 1H), 7.91 (d, J = 8.2 Hz, 1H), 7.86 (d, J = 13.8 Hz, 1H), 7.59 - 7.37 (m, 5H), 7.25 - 7.07 (m, 4H), 6.71 (d, J = 12.2 Hz, 2H), 4.91 (s, 1H), 3.95 (d, J = 15.5 Hz, 2H), 3.29 (d, J = 5.6 Hz, 1H), 2.99 (s, 1H), 2.88 (d, J = 13.8 Hz, 3H), 2.15 (s, 3H), 1.38 (d, J = 42.2 Hz, 9H). Peak at 8.99 ppm too broad to integrate

[0001677] Step 8: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]-N- methyl-carbamate

[0001678] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [[3 -[[2- [tert- butoxy carbonyl(methyl)amino]acetyl]amino]phenyl]sulfonylamino]ethy l]phenyl]methylene]ami no] acetate (483 mg, 0.709 mmol, 1.0 eq.) in acetic acid (5 mL) was added zinc (928 mg, 14.2 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 96 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was then submitted to Reach for achiral purification via HPLC on a Gemini NX C18 (30mm x 150mm, 5um), eluting with 40-100% MeCN in water (+1% v/v NH ₃ ) to afford the product (66 mg,0.106 mmol, 15% yield) as a white solid. UPLC-MS (acidic 6 min): Rt = 2.48 min; m/z = 623.4 for [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 7.98 (t, J = 8.5 Hz, 1H), 7.86 (d, J = 7.1 Hz, 1H), 7.74 (d, J = 12.4 Hz, 1H), 7.63 (s, 1H), 7.44 (s, 2H), 7.37 (d, J = 7.8 Hz, 1H), 7.21 (s, 1H), 7.12 (s, 3H), 4.79 (s, 1H), 3.96 (d, J = 16.1 Hz, 2H), 3.21 (s, 1H), 3.00 (d, J = 10.5 Hz, 1H), 2.88 (d, J = 13.9 Hz, 3H), 2.07 (s, 2H), 1.42 (s, 4H), 1.31 (s, 5H). - exchangeables not observed

[0001679] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-2-(methylamino)a cetamide

[0001680] To a magnetically stirred solution tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2- (3-carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl] -N-methyl-carbamate (66 mg, 0.106 mmol, 1.0 eq.) in 1,4-dioxane (1.0 mL) was added hydrogen chloride 4 N in 1,4-dioxane (1.0 mL, 28.8 mmol, 271 eq.) and the resultant suspension was stirred at RT for 18 h. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in water and concentrated under reduced pressure and dried in the vacuum oven overnight to afford the product (52 mg, 0.100 mmol, 94% yield) as a beige solid. UPLC-MS (acidic 6 min): Rt = 1.36 mm; m/z = 523.3 for [M+H] ⁺ , 100% purity. ¹ H NMR (400 MHz, DMSO-d6) 5 10.93 (s, 1H), 9.25 (s, 2H), 9.19 (s, 2H), 9.10 (s, 2H), 9.03 (d, J = 8.0 Hz, 1H), 8.11 (d, J = 7.9 Hz, 1H), 7.95 (d, J = 8.3 Hz, 1H), 7.87 (s, 1H), 7.73 (s, 1H), 7.59 (d, J = 7.9 Hz, 1H), 7.55 - 7.42 (m, 4H), 7.27 (t, J = 7.8 Hz, 1H), 7.20 - 7.12 (m, 2H), 5.01 (ddd, J = 12.3, 7.9, 4.5 Hz, 1H), 4.00 (t, J = 5.9 Hz, 2H), 3.43 - 3.37 (m, 1H), 3.02 (dd, J = 14.0, 10.4 Hz, 1H), 2.67 (t, J = 5.3 Hz, 3H). - product appears to be bis-HCl salt

[0001681] Step 10: 2-(methylamino)-N-[3-[[rac-(lR)-l-(l,3-benzothiazol-2-yl)-2- (3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]acetamide

[0001682] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-2-(methylamino)a cetamide (39 mg, 0.0744 mmol) was purified by SFC using Lux iC5 (21.2 mm x 250 mm, 5 um) eluting with 40:60 EtOH:CO ₂ (0.2% v/v Isopropylamine). The residue was triturated with Et ₂ O and dissolved in water before being concentrated under reduced pressure and dried in the vacuum oven overnight to afford the product (12 mg, 0.023 mmol, 31% yield) as a colourless glass. UPLC-MS (acidic 6 mm): Rt = 1.36 mm; m/z = 523.2 for [M+H] ⁺ , 90% purity. ¹ H NMR (400 MHz, DMSO-d6) 5 8.91 (s, 1H), 8.09 - 8.05 (m, 1H), 7.92 (d, J = 8.2 Hz, 1H), 7.90 (t, 1H), 7.70 (s, 1H), 7.54 (d, J = 9.8 Hz, 2H), 7.50 (dd, J = 8.2, 1.3 Hz, 2H), 7.48 - 7.41 (m, 3H), 7.25 (t, J = 7.8 Hz, 1H), 7.18 - 7.10 (m, 2H), 6.50 (s, 1H), 5.02 (s, 1H), 3.08 - 3.01 (m, 1H), 2.39 (s, 3H). - 2 extra protons in aromatic region due to peak clustering between 7.52 and 7.41 ppm, CH and CH ₂ obscured by water peak, 2 exchangeables accounted for (amide at 8.91 ppm and sulfonamide at 5.02 ppm), aliphatic impurities at 1.90 ppm (integrates to 0.19), 1.23 (integrates to 0.56), 1.17-1.15 ppm (integrates to 0.23), 1.14 (integrates to 0.52) D ₂ O (400 MHz, DMSO-d6) 5 8.02 (d, J = 8.0 Hz, 1H), 7.90 (d, J = 8.1 Hz, 1H), 7.84 (s, 1H), 7.60 (s, 1H), 7.53 - 7.42 (m, 6H), 7.25 (t, J = 7.8 Hz, 1H), 7.16 (t, J = 7.8 Hz, 1H), 7.12 (d, J = 7.9 Hz, 1H), 4.97 (dd, J = 10.3, 4.6 Hz, 1H), 3.44 - 3.33 (m, 3H), 3.01 (dd, J = 14.0, 10.4 Hz, 1H), 2.39 (s, 3H). - 1 extra protons in aromatic region due to peak clustering between 7.52 and 7.41 ppm, CH and CH ₂ overlapping but protons accounted for, aliphatic impurities at 1.90 ppm (integrates to 0.19), 1.23 (integrates to 0.56), 1.17-1.15 ppm (integrates to 0.23), 1.14 (integrates to 0.52)

Example 88: Exemplary synthesis of Compound 244

[0001683] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001684] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (16.0 g, 55.1 mmol, 1.0 eq.) and 2-aminothiophenol (6.5 mL, 60.6 mmol, 1.1 eq.) in toluene (300 mL) was added DIPEA (14.0 mL, 82.7 mmol, 1.5 eq.) and T3P (25.0 mL, 41.3 mmol, 0.8 eq.). The reaction was heated to 115 °C and stirred for 8.5 h. The reaction mixture was re-dosed with T3P (25.0 mL, 41.3 mmol, 0.8 eq.) and stirred at 115 °C for 2.5 h before being cooled to RT. The reaction was concentrated to dryness to give a residue, which was dissolved in EtOAc (200 mL). The resulting solution was washed sequentially with aq. saturated Na ₂ CO ₃ solution (2 x 100 mL) and brine (100 mL). The organic fraction was dried over anhydrous Na ₂ SO ₄ and concentrated to dryness. The residue was then purified by normal phase column chromatography (120 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (7.12 g, 18.8 mmol, 34% yield) as a brown solid. UPLC-MS (basic 2 min): Rt = 1.23 mm; m/z = 280.0 for [M-Boc] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 8.05 (d, 1H), 7.94 (dt, J = 8.0, 1.1 Hz, 1H), 7.88 (d, J = 8.7 Hz, 1H), 7.77 (t, J = 1.8 Hz, 1H), 7.67 (dd, J = 7.8, 1.7 Hz, 2H), 7.52 - 7.45 (m, 2H), 7.40 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.12 (ddd, J = 11.1, 8.8, 4.3 Hz, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.10 - 3.05 (m, 1H), 1.26 (s, 9H).

[0001685] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001686] Tert-butyl N-[l -(1 ,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamate (7.12 g, 18.8 mmol, 1.0 eq.) was dissolved in 4 N HC1 in 1,4-dioxane (35.0 mL, 18.8 mmol, 1.0 eq.) and the resultant solution was stirred at RT for 21 h. The reaction mixture was then concentrated to dryness to afford the product (6.24 g, 19.8 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.01 mm; m/z = 280.0 for [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 9.12 - 8.99 (m, 3H), 8.15 - 8.08 (m, 1H), 8.01 (d, J = 8.0 Hz, 1H), 7.78 (s, 1H), 7.69 (d, J = 7.6 Hz, 1H), 7.57 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.28 (s, 1H), 3.50 (dd, J = 13.9, 6.3 Hz, 1H), 3.39 - 3.28 (m, 1H).

[0001687] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001688] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (6.24 g, 19.8 mmol, 1.0 eq.) in DMF (62 mL), cooled to 0 °C, was added triethylamine (9.6 mL, 69.2 mmol, 3.5 eq.) and the resultant solution was stirred for 10 min. To the cooled solution was added 3 -nitrobenzenesulfonyl chloride (5.25 g, 23.7 mmol, 1.2 eq.) portionwise over 10-15 min. The resultant mixture was then gently warmed to RT and stirred for 2 h. The organics were then extracted into EtOAc (300 mL), washed with aq. saturated Na ₂ CO ₃ solution (250 mL), and water (250 mL). The organics were then dried over anhydrous Na ₂ SO ₄ , filtered, and concentrated to dryness. The residue was triturated with DCM (25 mL) and filtered under vacuum to afford the product (3.83 g, 7.09 mmol, 36% yield) as a beige solid, which was used in the next step without further purification. UPLC-MS (basic 2 mm): Rt = 1.17 mm; m/z = 465.0 for [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 9.37 (s, 1H), 8.22 - 8.15 (m, 1H), 8.11 - 8.04 (m, 3H), 7.88 (t, J = 6.9 Hz, 2H), 7.64 (d, J = 2.1 Hz, 1H), 7.61 - 7.46 (m, 3H), 7.46 - 7.38 (m, 2H), 7.24 (td, J = 7.8, 2.0 Hz, 1H), 5.17 (d, J = 10.5 Hz, 1H), 3.41 (d, J = 14.2 Hz, 1H), 3.03 (t, J = 12.5 Hz, 1H).

[0001689] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001690] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-nitro-benzenesulfonamide (3.83 g, 7.09 mmol, 1.0 eq.) in ethanol (38 mL) and water (19 mL), under N2, were added ammonium chloride (1.90 g, 35.5 mmol, 5.0 eq.) and iron (3.96 g, 70.9 mmol, 10.0 eq.). The reaction mixture was heated to 85 °C and stirred for 4 h. The reaction mixture was then cooled to RT and filtered through a plug of Celite under vacuum, washing with copious EtOH. The crude solid was dissolved in DCM (60 mL) and washed with aq. saturated Na ₂ CO ₃ solution (60 mL). The organics were extracted with DCM (2 x 60 mL), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The crude was re-suspended in EtOH (24 mL) and water (12 mL), followed by addition of iron (1.98 g, 35.5 mmol) and ammonium chloride (0.95 g, 17.7 mmol) at RT. The resultant mixture was heated to 85 °C and stirred for 4.5 h before being cooled to RT. After 18 h of stirred at RT, the reaction mixture was filtered over Celite, rinsed with copious EtOH and DCM and concentrated under reduced pressure. The residue was suspended in EtOAc (50 mL) and washed with aq. saturated Na ₂ CO ₃ solution (50 mL). The organics were extracted with EtOAc (2 x 50 mL), combined, dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to afford the product (2.13 g, 4.08 mmol, 57% yield) as a brown foam. UPLC-MS (basic 2 min): Rt = 1.09 mm; m/z = 435.1 for [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 8.73 (s, 1H), 8.11 - 8.06 (m, 1H), 8.00 - 7.88 (m, 1H), 7.57 (d, J = 1.7 Hz, 1H), 7.56 - 7.46 (m, 3H), 7.46 - 7.40 (m, 1H),

7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.54 (m, 2H), 5.40 (s, 2H), 4.93 - 4.86 (m, 1H), 3.40 - 3.32 (m, 1H), 2.98 (dd, J = 13.8, 9.8 Hz, 1H).

[0001691] Step 5: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]-N-methyl-c arbamate

[0001692] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (735 mg, 1.69 mmol, 1.0 eq.) in DMF (12 mb) was added N-Boc-sarcosine (384 mg, 2.03 mmol, 1.2 eq.), DIPEA (0.88 mL, 5.07 mmol, 3.0 eq.) and HATU (965 mg, 2.54 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 20 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with brine (25 mL), aq. saturated Na ₂ CO ₃ solution (25 mL), and brine again (25 mL). The organics were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure. The residue was purified by normal-phase column chromatography over silica (20 g cartridge) eluting with a gradient of EtOAc (40% to 100%; v/v) in iso-hexane to afford the product (635 mg, 1.05 mmol, 62% yield) as a yellow oil. UPLC-MS (basic 2 min): Rt = 1.15 min; m/z = 606.2 [M+H] ⁺ . 'H NMR (400 MHz, DMSO-d6) 5 10.12 (d, J = 10.2 Hz, 1H), 8.99 (s, 1H), 8.09 (s, 1H), 7.95 (d, J = 8.2 Hz, 1H), 7.82 (s, 1H), 7.57 - 7.42 (m, 8H), 7.22 (t, J = 8.0 Hz, 2H), 7.13 (d, J = 8.0 Hz, 1H), 4.93 (s, 1H), 2.92 (s, 2H), 2.88 (s, 2H), 1.43 (s, 5H), 1.33 (s, 5H).

[0001693] Step 6: tert-butyl N-[2-[3-[[l-(l, 3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]anilino]-2-oxo-e thyl]-N-methyl-carbamate

[0001694] To a magnetically stirred solution of tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)- 2-(3-cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]-N-met hyl-carbamate (635 mg, 1.05 mmol, 1.0 eq.) in EtOH (6 mL) were added hydroxylamine hydrochloride (146 mg, 2.10 mmol, 2.0 eq.) and DIPEA (0.55 mL, 3.14 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (670 mg, 1.05 mmol, assumed quantitative yield), as an orange oil, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.24 min; m/z = 639.2 for [M+H] ⁺

[0001695] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[[2-[tert- butoxycarbonyl(methyl)amino]acetyl]amino]phenyl]sulfonylamin o]ethyl]phenyl]methylene]ami no] acetate

[0001696] To a magnetically stirred solution of tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)- 2-[3-[(E)-N' -hydroxy carbamimidoyl]phenyl]ethyl]sulfamoyl]anilino]-2-oxo-ethyl]-N -methyl- carbamate (670 mg, 1.05 mmol, 1.0 eq.) in acetic acid (6 mL) was added acetic anhydride (0.10 mL, 1.06 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 18 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (20 g cartridge) eluting with 0-100% EtOAc in iso-hexane to afford the product (483 mg, 0.709 mmol, 68% yield) as a yellow oil. UPLC-MS (basic 2 min): Rt = 1.08 min; m/z = 681.2 for [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 10.04 (d, J = 10.5 Hz, 1H), 8.04 (d, J = 7.2 Hz, 1H), 7.91 (d, J = 8.2 Hz, 1H), 7.86 (d, J = 13.8 Hz, 1H), 7.59 - 7.37 (m, 5H), 7.25 - 7.07 (m, 4H), 6.71 (d, J = 12.2 Hz, 2H), 4.91 (s, 1H), 3.95 (d, J = 15.5 Hz, 2H), 3.29 (d, J = 5.6 Hz, 1H), 2.99 (s, 1H), 2.88 (d, J = 13.8 Hz, 3H), 2.15 (s, 3H), 1.38 (d, J = 42.2 Hz, 9H).

[0001697] Step 8: tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]-N- methyl-carbamate

[0001698] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [[3 -[[2- [tert- butoxy carbonyl(methyl)amino]acetyl]amino]phenyl]sulfonylamino]ethy l]phenyl]methylene]ami no] acetate (483 mg, 0.709 mmol, 1.0 eq.) in acetic acid (5 mL) was added zinc (928 mg, 14.2 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 96 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was then submitted to Reach for achiral purification via HPLC on a Gemini NX C18 (30mm x 150mm, 5um), eluting with 40-100% MeCN in water (+1% v/v NH ₃ ) to afford the product (66 mg,0.106 mmol, 15% yield) as a white solid. UPLC-MS (acidic 6 min): Rt = 2.48 min; m/z = 623.4 for [M+H] ⁺ . ¹ H NMR (400 MHz, DMSO-d6) 5 7.98 (t, J = 8.5 Hz, 1H), 7.86 (d, J = 7.1 Hz, 1H), 7.74 (d, J = 12.4 Hz, 1H), 7.63 (s, 1H), 7.44 (s, 2H), 7.37 (d, J = 7.8 Hz, 1H), 7.21 (s,

1H), 7.12 (s, 3H), 4.79 (s, 1H), 3.96 (d, J = 16.1 Hz, 2H), 3.21 (s, 1H), 3.00 (d, J = 10.5 Hz, 1H), 2.88 (d, J = 13.9 Hz, 3H), 2.07 (s, 2H), 1.42 (s, 4H), 1.31 (s, 5H).

[0001699] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-2-(methylamino)a cetamide

[0001700] To a magnetically stirred solution tert-butyl N-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2- (3-carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl] -N-methyl-carbamate (66 mg, 0.106 mmol, 1.0 eq.) in 1,4-dioxane (1.0 mL) was added hydrogen chloride 4 N in 1,4-dioxane (1.0 mL, 28.8 mmol, 271 eq.) and the resultant suspension was stirred at RT for 18 h. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in water and concentrated under reduced pressure and dried in the vacuum oven overnight to afford the product (52 mg, 0.100 mmol, 94% yield) as a beige solid. UPLC-MS (acidic 6 min): Rt = 1.36 mm; m/z = 523.3 for [M+H] ⁺ , 100% purity. ¹ H NMR (400 MHz, DMSO-d6) 5 10.93 (s, 1H), 9.25 (s, 2H), 9.19 (s, 2H), 9.10 (s, 2H), 9.03 (d, J = 8.0 Hz, 1H), 8.11 (d, J = 7.9 Hz, 1H), 7.95 (d, J = 8.3 Hz, 1H), 7.87 (s, 1H), 7.73 (s, 1H), 7.59 (d, J = 7.9 Hz, 1H), 7.55 - 7.42 (m, 4H), 7.27 (t, J = 7.8 Hz, 1H), 7.20 - 7.12 (m, 2H), 5.01 (ddd, J = 12.3, 7.9, 4.5 Hz, 1H), 4.00 (t, J = 5.9 Hz, 2H), 3.43 - 3.37 (m, 1H), 3.02 (dd, J = 14.0, 10.4 Hz, 1H), 2.67 (t, J = 5.3 Hz, 3H). -

[0001701] Step 10: 2-(methylamino)-N-[3-[[rac-(lR)-l-(l,3-benzothiazol-2-yl)-2- (3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]acetamide

[0001702] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-2-(methylamino)a cetamide (39 mg, 0.0744 mmol) was purified by SFC using Lux iC5 (21.2 mm x 250 mm, 5 um) eluting with 40:60 EtOH:CO2 (0.2% v/v Isopropylamine). The residue was triturated with Et ₂ O and dissolved in water before being concentrated under reduced pressure and dried in the vacuum oven overnight to afford the product (5.0 mg, 0.0096 mmol, 13% yield) as a beige solid. UPLC-MS (acidic 6 mm): Rt = 1.91 mm; m/z = 523.2 for [M+H] ⁺ , 87% purity. ¹ H NMR (400 MHz, DMSO-d6) 5 8.02 (d, J = 7.7 Hz, 1H), 7.91 - 7.85 (m, 2H), 7.65 (s, 1H), 7.56 (d, J = 7.0 Hz, 1H), 7.54 - 7.42 (m, 3H), 7.39 (t, J = 7.6 Hz, 1H), 7.30 (d, J = 7.2 Hz, 1H), 7.19 - 7.10 (m, 3H), 4.93 - 4.86 (m,

1H), 3.00 (dd, J = 13.4, 9.3 Hz, 2H), 2.92 (s, 1H), 2.32 (d, J = 2.7 Hz, 3H). - 1 extra proton in aromatic region due to peak clustering between 7.57 and 7.29 ppm, CH obscured by water peak, aliphatic impurities at 1.75 ppm (integrates to 0.09), 1.23 ppm (integrates to 0.56), 1.15 ppm (integrates to 0.19) D ₂ O (400 MHz, DMSO-d6) 5 7.95 (s, 1H), 7.84 (d, J = 8.0 Hz, 1H), 7.73 (s, 1H), 7.57 (t, J = 1.9 Hz, 1H), 7.50 - 7.32 (m, 7H), 7.19 (t, J = 7.7 Hz, 1H), 7.13 (dd, J = 3.8, 1.5 Hz, 2H), 4.84 (d, J = 4.5 Hz, 1H), 3.25 (dd, J = 9.9 Hz, 1H), 3.20 (s, 2H), 2.99 (dd, J = 13.4, 9.5 Hz, 1H), 2.26 (s, 3H).

Example 89a: Exemplary synthesis of Compound A

[0001703] Step 1 : tert-butyl N-[(lS)-l-[(3-cyanophenyl)methyl]-2-(2-iodoanilino)-2-oxo- ethyl] carbamate

[0001704] A mixture of (2S)-2-(tert-butoxycarbonylamino)-3-(3-cyanophenyl)propanoic acid (1.23 g, 4.24 mmol, 1.0 eq.) and 2-iodoaniline (1.40 g, 6.37 mmol, 1.5 eq.) in pyridine (10 mb) was stirred, at RT and under a balloon of nitrogen, for 5 min until homogeneous. 1,3- dimethylaminopropyl-3 -ethylcarbodiimide hydrochloride (1.22 g, 6.37 mmol, 1.5 eq.) was then added and the resulting mixture was stirred at RT for 2 h. The reaction was then diluted with water (75 mL) and stirred for 5 min before being filtered, washing with copious water. The precipitate was then allowed to air dry to afford the product (2.08 g, 4.24 mmol, 100% yield) as a white solid.

[0001705] 1H NMR (400 MHz, DMSO-d6) 5 9.49 (s, 1H), 7.89 (dd, J = 7.9, 1.4 Hz, 1H), 7.80 (s, 1H), 7.70 (d, J = 7.8 Hz, 2H), 7.59 - 7.49 (m, 2H), 7.40 (t, J = 7.7 Hz, 1H), 7.28 (d, J = 8.6 Hz, 1H), 6.99 (t, J = 7.6 Hz, 1H), 4.42 (d, J = 10.5 Hz, 1H), 3.28 (dd, J = 16.4, 5.2 Hz, 1H), 2.97 - 2.85 (m, 1H), 1.31 (s, 9H).

[0001706] UPLC-MS (basic 2 mm) Rt = 1.18 mm. m/z = 490.1 for [M-H]’

[0001707] Step 2: tert-butyl N-[(lS)-l-[(3-cyanophenyl)methyl]-2-(2-iodoanilino)-2-thioxo - ethyl] carbamate

[0001708] To a mixture of tert-butyl N-[(lS)-l-[(3-cyanophenyl)methyl]-2-(2-iodoanilino)-2- oxo-ethyl] carbamate (2.08 g, 4.23 mmol, 1.0 eq.) in anhydrous toluene (40 mL) was added 2,4- bis(4-methoxyphenyl)-l,3-dithia-2,4-diphosphetane 2,4-disulfide (Lawesson’s reagent) (1.03 g, 2.54 mmol, 0.6 eq.). The resulting mixture was then stirred at 100 °C for 90 min. The reaction mixture was then concentrated in vacuo and the residue was purified via normal phase column chromatography (80 g cartridge) eluting with 0-60% ethyl acetate in isohexane to afford the product (1.69 g, 3.33 mmol, 79% yield) as a yellow solid.

[0001709] 1H NMR (400 MHz, DMSO-d6) 5 11.54 (s, 1H), 7.90 (dd, J = 7.9, 1.4 Hz, 1H), 7.82 (s, 1H), 7.69 (dd, J = 14.1, 7.8 Hz, 2H), 7.59 - 7.49 (m, 1H), 7.42 (t, J = 7.6 Hz, 1H), 7.26 - 7.17

(m, 1H), 7.13 - 7.00 (m, 2H), 4.74 (td, J = 9.7, 3.7 Hz, 1H), 3.28 (dd, J = 13.6, 3.9 Hz, 1H), 2.95 (dd, J = 13.6, 10.4 Hz, 1H), 1.27 (s, 9H).

[0001710] UPLC-MS (basic 2 min) Rt = 1.22 min. m/z = 506.1 for [M-H]’

[0001711] Step 3: tert-butyl N-[(lS)-l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethy 1] carbamate

[0001712] A mixture of tert-butyl N-[(lS)-l-[(3-cyanophenyl)methyl]-2-(2-iodoanilino)-2- thi oxo-ethyl] carbamate (1.69 g, 3.33 mmol, 1.0 eq.), potassium tert-butoxide (374 mg, 3.33 mmol, 1.0 eq.) and 1 , 10-phenanthroline (120 mg, 0.666 mmol, 0.2 eq.) in methanol (33.3 mb) was purged with a balloon of nitrogen before being stirred at RT for 3 h. The reaction was quenched via the addition of water (50 ml) and diluted with ethyl acetate (100 mL). After separation of the phases, the aqueous was extracted with further ethyl acetate (100 mL) and the combined organics were washed with brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was re-subjected to the same reaction conditions and stirred for 22 h at RT before quenching via the addition of water (50 mL). The precipitate was then filtered, washing with copious water and air-dried to afford the product (1.04 g, 2.74 mmol, 82% yield) as an off-white solid.

[0001713] 1H NMR (400 MHz, DMSO-d6) 5 8.09 (d, J = 7.9 Hz, 1H), 7.98 (dt, J = 8.0, 1.0 Hz, 1H), 7.92 (d, J = 8.9 Hz, 1H), 7.80 (d, J = 1.8 Hz, 1H), 7.70 (dd, J = 7.8, 1.7 Hz, 2H), 7.55 - 7.49 (m, 2H), 7.44 (ddd, J = 8.2, 7.2, 1.3 Hz, 1H), 5.22 - 5.09 (m, 1H), 3.59 - 3.52 (m, 1H), 3.18 - 3.02 (m, 1H), 1.30 (s, 9H).

[0001714] UPLC-MS (basic 2 mm) Rt = 1.22 mm. m/z = 324.1 for [M-tBu+H] ⁺

[0001715] Step 4: 3-[(2S)-2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile; hydrochloride

[0001716] A mixture of tert-butyl N-[(lS)-l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (1.04 g, 2.74 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (10.0 mL, 41.0 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated in vacuo and the residue dried in a vacuum oven overnight to afford the product (796 mg, 2.52 mmol, 92% yield) as a yellow solid.

[0001717] 1H NMR (400 MHz, DMSO-d6) 5 9.09 (d, J = 5.8 Hz, 3H), 8.15 (ddd, J = 8.0, 1.3, 0.6 Hz, 1H), 8.05 (ddd, J = 8.1, 1.2, 0.6 Hz, 1H), 7.82 (t, J = 1.5 Hz, 1H), 7.73 (dt, J = 7.7, 1.4 Hz, 1H), 7.57 (ddt, J = 7.2, 5.8, 1.4 Hz, 2H), 7.53 - 7.46 (m, 2H), 5.32 (s, 1H), 3.56 - 3.50 (m, 1H), 3.38 (dd, J = 13.9, 8.6 Hz, 1H).

[0001718] UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 280.1 for [M+H] ⁺

[0001719] Step 5: N N-[(lS)-l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001720] To a mixture of 3-[(2S)-2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (200 mg, 0.633 mmol, 1.0 eq.) in DMF (2.1 mL), under a balloon of nitrogen, at 0 °C was added triethylamine (0.26 mL, 1.90 mmol, 3.0 eq.). The resulting mixture was stirred at the same temperature for 10 min before the dropwise addition of benzenesulphonyl chloride (134 mg, 0.760 mmol, 1.2 eq.). The resulting mixture was then stirred at the same temperature for 10 min before being allowed to warm to RT and stirred for 3 h. The reaction was quenched via the addition of water (50 ml), extracted with ethyl acetate (100 mL), washed with further water (3 x 50 ml), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was dissolved in 1: 1 DCM: isohexane, resulting in a dark red oily insoluble residue. Both the mother liquor and residue were found to contain the desired product. They were recombined and purification was performed via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (67.0 mg, 0.160 mmol, 25% yield) as a yellow solid.

[0001721] 1H NMR (400 MHz, DMSO-d6) 5 8.96 (s, 1H), 8.08 (ddd, J = 7.9, 1.3, 0.6 Hz, 1H), 7.94 (ddd, J = 8.1, 1.2, 0.6 Hz, 1H), 7.59 (d, J = 1.8 Hz, 1H), 7.55 - 7.48 (m, 3H), 7.47 - 7.39 (m, 4H), 7.35 - 7.23 (m, 3H), 5.02 (s, 1H), 3.42 - 3.36 (m, 1H), 3.00 (dd, J = 13.9, 10.5 Hz, 1H).

[0001722] UPLC-MS (basic 2 mm) Rt = 1.14 mm. m/z = 420.1 for [M+H] ⁺

[0001723] Step 6: N'-hydroxy-3-[(2S)-2-(benzenesulfonamido)-2-(l,3-benzothiazo l-2- yl)ethyl]benzamidine

[0001724] A mixture of N-[(lS)-l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (63.0 mg, 0.150 mmol, 1.0 eq.), N,N- diisopropylethylamine (DIPEA) (0.078 mL, 0.451 mmol, 3.0 eq.) and hydroxylammonium chloride (21.0 mg, 0.300 mmol, 2.0 eq.) in ethanol (3.0 mL) was stirred at 85 °C for 4 h. The reaction was then concentrated in vacuo to afford the product (68 mg, 0.150 mmol, assumed quantitative yield) as a yellow oil.

[0001725] UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 453.1 for [M+H] ⁺

[0001726] Step 7: [(E)-[amino-[3-[(2S)-2-(benzenesulfonamido)-2-(l,3-benzothia zol-2- yl)ethyl]phenyl]methylene]amino] acetate

[0001727] To a solution of N'-hydroxy-3-[(2S)-2-(benzenesulfonamido)-2-(l,3-benzothiazo l-2- yl)ethyl]benzamidine (68.0 mg, 0.150 mmol, 1.0 eq.) in acetic acid (3.0 mL) was added acetic anhydride (77.0 mg, 0.751 mmol, 5.0 eq.). The resulting mixture was stirred at RT for 2 h. The resulting mixture was concentrated in vacuo and purification was attempted via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in heptane to afford the product (48.0 mg, 0.0971 mmol, 65% yield) as a yellow solid.

[0001728] 1H NMR (400 MHz, DMSO-d6) 5 8.93 (s, 1H), 8.05 (d, J = 8.0 Hz, 1H), 7.91 (d, J = 8.1 Hz, 1H), 7.59 (s, 1H), 7.52 - 7.32 (m, 6H), 7.24 (t, J = 7.4 Hz, 3H), 7.12 (t, J = 7.7 Hz, 1H), 6.74 (s, 2H), 4.96 (s, 1H), 3.00 (dd, J = 13.8, 9.7 Hz, 1H), 2.15 (s, 3H) One aliphatic overlapping with water signal

[0001729] UPLC-MS (basic 2 mm) Rt = 1.04 mm. m/z = 495.2 for [M+H] ⁺

[0001730] Step 8: 3-[(2S)-2-(benzenesulfonamido)-2-(l,3-benzothiazol-2-yl)ethy l]benzamidine

[0001731] A mixture of [(E)-[amino-[3-[(2S)-2-(benzenesulfonamido)-2-(l,3-benzothia zol-2- yl)ethyl]phenyl]methylene]amino] acetate (48.0 mg, 0.0971 mmol, 1.0 eq.) and zinc (127 mg, 1.94 mmol, 20.0 eq.) in acetic acid (3 mL) was stirred at RT for 20 h. The reaction mixture was then filtered through Celite, washing with copious acetonitrile, ethanol and DCM and the filtrate was concentrated in vacuo. The residue was submitted for purification via prep-HPLC on a Cl XBridge BEH C18 eluting with 35-100% MeCN in water (10 mM ammonium bicarbonate) to afford the product (15.0 mg, 0.0344 mmol, 35% yield) as a yellow solid.

[0001732] 1H NMR (400 MHz, DMSO-d6) 5 8.02 (d, J = 7.8 Hz, 1H), 7.89 (d, J = 7.9 Hz, 1H), 7.68 (s, 1H), 7.51 (d, J = 7.9 Hz, 1H), 7.46 (dt, J = 6.9, 2.0 Hz, 3H), 7.42 - 7.36 (m, 1H), 7.36 - 7.28 (m, 2H), 7.21 (td, J = 7.7, 5.9 Hz, 3H), 4.92 (dd, J = 9.1, 5.0 Hz, 1H), 3.02 (dd, J = 13.7, 9.3 Hz, 1H). One aliphatic proton overlapping with water. Grease integrates to 0.75. No exchangeable protons visible. One unidentified aliphatic peak integrates to 0.5H

[0001733] UPLC-MS (acidic 6 mm) Rt = 2.40 mm. m/z = 437.2 for [M+H] ⁺ , 99% purity

Example 89b: Exemplary synthesis of Compound A-l

[0001734] Step 1 : tert-butyl N-[(lR)-l-[(3-cyanophenyl)methyl]-2-(2-iodoanilino)-2-oxo- ethyl] carbamate

[0001735] A mixture of (2R)-2-(tert-butoxycarbonylamino)-3-(3-cyanophenyl)propanoic acid (1.57 g, 5.40 mmol, 1.0 eq.) and 2-iodoaniline (1.77 g, 8.10 mmol, 1.5 eq.) in pyridine (10 mb) was stirred for 5 min, under a balloon of nitrogen, until homogeneous. 1,3-dimethylaminopropyl- 3 -ethylcarbodiimide hydrochloride (1.55 g, 8.10 mmol, 1.5 eq.) was then added and the resulting mixture stirred at RT for 2 h. The reaction was quenched via the addition of water (100 mL) and the precipitate that formed was collected by filtration, washed with further water and dried in a vacuum oven overnight to afford the product (2.67 g, 5.43 mmol, assumed quantitative yield) as a beige solid.

[0001736] 1H NMR (400 MHz, DMSO-d6) 5 9.48 (s, 1H), 7.89 (dd, J = 8.0, 1.4 Hz, 1H), 7.80 (s, 1H), 7.70 (d, J = 7.7 Hz, 2H), 7.61 - 7.50 (m, 2H), 7.40 (t, J = 7.6 Hz, 1H), 7.27 (d, J = 8.7 Hz, 1H), 6.99 (dd, J = 8.1, 6.5 Hz, 1H), 4.43 (s, 1H), 3.27 (d, J = 12.7 Hz, 1H), 2.96 - 2.86 (m, 1H), 1.31 (s, 9H). Contains 0.2 eq. of 2-iodoaniline

[0001737] UPLC-MS (basic 2 mm) Rt = 1.19 mm, m/z = 490.1 for [M-H]’

[0001738] Step 2: tert-butyl N-[(lR)-l-[(3-cyanophenyl)methyl]-2-(2-iodoanilino)-2-thioxo - ethyl] carbamate

[0001739] A mixture of tert-butyl N-[(lR)-l-[(3-cyanophenyl)methyl]-2-(2-iodoanilino)-2-oxo- ethyl] carbamate (1.30 g, 2.65 mmol, 1.0 eq.) and Lawesson reagent (1.07 mg, 2.65 mmol, 1.0 eq.) in anhydrous toluene (20.4 mL) was stirred at 100 °C for 2 h. The reaction mixture was concentrated in vacuo and the residue was purified via normal phase column chromatography (40 g cartridge) eluting with 0-60% ethyl acetate in isohexane to afford the product (772 mg, 1.52 mmol, 58% yield) as a yellow solid.

[0001740] 1H NMR (400 MHz, DMSO-d6) 5 11.57 (s, 1H), 7.94 (d, J = 7.9 Hz, 1H), 7.87 (d, J = 13.8 Hz, 2H), 7.76 - 7.66 (m, 4H), 7.46 (t, J = 7.8 Hz, 2H), 7.25 (d, J = 7.8 Hz, 1H), 7.11 (t, J = 7.4 Hz, 1H), 7.06 (d, J = 8.9 Hz, 1H), 4.82 - 4.74 (m, 1H), 3.32 (dd, J = 13.4, 3.9 Hz, 1H), 2.99 (t, J = 12.0 Hz, 1H), 1.31 (s, 13H). Some signals over-integrating due to overlaps with impurities

[0001741] UPLC-MS (basic 2 mm) Rt = 1.22 mm. m/z = 506.1 for [M-H]’

[0001742] Step 3: tert-butyl N-[(lR)-l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethy 1] carbamate

[0001743] A mixture of tert-butyl N-[(lR)-l-[(3-cyanophenyl)methyl]-2-(2-iodoanilino)-2- thi oxo-ethyl] carbamate (772 mg, 1.52 mmol, 1.0 eq.), potassium tert-butoxide (171 mg, 1.52 mmol, 1.0 eq.) and 1 , 10-phenanthroline (55 mg, 0.304 mmol, 0.2 eq.) in methanol (15.2 mL) was stirred at RT for 3 h. The reaction was quenched via the addition of water (100 mL), extracted with ethyl acetate (150 ml), washed with brine (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to afford a mixture of product and starting material. This mixture was resubmitted to the same reaction conditions, and worked up in the same manner. Purification was performed via normal phase column chromatography (24 g cartridge) eluting with 0-100% ethyl acetate: isohexane to afford the product (315 mg, 0.830 mmol, 55% yield) as an off-white solid.

[0001744] 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 7.9 Hz, 1H), 7.98 (ddd, J = 8.1, 1.2, 0.6 Hz, 1H), 7.93 (d, J = 8.8 Hz, 1H), 7.81 (s, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.50 (m, 2H), 7.47 - 7.41 (m, 1H), 5.17 (d, J = 8.9 Hz, 1H), 3.56 (dd, J = 13.9, 4.2 Hz, 1H), 3.18 - 3.07 (m, 1H).

[0001745] UPLC-MS (basic 2 mm) Rt = 1.21 mm. m/z = 324.1 for [M-tBu+H] ⁺

[0001746] Step 4: 3-[(2R)-2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile; hydrochloride

[0001747] A mixture of tert-butyl N-[(lR)-l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (315 mg, 0.830 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (3.1 mL, 12.5 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was concentrated in vacuo to afford the product (289 mg, 0.915 mmol, assumed quantitative yield) as a white solid.

[0001748] Step 5: 1H NMR (400 MHz, DMSO-d6) 5 9.03 - 8.94 (m, 3H), 8.16 (ddd, J = 8.0, 1.3, 0.6 Hz, 1H), 8.06 (ddd, J = 8.1, 1.2, 0.6 Hz, 1H), 7.82 (d, J = 1.7 Hz, 1H), 7.75 (dt, J = 7.6, 1.4 Hz, 1H), 7.61 - 7.55 (m, 2H), 7.51 (ddd, J = 8.1, 7.2, 1.1 Hz, 2H), 5.35 (s, 1H), 3.47 (dd, J = 13.9, 6.5 Hz, 1H), 3.37 (dd, J = 13.9, 8.3 Hz, 1H). 0.16 eq. 1,4-dioxane

[0001749] UPLC-MS (basic 2 mm) Rt = 1.03 mm. m/z = 280.1 for [M+H] ⁺

[0001750] Step 6: N N-[(lR)-l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001751] A mixture of 3-[(2R)-2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (289 mg, 0.915 mmol, 1.0 eq.) in DMF (4.6 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of tri ethylamine (0.38 mL, 2.75 mmol, 3.0 eq.). The resulting mixture was stirred at the same temperature for 5 min before the dropwise addition of benzenesulphonyl chloride (194 mg, 1.10 mmol, 1.2 eq.). The resulting solution was allowed to stir at the same temperature for 5 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (50 mL), extracted with ethyl acetate (100 mL), washed with further water (2 x 50 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. Purification was then performed via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in DCM which proved ineffective. A second purification was performed via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in isohexane to afford the product (111 mg, 0.265 mmol, 29% yield) as a yellow solid.

[0001752] 1H NMR (400 MHz, DMSO-d6) 5 8.98 (d, J = 8.3 Hz, 1H), 8.09 (ddd, J = 8.0, 1.4, 0.6 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.60 (t, J = 1.5 Hz, 1H), 7.54 - 7.48 (m, 3H), 7.47 - 7.39 (m, 4H), 7.34 - 7.25 (m, 3H), 5.02 (ddd, J = 10.5, 8.3, 4.5 Hz, 1H), 3.40 (d, J = 4.6 Hz, 1H), 3.00 (dd, J = 13.9, 10.6 Hz, 1H)

[0001753] UPLC-MS (basic 2 mm) Rt = 1.13 mm. m/z = 420.1 for [M+H] ⁺

[0001754] Step 7: N'-hydroxy-3-[(2R)-2-(benzenesulfonamido)-2-(l,3-benzothiazo l-2- yl)ethyl]benzamidine

[0001755] A mixture of N-[(lR)-l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (111 mg, 0.265 mmol, 1.0 eq.), hydroxylammonium chloride (37 mg, 0.529 mmol, 2.0 eq.) and DIPEA (0.14 mL, 0.794 mmol, 3.0 eq.) in ethanol ( 2.6 mL) was stirred at 85 °C for 18 h. The reaction mixture was the concentrated in vacuo to afford the product (120 mg, 0.265 mmol, assumed quantitative yield) as a yellow oil.

[0001756] UPLC-MS (basic 2 mm) Rt = 1.00 mm. m/z = 453.1 for [M+H] ⁺

[0001757] Step 8 :[(E)-[amino-[3-[(2R)-2-(benzenesulfonamido)-2-(l,3-benzothi azol-2- yl)ethyl]phenyl]methylene]amino] acetate

[0001758] A mixture of 3-[(2R)-2-(benzenesulfonamido)-2-(l,3-benzothiazol-2-yl)ethy l]-N'- hydroxy-benzamidine (120 mg, 0.265 mmol, 1.0 eq.) and acetic anhydride (0.075 mL, 0.795 mmol, 3.0 eq.) in acetic acid (2.7 mL) was stirred at RT for 2 h. The reaction mixture was concentrated in vacuo, The residue was purified via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in isohexane to afford the product (89 mg, 0.180 mmol, 68% yield) as a colorless oil.

[0001759] 1H NMR (400 MHz, DMSO-D6) 5 8.94 (s, 1H), 8.05 (ddd, J = 7.9, 1.3, 0.7 Hz, 1H), 7.92 (ddd, J = 8.1, 1.3, 0.7 Hz, 1H), 7.59 (t, J = 1.7 Hz, 1H), 7.53 - 7.32 (m, 6H), 7.29 - 7.17 (m, 3H), 7.12 (t, J = 7.7 Hz, 1H), 6.74 (s, 2H), 4.97 (s, 1H), 3.32 - 3.27 (m, 1H), 3.00 (dd, J = 13.8, 9.7 Hz, 1H), 2.15 (s, 3H).

[0001760] UPLC-MS (basic 2 mm) Rt = 1.04 mm. m/z = 495.1 for [M+H] ⁺

[0001761] Step 9: 3-[(2R)-2-(benzenesulfonamido)-2-(l,3-benzothiazol-2-yl)ethy l]benzamidine

[0001762] A mixture of [(E)-[amino-[3-[(2R)-2-(benzenesulfonamido)-2-(l,3-benzothia zol-2- yl)ethyl]phenyl]methylene]amino] acetate (89 mg, 0.180 mmol, 1.0 eq.) and zinc (235 mg, 3.60 mmol, 20.0 eq.) in acetic acid (1.8 mL) was stirred at RT for 24 h. The reaction mixture was then filtered through Celite, washing with copious acetonitrile, ethanol and DCM. The filtrate was then concentrated in vacuo. The residue was purified via preparative reverse phase HPLC on a C2 XBridge BEH C18 (19 mm x 150 mm, 10 um) eluting with 15-100% MeCN in water (0.2% TFA) to afford the TFA salt of the product. The residue was dissolved in 4 N HC1 in 1,4-dioxane (1.0 mL), with a couple of drops of water added, stirred for 1 min and then concentrated in vacuo. This process was repeated 4 times before redissolving in MeCN/water, concentrating in vacuo and drying in a vacuum oven to afford the product (41 mg, 0.0867 mmol, 48% yield) as a white solid.

[0001763] 1H NMR (400 MHz, DMSO-D6) 5 9.25 (s, 2H), 9.06 (s, 2H), 8.97 (d, J = 8.1 Hz, 1H), 8.10 - 8.05 (m, 1H), 7.95 - 7.89 (m, 1H), 7.73 (d, J = 2.2 Hz, 1H), 7.57 (dd, J = 7.6, 1.7 Hz, 1H), 7.55 - 7.41 (m, 5H), 7.37 (td, J = 7.4, 1.2 Hz, 1H), 7.32 - 7.19 (m, 3H), 5.10 - 5.02 (m, 1H), 3.41 - 3.34 (m, 1H), 3.05 (dd, J = 13.9, 10.1 Hz, 1H). Unknown singlet integrates to 0.06. Compound is the mono-HCl salt

[0001764] UPLC-MS (acidic 6 min) Rt = 2.62 min. m/z = 437.1 for [M+H] ⁺ , 100% purity

Example 90: Exemplary synthesis of Compound 264

[0001765] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001766] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2-aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in toluene (245 mb) was added DIPEA (22.0 mL, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirred for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H).

[0001767] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001768] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60.0 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid.

[0001769] 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). One CH not observed. 0.5 eq. of residual 1,4-dioxane. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺

[0001770] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001771] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001772] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001773] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (4.45 g, 8.24 mmol, 1.0 eq.), iron (4.60 g, 82.4 mmol, 10.0 eq.) and ammonium chloride (2.20 g, 41.2 mmol, 5.0 eq.) in ethanol (45 mL) and water (22.5 mb) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (250 mL), washed with saturated sodium hydrogen carbonate solution (2 x 250 mL), and brine (250 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford the product (3.00 g, 6.90 mmol, 84% yield) as a yellow solid. UPLC-MS (basic 2 mm): Rt = 1.05 mm; m/z = 435.2 for [M+H] ⁺ 1H NMR (400 MHz, DMSO- d6) 5 8.73 (d, J = 8.1 Hz, 1H), 8.09 (ddt, J = 7.9, 1.4, 0.6 Hz, 1H), 7.95 (ddt, J = 8.1, 1.2, 0.6 Hz, 1H), 7.63 - 7.39 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.58 (dddd, J = 8.5, 3.0, 2.0, 0.9 Hz, 2H), 5.41 (s, 2H), 4.93 - 4.82 (m, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001774] Step 5: tert-Butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]piperidine- 1-carboxylate

[0001775] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added 1 -boc-piperidin-4-ylacetic acid (336 mg, 1.38 mmol, 1.2 eq.) DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 24 h. The reaction mixture was suspended in EtOAc (25 mL) and washed with water (25 mL), aq. saturated Na ₂ CO ₃ (25 mL), and water (25 mL). The organics were dried over anhydrous sodium sulfate, filtered and concentrated to dryness to afford the product (740 mg, 1.12 mmol, 97% yield) as a yellow foam. UPLC-MS (basic 2 min): Rt = 1.21 min; m/z = 658.3 [M-H]' 1H NMR (400 MHz, DMSO-d6) 5 10.01 (s, 1H), 8.96 (d, J = 8.3 Hz, 1H), 8.13 - 8.06 (m, 1H), 7.98 - 7.91 (m, 1H), 7.85 (t, J = 2.0 Hz, 1H), 7.59 - 7.40 (m, 7H), 7.21 (td, J = 7.8, 4.9 Hz, 2H), 7.12 (d, J = 7.8 Hz, 1H), 4.99 - 4.89 (m, 1H), 3.93 (d, J = 13.2 Hz, 3H), 3.43 - 3.33 (m, 1H), 3.28 (d, J = 5.5 Hz, 2H), 3.03 - 2.92 (m, 1H), 2.27 (d, J = 7.0 Hz, 2H), 1.67 (d, J = 13.2 Hz, 2H), 1.40 (s, 9H), 1.39 (d, J = 2.6 Hz, 3H), 1.09 (td, J = 14.2, 7.9 Hz, 3H)

Example 91: Exemplary synthesis of Compound 259

[0001776] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001777] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2- Aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in Toluene (245 mL) was added DIPEA (22.0 mb, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃

(200 mL) and stirring for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H). Purity appears to be ca. 90%

[0001778] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001779] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid. 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 280.1 for [M+H] ⁺

[0001780] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001781] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001782] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001783] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (3.40 g, 6.29 mmol, 1.0 eq.), iron (3.52 g, 62.9 mmol, 10.0 eq.) and ammonium chloride (1.68 g, 31.5 mmol, 5.0 eq.) in ethanol (35 mL) and water (17.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL), water (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.53 g as a yellow solid. The Celite was re-extracted with further ethanol (100 ml) and DCM (100 mL). The filtrate was concentrated in vacuo, resuspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL) and water (100 ml), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.09 g as a yellow oil. These were combined to afford the product (2.62 g, 6.04 mmol, 96% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 435.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001784] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl]phenyl]- 1 H-py razole- 5 - carboxamide

[0001785] To a stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) and lH-pyrazole-3- carboxylic acid (155 mg, 1.38 mmol, 1.2 eq.) in DMF (5 mL) was added N,N- diisopropylethylamine (DIPEA) (0.60 mL, 3.45 mmol, 3.0 eq.) and O-(7-Azabenzotriazol-l-yl)- N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) (656 mg, 1.73 mmol, 1.5 eq.) and the reaction was stirred at RT for 18 h. The reaction mixture was then concentrated in vacuo and purified via normal phase column chromatography (24 g cartridge) eluting with 0-20% methanol in DCM to afford the product (337 mg, 0.638 mmol, 55% yield) as a yellow oil. UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 529.2 [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.17 (s, 1H), 8.94 (d, J = 8.2 Hz, 1H), 8.72 (ddd, J = 4.3, 1.4, 0.6 Hz, 1H), 8.49 (ddd, J = 8.4, 1.4, 0.6 Hz, 1H), 8.12 (s, 1H), 8.05 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 7.93 - 7.86 (m, 5H), 7.79 (ddd, J = 8.2, 2.1, 1.1 Hz, 1H), 7.57 - 7.53 (m, 1H), 7.49 - 7.43 (m, 3H), 7.42 - 7.36 (m, 2H), 7.24 - 7.10 (m, 3H), 4.95 (ddd, J = 10.4, 8.2, 4.4 Hz, 1H), 3.38 - 3.35 (m, 1H), 3.09 (dd, J = 7.3, 3.9 Hz, 1H).

[0001786] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-lH-pyraz ole-5-carboxamide

[0001787] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]-lH-pyrazole-5-carboxamid e (337 mg, 0.638 mmol, 1.0 eq.), hydroxylammonium chloride (89 mg, 1.28 mmol, 2.0 eq.) and N,N-diisopropylethylamine (DIPEA) (0.33 mb, 1.91 mmol, 3.0 eq.) in ethanol (12.8 mL) was stirred at reflux for 20 h. The resulting mixture was then concentrated in vacuo to afford the product (358 mg, 0.637 mmol, assumed quantitative yield) as a white oily-solid. UPLC-MS (basic 2 min): Rt = 0.93 min; m/z = 562.2 [M+H] ⁺

[0001788] Step 7: [(E)-[[3-[2-[[3-[(2-acetylpyrazole-3-carbonyl)amino]phenyl]s ulfonylamino]- 2-(l,3-benzothiazol-2-yl)ethyl]phenyl]-amino-methylene]amino ] acetate

[0001789] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-lH-pyraz ole-5-carboxamide (358 mg, 0.637 mmol, 1.0 eq.) and acetic anhydride (0.060 mL, 0.637 mmol, 1.0 eq.) in acetic acid (6.4 mL) was stirred at RT for 2 h. Further acetic anhydride (0.060 mL, 0.637 mmol, 1.0 eq.) was added and the resulting mixture stirred at RT for 2 h. Further acetic anhydride (0.060 mL, 0.637 mmol, 1.0 eq.) was added and the resulting mixture stirred at RT for 20 h. The reaction mixture was concentrated in vacuo and purification was attempted via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in isohexane to afford the product (264 mg, 0.409 mmol, 64% yield) as a colourless oil. UPLC-MS (basic 2 min): Rt = 1.05 min; m/z = 646.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.31 (s, 1H), 8.96 (d, J = 7.5 Hz, 1H), 8.54 (dd, J = 2.9, 0.6 Hz, 1H), 8.09 - 8.02 (m, 2H), 7.92 (ddt, J = 8.2, 1.3, 0.6 Hz, 1H), 7.85 - 7.79 (m, 1H), 7.56 (d, J = 2.1 Hz, 1H), 7.50 - 7.37 (m, 3H), 7.29 - 7.15 (m, 3H), 7.14 - 7.05 (m, 2H), 6.67 (s, 2H), 4.96 (s, 1H), 3.32 - 3.29 (m, 1H), 3.01 (dd, J = 13.9, 9.8 Hz, 1H), 2.81 (d, J = 0.7 Hz, 3H), 2.12 (d, J = 0.7 Hz, 3H).

[0001790] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-lH-pyrazole-5-ca rboxamide hydrochloride

[0001791] A mixture of [(E)-[[3-[2-[[3-[(2-acetylpyrazole-3- carbonyl)amino]phenyl] sulfonylamino] -2-( 1 ,3 -benzothiazol-2-yl)ethyl] phenyl] -amino- methylene]amino] acetate (264 mg, 0.409 mmol, 1.0 eq.) and zinc (535 mg, 8.18 mmol, 20.0 eq.) in acetic acid (8.2 mL) was stirred at RT for 20 h.The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM, and concentrated in vacuo. The residue was then submitted for purification via prep-HPLC on a C2 XBridge BEH C18 eluting with 20-100% MeCN in water (0.2% TFA) which afforded the TFA salt of the product. The residue was suspended in 4 N HC1 in 1,4-dioxane (2.0 mL) and stirring for 1 min before being concentrated in vacuo. This process was repeated twice more before dissolving the residue in MeCN/water, concentrating in vacuo and drying in a vacuum oven overnight. The resalting process was then repeated a further 2 times, with the stir time increased to 5 min. On the last dose of HC1, 6 drops of water were added to the suspension to aid with solubility. The residue was dissolved in MeCN/water and concentrated twice before drying in a vacuum oven overnight to afford the product (81 mg, 0.148 mmol, 45% yield) as a yellow solid. UPLC-MS (acidic 6 mm): Rt = 2.28 mm; m/z = 546.2 for [M+H] ⁺ , 98% purity. 1H NMR (400 MHz, DMSO-d6) 5 10.18 (s, 1H), 9.15 (s, 2H), 8.97 - 8.90 (m, 3H), 8.11 (t, J = 1.9 Hz, 1H), 8.08 - 8.02 (m, 1H), 7.92 - 7.85 (m, 2H), 7.72 (dt, J = 8.0, 1.7 Hz, 1H), 7.68 (d, J = 1.8 Hz, 1H), 7.51 - 7.43 (m, 3H), 7.39 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 7.23 - 7.06 (m, 3H), 6.83 (d, J = 2.2 Hz, 1H), 4.99 (ddd, J = 9.9, 8.0, 4.6 Hz, 1H), 3.43 - 3.28 (m, 1H), 3.09 - 2.89 (m, 1H).

[0001792] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-lH-pyrazole-5-ca rboxamide hydrochloride

[0001793] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-lH-pyrazole-5-ca rboxamide (81 mg, 0.148 mmol) was submitted for chiral separation at Reach. Purification was performed via SFC on a Lux C4 (30 mm x 250 mm, 5 um) eluting with 50:50 MeOH:CO2 (0.2% v/v NH ₃ ) to afford the 1st eluting enantiomer of the product (18 mg, 0.0337 mmol, 22% yield) as a white solid. UPLC- MS (basic 6 mm): Rt = 2.24 mm; m/z = 546.2 for [M+H] ⁺ , 98% purity. 1H NMR (400 MHz, DMSO-d6) 5 8.11 (d, J = 2.1 Hz, 1H), 8.01 - 7.96 (m, 1H), 7.90 - 7.85 (m, 2H), 7.72 (dt, J = 7.2, 2.1 Hz, 1H), 7.65 (d, J = 2.0 Hz, 1H), 7.48 - 7.40 (m, 2H), 7.35 (td, J = 7.6, 1.2 Hz, 1H), 7.26 (d,

J = 7.6 Hz, 1H), 7.18 - 7.10 (m, 3H), 6.85 (d, J = 2.3 Hz, 1H), 4.86 (dd, J = 8.7, 5.0 Hz, 1H), 3.25 (dd, J = 13.5, 5.0 Hz, 1H), 3.02 (dd, J = 13.5, 8.8 Hz, 1H).

Example 92: Exemplary synthesis of Compound 259

[0001794] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001795] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2- Aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in Toluene (245 mL) was added DIPEA (22.0 mL, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirring for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H).

[0001796] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001797] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid. 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H).

One CH not observed. 0.5 eq. of residual 1,4-dioxane present. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺

[0001798] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001799] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001800] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001801] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (3.40 g, 6.29 mmol, 1.0 eq.), iron (3.52 g, 62.9 mmol, 10.0 eq.) and ammonium chloride (1.68 g, 31.5 mmol, 5.0 eq.) in ethanol (35 mL) and water (17.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL), water (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.53 g as a yellow solid. The Celite was re-extracted with further ethanol (100 ml) and DCM (100 mL). The filtrate was concentrated in vacuo, resuspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL) and water (100 ml), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.09 g as a yellow oil. These were combined to afford the product (2.62 g, 6.04 mmol, 96% yield) as a yellow solid. PLC-MS (basic 2 min): Rt = 1.07 min; m/z = 435.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001802] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl]phenyl]- 1 H-py razole- 5 - carboxamide

[0001803] To a stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) and lH-pyrazole-3- carboxylic acid (155 mg, 1.38 mmol, 1.2 eq.) in DMF (5 mL) was added N,N- diisopropylethylamine (DIPEA) (0.60 mL, 3.45 mmol, 3.0 eq.) and O-(7-Azabenzotriazol-l-yl)- N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) (656 mg, 1.73 mmol, 1.5 eq.) and the reaction was stirred at RT for 18 h. The reaction mixture was then concentrated in vacuo and purified via normal phase column chromatography (24 g cartridge) eluting with 0-20% methanol in DCM to afford the product (337 mg, 0.638 mmol, 55% yield) as a yellow oil. UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 529.2 [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.17 (s, 1H), 8.94 (d, J = 8.2 Hz, 1H), 8.72 (ddd, J = 4.3, 1.4, 0.6 Hz, 1H), 8.49 (ddd, J = 8.4, 1.4, 0.6 Hz, 1H), 8.12 (s, 1H), 8.05 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 7.93 - 7.86 (m, 5H), 7.79 (ddd, J = 8.2, 2.1, 1.1 Hz, 1H), 7.57 - 7.53 (m, 1H), 7.49 - 7.43 (m, 3H), 7.42 - 7.36 (m, 2H), 7.24 - 7.10 (m, 3H), 4.95 (ddd, J = 10.4, 8.2, 4.4 Hz, 1H), 3.38 - 3.35 (m, 1H), 3.09 (dd, J = 7.3, 3.9 Hz, 1H).

[0001804] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-lH-pyraz ole-5-carboxamide

[0001805] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]-lH-pyrazole-5-carboxamid e (337 mg, 0.638 mmol, 1.0 eq.), hydroxylammonium chloride (89 mg, 1.28 mmol, 2.0 eq.) and N,N-diisopropylethylamine (DIPEA) (0.33 mL, 1.91 mmol, 3.0 eq.) in ethanol (12.8 mL) was stirred at reflux for 20 h. The resulting mixture was then concentrated in vacuo to afford the product (358 mg, 0.637 mmol, assumed quantitative yield) as a white oily-solid. UPLC-MS (basic 2 min): Rt = 0.93 min; m/z = 562.2 [M+H] ⁺

[0001806] Step 7: [(E)-[[3-[2-[[3-[(2-acetylpyrazole-3-carbonyl)amino]phenyl]s ulfonylamino]- 2-(l,3-benzothiazol-2-yl)ethyl]phenyl]-amino-methylene]amino ] acetate

[0001807] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-lH-pyraz ole-5-carboxamide (358 mg, 0.637 mmol, 1.0 eq.) and acetic anhydride (0.060 mL, 0.637 mmol, 1.0 eq.) in acetic acid (6.4 mL) was stirred at RT for 2 h. Further acetic anhydride (0.060 mL, 0.637 mmol, 1.0 eq.) was added and the resulting mixture stirred at RT for 2 h. Further acetic anhydride (0.060 mL, 0.637 mmol, 1.0 eq.) was added and the resulting mixture stirred at RT for 20 h. The reaction mixture was concentrated in vacuo and purification was attempted via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in isohexane to afford the product (264 mg, 0.409 mmol, 64% yield) as a colourless oil. UPLC-MS (basic 2 min): Rt = 1.05 min; m/z = 646.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.31 (s, 1H), 8.96 (d, J = 7.5 Hz, 1H), 8.54 (dd, J = 2.9, 0.6 Hz, 1H), 8.09 - 8.02 (m, 2H), 7.92 (ddt, J = 8.2, 1.3, 0.6 Hz, 1H), 7.85 - 7.79 (m, 1H), 7.56 (d, J = 2.1 Hz, 1H), 7.50 - 7.37 (m, 3H), 7.29 - 7.15 (m, 3H), 7.14 - 7.05 (m, 2H), 6.67 (s, 2H), 4.96 (s, 1H), 3.32 - 3.29 (m, 1H), 3.01 (dd, J = 13.9, 9.8 Hz, 1H), 2.81 (d, J = 0.7 Hz, 3H), 2.12 (d, J = 0.7 Hz, 3H).

[0001808] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-lH-pyrazole-5-ca rboxamide hydrochloride

[0001809] A mixture of [(E)-[[3-[2-[[3-[(2-acetylpyrazole-3- carbonyl)amino]phenyl] sulfonylamino] -2-( 1 ,3 -benzothiazol-2-yl)ethyl] phenyl] -amino- methylene]amino] acetate (264 mg, 0.409 mmol, 1.0 eq.) and zinc (535 mg, 8.18 mmol, 20.0 eq.) in acetic acid (8.2 mL) was stirred at RT for 20 h.The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM, and concentrated in vacuo. The residue was then submitted for purification via prep-HPLC on a C2 XBridge BEH C18 eluting with 20-100% MeCN in water (0.2% TFA) which afforded the TFA salt of the product. The residue was suspended in 4 N HC1 in 1,4-dioxane (2.0 mL) and stirring for 1 min before being concentrated in vacuo. This process was repeated twice more before dissolving the residue in MeCN/water, concentrating in vacuo and drying in a vacuum oven overnight. The resalting process was then repeated a further 2 times, with the stir time increased to 5 min. On the last dose of HC1, 6 drops of water were added to the suspension to aid with solubility. The residue was dissolved in MeCN/water and concentrated twice before drying in a vacuum oven overnight to afford the product (81 mg, 0.148 mmol, 45% yield) as a yellow solid. UPLC-MS (acidic 6 mm): Rt = 2.28 mm; m/z = 546.2 for [M+H] ⁺ , 98% purity 1H NMR (400 MHz, DMSO-d6) 5 10.18 (s, 1H), 9.15 (s, 2H), 8.97 - 8.90 (m, 3H), 8.11 (t, J = 1.9 Hz, 1H), 8.08 - 8.02 (m, 1H), 7.92 - 7.85 (m, 2H), 7.72 (dt, J = 8.0, 1.7 Hz, 1H), 7.68 (d, J = 1.8 Hz, 1H), 7.51 - 7.43 (m, 3H), 7.39 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 7.23 - 7.06 (m, 3H), 6.83 (d, J = 2.2 Hz, 1H), 4.99 (ddd, J = 9.9, 8.0, 4.6 Hz, 1H), 3.43 - 3.28 (m, 1H), 3.09 - 2.89 (m, 1H).

[0001810] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-lH-pyrazole-5-ca rboxamide hydrochloride

[0001811] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-lH-pyrazole-5-ca rboxamide (81 mg, 0.148 mmol) was submitted for chiral separation at Reach. Purification was performed via SFC on a Lux C4 (30 mm x 250 mm, 5 um) eluting with 50:50 MeOH:CO2 (0.2% v/v NH ₃ ) to afford the 2nd eluting enantiomer of the product (17 mg, 0.0304 mmol, 20% yield) as a white solid. UPLC- MS (basic 6 mm): Rt = 2.24 mm; m/z = 546.2 for [M+H] ⁺ , 95% purity 1H NMR (400 MHz, DMSO-d6) 5 8.12 (d, J = 2.4 Hz, 1H), 7.99 (d, J = 7.7 Hz, 1H), 7.91 - 7.84 (m, 2H), 7.73 (dt, J =

7.2, 2.2 Hz, 1H), 7.65 (s, 1H), 7.48 - 7.40 (m, 2H), 7.36 (td, J = 7.7, 1.2 Hz, 1H), 7.27 (d, J = 7.6 Hz, 1H), 7.20 - 7.10 (m, 3H), 6.85 (d, J = 2.3 Hz, 1H), 4.87 (dd, J = 8.8, 5.0 Hz, 1H), 3.26 (dd, J = 13.5, 5.0 Hz, 1H), 3.02 (dd, J = 13.5, 8.9 Hz, 1H).

Example 93: Exemplary synthesis of Compound 261

[0001812] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001813] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2- Aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in Toluene (245 mL) was added DIPEA (22.0 mb, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirring for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H).

[0001814] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001815] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid. 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 -

8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H).

[0001816] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001817] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001818] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001819] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (3.40 g, 6.29 mmol, 1.0 eq.), iron (3.52 g, 62.9 mmol, 10.0 eq.) and ammonium chloride (1.68 g, 31.5 mmol, 5.0 eq.) in ethanol (35 mL) and water (17.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL), water (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.53 g as a yellow solid. The Celite was re-extracted with further ethanol (100 ml) and DCM (100 mL). The filtrate was concentrated in vacuo, resuspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL) and water (100 ml), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.09 g as a yellow oil. These were combined to afford the product (2.62 g, 6.04 mmol, 96% yield) as a yellow solid. .UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 435.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001820] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxamide

[0001821] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added oxazole-5-carboxylic acid (156 mg, 1.38 mmol, 1.2 eq.) N,N-diisopropylethylamine (DIPEA) (0.60 mL, 3.45 mmol, 3.0 eq.) and O-(7-Azabenzotriazol-l-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 3.5 h. The reaction mixture was suspended in EtOAc (25 mL) and washed with water (25 mL), aq. saturated NaHCO3 (25 mL), and water (25 mL). The resulting precipitate was filtered away from the organics and washed with EtOAc to afford the product (425 mg, 0.803 mmol, 70% yield) as a beige solid. UPLC-MS (basic 2 min): Rt = 1.05 min; m/z = 530.1 [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.51 (s, 1H), 9.04 (s, 1H), 8.70 (d, J = 0.5 Hz, 1H), 8.09 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 8.03 (d, J = 0.3 Hz, 1H), 7.98 - 7.90 (m, 2H), 7.78 (ddd, J = 8.2, 2.2, 1.1 Hz, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 - 7.47 (m, 2H), 7.43 (dddd, J = 8.3, 3.8, 2.9, 1.3 Hz, 2H), 7.28 (t, J = 7.9 Hz, 1H), 7.24 - 7.16 (m, 2H), 4.97 (d, J = 10.5 Hz, 1H), 3.39 (dd, J = 14.5, 5.0 Hz, 1H), 2.99 (dd, J = 13.8, 10.7 Hz, 1H).

[0001822] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]oxazole-5 -carboxamide

[0001823] To a magnetically stirred suspension of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxamide (425 mg, 0.803 mmol, 1.0 eq.) in ethanol (10 mb) was added N,N-diisopropylethylamine (DIPEA) (0.42 mb, 2.41 mmol, 3.0 eq.) and hydroxylammonium chloride (112 mg, 1.61 mmol, 2.0 eq.) and the reaction mixture was heated to 85 °C and stirred for 2.5 h before being cooled to RT and stirred for 72 h. The reaction mixture was then concentrated to afford the product (452 mg, 0.803 mmol, assumed quantitative yield) as an orange foam. UPLC-MS (basic 2 min): Rt = 0.92 min; m/z = 563.2 [M+H] ⁺

[0001824] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(oxazole-5- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate

[0001825] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]oxazole-5 -carboxamide (451 mg, 0.802 mmol, 1.0 eq.) and acetic anhydride (0.23 mL, 2.40 mmol, 3.0 eq.) in acetic acid (4 mL) was stirred at RT for 20 h. The reaction mixture was concentrated in vacuo and purification was attempted via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in ioshexane to afford the product (283 mg, 0.468 mmol, 58% yield) as a colourless oil. UPLC-MS (basic 2 mm): Rt = 0.97 mm; m/z = 605.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO- d6) 5 10.41 (s, 1H), 8.96 (d, J = 8.1 Hz, 1H), 8.68 (s, 1H), 8.09 - 8.03 (m, 1H), 8.00 (s, 1H), 7.97 - 7.89 (m, 2H), 7.72 (dd, J = 8.0, 1.8 Hz, 1H), 7.57 (s, 1H), 7.51 - 7.34 (m, 3H), 7.28 - 7.16 (m, 3H), 7.08 (t, J = 7.7 Hz, 1H), 6.67 (s, 2H), 4.99 - 4.90 (m, 1H), 3.01 (dd, J = 13.8, 9.9 Hz, 1H), 2.12 (d, J = 0.5 Hz, 3H).

[0001826] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxa mide hydrochloride

[0001827] A mixture of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(oxazole-5- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate (283 mg, 0.468 mmol, 1.0 eq.) and zinc (612 mg, 9.36 mmol, 20.0 eq.) in acetic acid (9.4 mL) was stirred at RT for 20 h. Further zinc (612 mg, 9.36 mmol, 20.0 eq.) was added and the reaction was stirred at RT for a further 20 h. The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM and the filtrate was concentrated in vacuo. The residue was submitted for purification via prep-HPLC on a Waters XBridge C18 eluting with 25-100% MeCN in water (0.2% TFA) to afford the TFA salt of the procuct. The residue was suspended in 4 N HC1 in 1,4-dioxane (2.0 mL) and stirring for 5 min before being concentrated in vacuo. This process was repeated twice more and on the last repeat, 6 drops of water were added for to aid solubility. The residue was dissolved in MeCN/water, concentrating in vacuo and drying in a vacuum oven overnight. The entire process was then repeated a second time to afford the product (85 mg, 0.145 mmol, 51% yield) as an off-white solid. UPLC-MS (basic 6 min): Rt = 1.97 min; m/z = 547.2 for [M+H] ⁺ , 93% purity. 1H NMR (400 MHz, DMSO-d6) 5 10.54 (s, 1H), 9.18 (s, 2H), 8.98 (d, J = 8.0 Hz, 1H), 8.93 (s, 2H), 8.70 (s, 1H), 8.09 (s, 1H), 8.09 - 8.03 (m, 1H), 7.97 (t, J = 1.9 Hz, 1H), 7.96 - 7.88 (m, 1H), 7.78 - 7.70 (m, 2H), 7.58 - 7.51 (m, 1H), 7.51 - 7.44 (m, 2H), 7.42 (td, J = 7.6, 1.4 Hz, 1H), 7.26 - 7.13 (m, 3H), 5.08 - 4.98 (m, 1H), 3.44 - 3.35 (m, 1H), 3.05 (dd, J = 13.9, 10.2 Hz, 1H).

[0001828] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxa mide hydrochloride

[0001829] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxa mide (85 mg, 0.145 mmol) was submitted to Reach for chiral separation. Purification was performed on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 MeOH:CO2 (0.2% v/v NH ₃ ) to afford the 1st eluting enantiomer of the product (17 mg, 0.0304 mmol, 21% yield) as a white solid. UPLC-MS (basic 6 min): Rt = 2.15 min; m/z = 547.2 for [M+H] ⁺ , 94% purity.

[0001830] 1H NMR (400 MHz, DMSO-d6) 5 8.66 (s, 1H), 8.03 (s, 1H), 7.98 (dd, J = 7.7, 1.2 Hz, 1H), 7.91 (d, J = 1.9 Hz, 1H), 7.88 - 7.84 (m, 1H), 7.70 (dt, J = 6.7, 2.4 Hz, 1H), 7.64 (d, J = 2.0 Hz, 1H), 7.48 - 7.43 (m, 1H), 7.43 - 7.39 (m, 1H), 7.35 (td, J = 7.6, 1.3 Hz, 1H), 7.27 (d, J =

7.6 Hz, 1H), 7.21 - 7.12 (m, 3H), 4.84 (dd, J = 8.9, 4.8 Hz, 1H), 3.25 (dd, J = 13.5, 4.8 Hz, 1H), 3.01 (dd, J = 13.5, 9.0 Hz, 1H).

Example 94: Exemplary synthesis of Compound 261

[0001831] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001832] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2- Aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in Toluene (245 mL) was added DIPEA (22.0 mL, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirring for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H).

[0001833] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001834] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid. 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H).

One CH not observed. 0.5 eq. of residual 1,4-di oxane. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺

[0001835] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001836] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001837] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001838] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (3.40 g, 6.29 mmol, 1.0 eq.), iron (3.52 g, 62.9 mmol, 10.0 eq.) and ammonium chloride (1.68 g, 31.5 mmol, 5.0 eq.) in ethanol (35 mL) and water (17.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL), water (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.53 g as a yellow solid. The Celite was re-extracted with further ethanol (100 ml) and DCM (100 mL). The filtrate was concentrated in vacuo, resuspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL) and water (100 ml), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.09 g as a yellow oil. These were combined to afford the product (2.62 g, 6.04 mmol, 96% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 435.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001839] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxamide

[0001840] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added oxazole-5-carboxylic acid (156 mg, 1.38 mmol, 1.2 eq.) N,N-diisopropylethylamine (DIPEA) (0.60 mL, 3.45 mmol, 3.0 eq.) and O-(7-Azabenzotriazol-l-yl)-N,N,N',N'-tetramethyluronium hexafluorophosphate (HATU) (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 3.5 h. The reaction mixture was suspended in EtOAc (25 mL) and washed with water (25 mL), aq. saturated NaHCO3 (25 mL), and water (25 mL). The resulting precipitate was filtered away from the organics and washed with EtOAc to afford the product (425 mg, 0.803 mmol, 70% yield) as a beige solid. UPLC-MS (basic 2 min): Rt = 1.05 min; m/z = 530.1 [M+H]- ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 10.51 (s, 1H), 9.04 (s, 1H), 8.70 (d, J = 0.5 Hz, 1H), 8.09 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 8.03 (d, J = 0.3 Hz, 1H), 7.98 - 7.90 (m, 2H), 7.78 (ddd, J = 8.2, 2.2, 1.1 Hz, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 - 7.47 (m, 2H), 7.43 (dddd, J = 8.3, 3.8, 2.9, 1.3 Hz, 2H), 7.28 (t, J = 7.9 Hz, 1H), 7.24 - 7.16 (m, 2H), 4.97 (d, J = 10.5 Hz, 1H), 3.39 (dd, J = 14.5, 5.0 Hz, 1H), 2.99 (dd, J = 13.8, 10.7 Hz, 1H).

[0001841] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]oxazole-5 -carboxamide

[0001842] To a magnetically stirred suspension of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxamide (425 mg, 0.803 mmol, 1.0 eq.) in ethanol (10 mb) was added N,N-diisopropylethylamine (DIPEA) (0.42 mb, 2.41 mmol, 3.0 eq.) and hydroxylammonium chloride (112 mg, 1.61 mmol, 2.0 eq.) and the reaction mixture was heated to 85 °C and stirred for 2.5 h before being cooled to RT and stirred for 72 h. The reaction mixture was then concentrated to afford the product (452 mg, 0.803 mmol, assumed quantitative yield) as an orange foam. UPLC-MS (basic 2 min): Rt = 0.92 min; m/z = 563.2 [M+H] ⁺

[0001843] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(oxazole-5- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate

[0001844] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]oxazole-5 -carboxamide (451 mg, 0.802 mmol, 1.0 eq.) and acetic anhydride (0.23 mL, 2.40 mmol, 3.0 eq.) in acetic acid (4 mL) was stirred at RT for 20 h. The reaction mixture was concentrated in vacuo and purification was attempted via normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in ioshexane to afford the product (283 mg, 0.468 mmol, 58% yield) as a colourless oil. UPLC-MS (basic 2 mm): Rt = 0.97 mm; m/z = 605.3 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO- d6) 5 10.41 (s, 1H), 8.96 (d, J = 8.1 Hz, 1H), 8.68 (s, 1H), 8.09 - 8.03 (m, 1H), 8.00 (s, 1H), 7.97 - 7.89 (m, 2H), 7.72 (dd, J = 8.0, 1.8 Hz, 1H), 7.57 (s, 1H), 7.51 - 7.34 (m, 3H), 7.28 - 7.16 (m, 3H), 7.08 (t, J = 7.7 Hz, 1H), 6.67 (s, 2H), 4.99 - 4.90 (m, 1H), 3.01 (dd, J = 13.8, 9.9 Hz, 1H), 2.12 (d, J = 0.5 Hz, 3H).

[0001845] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxa mide hydrochloride

[0001846] A mixture of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(oxazole-5- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate (283 mg, 0.468 mmol, 1.0 eq.) and zinc (612 mg, 9.36 mmol, 20.0 eq.) in acetic acid (9.4 mL) was stirred at RT for 20 h. Further zinc (612 mg, 9.36 mmol, 20.0 eq.) was added and the reaction was stirred at RT for a further 20 h. The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM and the filtrate was concentrated in vacuo. The residue was submitted for purification via prep-HPLC on a Waters XBridge C18 eluting with 25-100% MeCN in water (0.2% TFA) to afford the TFA salt of the procuct. The residue was suspended in 4 N HC1 in 1,4-dioxane (2.0 mL) and stirring for 5 min before being concentrated in vacuo. This process was repeated twice more and on the last repeat, 6 drops of water were added for to aid solubility. The residue was dissolved in MeCN/water, concentrating in vacuo and drying in a vacuum oven overnight. The entire process was then repeated a second time to afford the product (85 mg, 0.145 mmol, 51% yield) as an off-white solid. UPLC-MS (basic 6 min): Rt = 1.97 min; m/z = 547.2 for [M+H] ⁺ , 93% purity. 1H NMR (400 MHz, DMSO-d6) 5 10.54 (s, 1H), 9.18 (s, 2H), 8.98 (d, J = 8.0 Hz, 1H), 8.93 (s, 2H), 8.70 (s, 1H), 8.09 (s, 1H), 8.09 - 8.03 (m, 1H), 7.97 (t, J = 1.9 Hz, 1H), 7.96 - 7.88 (m, 1H), 7.78 - 7.70 (m, 2H), 7.58 - 7.51 (m, 1H), 7.51 - 7.44 (m, 2H), 7.42 (td, J = 7.6, 1.4 Hz, 1H), 7.26 - 7.13 (m, 3H), 5.08 - 4.98 (m, 1H), 3.44 - 3.35 (m, 1H), 3.05 (dd, J = 13.9, 10.2 Hz, 1H).

[0001847] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxa mide hydrochloride

[0001848] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]oxazole-5-carboxa mide (85 mg, 0.145 mmol) was submitted to Reach for chiral separation. Purification was performed on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 MeOH:CO2 (0.2% v/v NH ₃ ) to afford the 2 ^nd eluting enantiomer of the product (16 mg, 0.0291 mmol, 20% yield) as a white solid. UPLC-MS (basic 6 mm): Rt = 2.14 mm; m/z = 547.2 for [M+H] ⁺ , 97% purity. 1H NMR (400 MHz, DMSO-d6) 5 8.66 (s, 1H), 8.01 (s, 1H), 8.00 - 7.96 (m, 1H), 7.89 (q, J = 1.4 Hz, 1H), 7.88 - 7.83 (m, 1H), 7.70 (dt, J = 6.6, 2.4 Hz, 1H), 7.66 (d, J = 1.8 Hz, 1H), 7.46 (dd, J = 7.8, 1.7 Hz, 1H), 7.42 (ddd, J = 8.2, 7.2, 1.4 Hz, 1H), 7.37 - 7.32 (m, 1H), 7.26 (d, J = 7.6 Hz, 1H), 7.19 - 7.12 (m, 3H), 4.83

(dd, J = 8.9, 4.8 Hz, 1H), 3.25 (dd, J = 13.5, 4.8 Hz, 1H), 3.17 (s, OH), 3.01 (dd, J = 13.4, 8.9 Hz, 1H).

Example 95: Exemplary synthesis of Compound 269

[0001849] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001850] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (37.0 g, 105 mmol, 1.0 eq.) and 2-aminothiophenol (13.2 g, 105 mmol, 1.0 eq.) in toluene (500 mb) was added DIPEA (54.9 mL, 315 mmol, 3.0 eq.) and T3P (75.1 mL, 126 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 4 h. After cooling, the reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (500 mL) and stirring for 30 min. The reaction was then diluted with ethyl acetate (600 mL) and water (300 mL). After separation of the phases, the organics were washed with water (500 mL) and brine (500 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (330 g cartridge), in 2 batches, eluting with 0- 50% EtOAc in DCM to afford impure product. This was triturated with isohexane (100ml), filtered, washing with further isohexane, and air dried to afford the product (27.0 g, 71.1 mmol, 68% yield) as a white solid. UPLC-MS (basic 2 min): Rt = 1.22 min; m/z = 380.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.09 (dd, J = 8.0, 1.3 Hz, 1H), 8.02 - 7.88 (m, 2H), 7.81 (t, J = 1.7 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.16 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0001851] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001852] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (27.0 g, 71.2 mmol, 1.0 eq.) and 4 N HC1 in 1,4-di oxane (267 mL, 1067 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was air-dried to afford the product (25.6 g, 81.1 mmol, assumed quantitative yield) as a white solid. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.20 (d, J = 4.6 Hz, 3H), 8.14 (ddd, J = 8.0, 1.3, 0.7 Hz, 1H), 8.04 (ddt, J = 8.2, 1.2, 0.6 Hz, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.34 - 5.27 (m, 1H), 3.58 (dd, J = 13.9, 6.0 Hz, 1H), 3.56 (s, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H).

[0001853] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001854] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile (7.70 g, 16.5 mmol, 1.0 eq.) in DMF (45 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (4.6 mL, 33.1 mmol, 2.0 eq.). The resulting mixture was stirred for 10 min. Then, 3 -nitrophenylsulfonyl chloride (4.40 g, 19.8 mmol, 1.2 eq.) was dissolved in 5 mL anhydrous DMF and added over a period of 10 min. The reaction was allowed to stir at the same temperature for 30 min before being allowed to warm to RT and stirred for 2 h. The reaction was slowly added to 100 mL ice water mixture and precipitated solid was filtered off and washed with hexane (100 mL) to obtain the product (7.80 g,16.8 mmol, assumed quantitative yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.11 min; m/z = 465.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.36 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.92 - 7.84 (m, 2H), 7.67 - 7.39 (m, 6H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (dd, J = 10.9, 4.3 Hz, 1H), 3.42 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001855] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001856] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (7.80 g, 13.4 mmol, 1.0 eq.), iron (7.50 g, 134 mmol, 10.0 eq.) and ammonium chloride (3.59 g, 67.2 mmol, 5.0 eq.) in ethanol (30 mL) and water (15 mL) was stirred at reflux, under a balloon of nitrogen, for 4.5 h. The reaction mixture was filtered through Celite, washing with ethanol and DCM and concentrated in vacuo. The residue was redissolved in ethyl acetate (250 mL) and diluted with sat. sodium hydrogen carbonate solution (250 mL). After separation of the phases, the organics were washed with further sat. sodium hydrogen carbonate (250 mL) and water (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was triturated with DCM to afford 3-amino-N-[l-(l,3- benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]benzenesulfonamide (4.30 g, 9.90 mmol, 74% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.06 min; m/z = 435.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 -

6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001857] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carboxamide

[0001858] A mixture of nicotinic acid (170 mg, 1.38 mmol, 1.2 eq.), 3-amino-N-[l-(l,3- benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmo, 1.0 eq.l), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.)) and HATU (656 mg, 1.73 mmol, 1.5 eq.) in DMF (5 mL) was stirred at RT for 4 h. The reaction mixture was poured in ice- water (100 mL) and precipitated solid was filtered off and dried under vacuum to obtain N-[3-[[l-(l,3-benzothiazol- 2-yl)-2-(3-cyanophenyl)ethyl]sulfamoyl]phenyl]pyridine-3-car boxamide (612 mg, 1.13 mmol, 99% yield) as a brown solid. UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 540.2 [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.54 (s, 1H), 9.14 (d, J = 2.3 Hz, 1H), 9.03 (d, J = 8.2 Hz, 1H), 8.82 - 8.75 (m, 1H), 8.32 (dt, J = 8.0, 2.0 Hz, 1H), 8.10 (dd, J = 8.0, 1.3 Hz, 1H), 8.03 (t, J = 2.0 Hz, 1H), 7.95 (dd, J = 8.0, 1.3 Hz, 1H), 7.79 (ddd, J = 8.2, 2.2, 1.1 Hz, 1H), 7.64 - 7.50 (m, 2H),

7.55 - 7.39 (m, 4H), 7.37 - 7.25 (m, 1H), 7.25 - 7.17 (m, 2H), 4.98 (ddd, J = 10.6, 8.2, 4.3 Hz, 1H), 3.40 (dd, J = 13.9, 4.3 Hz, 1H), 3.05 - 2.93 (m, 1H).

[0001859] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]pyridine- 3-carboxamide

[0001860] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carboxamide (612 mg, 1.13 mmol, 1.0 eq.), DIPEA (0.59 mL, 3.40 mmol, 3.0 eq.) and hydroxylammonium chloride (158 mg, 2.27 mmol, 2.0 eq) in ethanol (12 mL) was stirred at reflux for 4 h. The reaction mixture was then poured in ice water (50 mL) and precipitated solid was filtered off to afford the product (620 mg, 1.08 mmol, 95% yield) as a light brown solid. UPLC-MS (basic 2 min): Rt = 0.94 min; m/z = 573.1 [M+H] ⁺

[0001861] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(pyridine-3- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate

[0001862] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]pyridine- 3-carboxamide (620 mg, 1.08 mmol, 1.0 eq.) and acetic anhydride (0.31 mL, 3.25 mmol, 3.0 eq.) in acetic acid (11.0 mL) was stirred at RT for 5 h. The reaction mixture was concentrated in vacuo and the residue was purified via normal phase column chromatography (40 g cartridge) eluting with 0-100% EtOAc in isohexane to the product (390 mg, 0.634 mmol, 59% yield) as white solid. UPLC-MS (basic 2 mm): Rt = 0.98 mm; m/z = 615.2 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6): 5 10.42 (s, 1H), 9.09 - 9.03 (m, 1H), 8.91 (d, J = 8.0 Hz, 1H), 8.75 (ddd, J = 4.8, 1.7, 0.7 Hz, 1H), 8.30 - 8.22 (m, 1H), 8.05 - 7.97 (m, 2H), 7.91 - 7.84 (m, 1H), 7.69 (dt, J = 7.6, 1.8 Hz, 1H), 7.59 - 7.54 (m, 2H), 7.46 - 7.32 (m, 3H), 7.19 (dq, J = 9.6, 7.8 Hz, 3H), 7.06 (t, J = 7.7 Hz, 1H), 6.64 (s, 2H), 4.91 (td, J = 9.1, 5.3 Hz, 1H), 3.26 (s, 1H), 3.13 (dd, J = 5.2, 0.7 Hz, 1H), 2.97 (dd, J = 13.8, 9.9 Hz, 1H), 2.07 (d, J = 0.8 Hz, 3H).

[0001863] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carbox amide

[0001864] A mixture of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(pyridine-3- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate (390 mg, 0.634 mmol, 1.0 eq.) and zinc (830 mg, 12.7 mmol, 20.0 eq.) in acetic acid (2 mL) was stirred at RT for 20 h. The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM. The filtrate was then concentrated in vacuo. The residue was submitted for purification by reverse phase preparative HPLC on a Cl XBridge BEH C18 (19 mm x 150 mm, 5 um) eluting with 5-100% MeCN: water (10 mm ammonium bicarbonate) to afford the product (145 mg, 0.247 mmol, 39% yield) as a white solid. UPLC-MS (basic 6 min): Rt = 2.23 min; m/z = 557.2 for [M+H] ⁺ , 95% purity. H NMR (400 MHz, DMSO-d6): 5 9.06 (d, J = 2.7 Hz, 1H), 8.73 (dd, J = 4.8, 1.7 Hz, 1H), 8.26 (dt, J = 8.0, 2.0 Hz, 1H), 8.01 - 7.91 (m, 2H), 7.82 (d, J = 8.0 Hz, 1H), 7.69 (dt, J = 7.2, 2.2 Hz, 1H), 7.63 (s, 1H), 7.54 (dd, J = 8.0, 4.7 Hz, 1H), 7.44 (d, J =

7.8 Hz, 1H), 7.38 (td, J = 7.6, 1.3 Hz, 1H), 7.30 (td, J = 7.6, 1.3 Hz, 1H), 7.24 (d, J = 7.7 Hz, 1H), 7.22 - 7.08 (m, 3H), 4.81 (dd, J = 8.8, 4.8 Hz, 1H), 3.22 (dd, J = 13.5, 4.8 Hz, 1H), 2.99 (dd, J = 13.4, 8.9 Hz, 1H). Contains 0.22 wt% acetonitrile.

Example 96: Exemplary synthesis of Compound 270

[0001865] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001866] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2-aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in toluene (245 mb) was added DIPEA (22.0 mL, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirred for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H). Purity appears to be ca. 90%

[0001867] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001868] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60.0 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid. 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 -

8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). One CH not observed. 0.5 eq. of residual 1,4-di oxane. UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺

[0001869] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001870] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺ . 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001871] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001872] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (4.45 g, 8.24 mmol, 1.0 eq.), iron (4.60 g, 82.4 mmol, 10.0 eq.) and ammonium chloride (2.20 g, 41.2 mmol, 5.0 eq.) in ethanol (45 mL) and water (22.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (250 mL), washed with saturated sodium hydrogen carbonate solution (2 x 250 mL), and brine (250 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford the product (3.00 g, 6.90 mmol, 84% yield) as a yellow solid. UPLC-MS (basic 2 mm): Rt = 1.05 mm; m/z = 435.2 for [M+H] ⁺ 1H NMR (400 MHz, DMSO- d6) 5 8.73 (d, J = 8.1 Hz, 1H), 8.09 (ddt, J = 7.9, 1.4, 0.6 Hz, 1H), 7.95 (ddt, J = 8.1, 1.2, 0.6 Hz, 1H), 7.63 - 7.39 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.58 (dddd, J = 8.5, 3.0, 2.0, 0.9 Hz, 2H), 5.41 (s, 2H), 4.93 - 4.82 (m, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001873] Step 5: tert-butyl N-[rac-(2R)-3-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-2-methyl-3-oxo-propyl]c arbamate

[0001874] To a magnetically stirred solution of tert-butyl 3-amino-N-[l-(l,3-benzothiazol- 2-yl)-2-(3-cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added (R)-3-((tert-Butoxycarbonyl)amino)-2-methylpropanoic acid (281 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 25 h. The reaction mixture was concentrated in vacuo and redissolved in DCM (5 mL) and purified via normal phase column chromatography (40 g cartridge) eluting with 0-100% EtOAc in hexane to afford the product (622 mg, 1.00 mmol, 87% yield) as a yellow oil. UPLC-MS (basic 2 min): Rt = 1.16 min, m/z = 620.4 [M+H] ⁺ , 95% purity. 1H NMR (400 MHz, DMSO-d6) 5 10.00 (s, 1H), 8.92 (d, J = 7.3 Hz, 1H), 8.06 (d, J = 7.9 Hz, 1H), 7.94 - 7.88 (m, 1H), 7.83 (dt, J = 4.1, 2.0 Hz, 1H), 7.54 - 7.45 (m, 4H), 7.42 - 7.35 (m, 2H), 7.25 - 7.13 (m, 2H), 7.08 (dt, J = 7.8, 1.4 Hz, 1H), 6.87 (d, J = 6.2 Hz, 1H), 4.90 (s, 1H), 3.35 (s, 1H), 3.15 (tq, J = 12.5, 6.5 Hz, 1H), 2.99 - 2.83 (m, 2H), 2.64 (q, J = 6.9 Hz, 1H), 1.95 (s, 3H), 1.33 (d, J = 1.5 Hz, 9H).

[0001875] Step 6: tert-butyl N-[rac-(2R)-3-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[rac-(E)-N '- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]anilino]-2-methy l-3-oxo-propyl]carbamate

[0001876] To a magnetically stirred solution of tert-butyl N-[rac-(2R)-3-[3-[[l-(l,3- benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamoyl]anilino] -2-methyl-3-oxo-propyl]carbamate (622 mg, 1.00 mmol, 1.0 eq.) in ethanol (6 mb) was added DIPEA (0.52 mL, 3.01 mmol, 3.0 eq.) and hydroxylammonium chloride (139 mg, 2.01 mmol, 2.0 eq.) and the reaction mixture was heated to 85 °C and stirred for 22 h before being cooled to RT and concentrated to dryness to afford the product (777 mg, 1.12 mmol, assumed quantitative yield) as a yellow foam. UPLC- MS (basic 2 min): Rt = 1.06 min, m/z = 653.3 [M+H] ⁺ , 49% purity.

[0001877] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[[rac-(2R)-3-(te rt- butoxycarbonylamino)-2-methyl- propanoyl]amino]phenyl]sulfonylamino]ethyl]phenyl]methylene] amino] acetate

[0001878] A solution of tert-butyl N-[rac-(2R)-3-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[rac-(E)- N'-hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]anilino]-2-me thyl-3-oxo-propyl]carbamate (1.02 g, 1.56 mmol, 1.0 eq.) and acetic anhydride (0.44 mL, 4.68 mmol, 3.0 eq.) in acetic acid (10 mL) was stirred at RT for 18.5 h. The reaction mixture was concentrated to dryness and the residue was purified via normal phase column chromatography (40 g cartridge) eluting with 0- 100% EtOAc in hexane to afford the product (281 mg, 0.404 mmol, 26% yield) as a colourless glass. UPLC-MS (basic 2 mm): Rt = 1.10 mm, m/z = 695.4 [M+H] ⁺ , 95% purity. 1H NMR (400 MHz, DMSO-d6) 5 9.94 (d, J = 3.7 Hz, 1H), 8.87 (dd, J = 8.1, 1.5 Hz, 1H), 8.01 (d, J = 8.0 Hz, 1H), 7.93 - 7.83 (m, 2H), 7.54 - 7.50 (m, 1H), 7.50 - 7.34 (m, 4H), 7.19 (d, J = 7.6 Hz, 1H), 7.13 - 7.02 (m, 3H), 6.90 - 6.83 (m, 1H), 6.66 (s, 2H), 4.88 (q, J = 8.0 Hz, 1H), 3.27 - 3.22 (m, 1H), 3.13 (q, J = 6.0 Hz, 1H), 3.01 - 2.88 (m, 2H), 2.66 - 2.56 (m, 1H), 2.11 - 2.09 (m, 3H), 1.32 (s, 9H), 1.03 (d, J = 6.9 Hz, 3H).

[0001879] Step 8: tert-butyl N-[rac-(2R)-3-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-methyl-3-oxo- propyl]carbamate

[0001880] A mixture of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[[rac-(2R)-3-(te rt- butoxycarbonylamino)-2-methyl- propanoyl]amino]phenyl]sulfonylamino]ethyl]phenyl]methylene] amino] acetate (281 mg, 0.404 mmol, 1.0 eq.) and zinc (264 mg, 4.04 mmol, 10.0 eq.) in acetic acid (3 mL) was stirred at RT for 16.5 h. The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM and the filtrate was concentrated to dryness. The residue was purified via preparative-HPLC on a Cl XBridge BEH C18 (19 mm x 150 mm, 5 um) eluting with 30-100% MeCN in 10 mM ammonium bicarbonate (+0.1% NH ₄ OH) to afford the product (81 mg, 0.128 mmol, 31% yield) as a white solid. UPLC-MS (2 min, basic): Rt = 1.04 min, m/z = 637.4 [M+H] ⁺ , 99% purity. 1H NMR (400 MHz, DMSO-d6) 5 8.01 (d, J = 7.9 Hz, 1H), 7.90 - 7.82 (m, 2H), 7.62 (s, 1H), 7.56 - 7.49 (m, 1H), 7.46 (t, J = 7.3 Hz, 2H), 7.38 (t, J = 7.6 Hz, 1H), 7.29 - 7.22 (m, 1H), 7.15 (t, J = 7.8 Hz, 1H), 7.12 - 7.06 (m, 2H), 4.89 - 4.80 (m, 1H), 2.99 (dt, J = 15.2, 8.1 Hz, 3H), 2.69 - 2.64 (m, 1H), 1.36 (s, 9H), 1.07 - 1.05 (m, 3H).

[0001881] Step 9: rac-(2R)-3-amino-N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-2-methyl-propana mide

[0001882] T ert-butyl N- [rac-(2R)-3 - [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-y 1) - 2- (3 - carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-methyl-3-oxo- propyl]carbamate (81 mg, 0.127 mmol, 1.0 eq.) was stirred in 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 62.9 eq.) for 23.5 h. The reaction was concentrated and resuspended in 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 62.9 eq.) and stirred for a further 1 h. The reaction was concentrated in vacuo and the residue was redissolved in water and concentrated before being dried in a vacuum oven to afford the product (134 mg, 0.216 mmol, 62% yield) as a white solid. UPLC-MS (acidic 6 min): Rt = 1.56 mm; m/z = 537.3 for [M+H] ⁺ , 93% purity. 1H NMR (400 MHz, DMSO-d6) 5 10.38 (d, J = 8.0 Hz, 1H), 9.20 (s, 2H), 9.01 (s, 2H), 8.92 (dd, J = 8.1, 2.7 Hz, 1H), 8.06 - 8.02 (m, 1H), 7.95 - 7.86 (m, 5H), 7.70 - 7.66 (m, 1H), 7.57 - 7.50 (m, 2H), 7.50 - 7.43 (m, 3H), 7.43 - 7.37 (m, 1H), 7.25 (q, J = 7.8 Hz, 1H), 7.15 - 7.05 (m, 2H), 4.97 (tt, J = 10.3, 5.4 Hz, 1H), 3.11 - 2.97 (m, 2H), 2.90 - 2.79 (m, 2H), 1.21 (dd, J = 6.9, 3.5 Hz, 4H). Bis HC1 salt.

Example 97: Exemplary synthesis of Compound 271

[0001883] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001884] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2-aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in toluene (245 mb) was added DIPEA (22.0 mL, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirring for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H). Purity appears to be ca. 90%

[0001885] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001886] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60.0 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid. 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺

[0001887] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001888] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.12 min; m/z = 465.1 for [M+H] ⁺

[0001889] 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001890] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001891] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (3.40 g, 6.29 mmol, 1.0 eq.), iron (3.52 g, 62.9 mmol, 10.0 eq.) and ammonium chloride (1.68 g, 31.5 mmol, 5.0 eq.) in ethanol (35 mL) and water (17.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL), water (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.53 g as a yellow solid. The Celite was re-extracted with further ethanol (100 ml) and DCM (100 mL). The filtrate was concentrated in vacuo, resuspended in ethyl acetate (150 mL), washed with saturated sodium hydrogen carbonate solution (100 mL) and water (100 ml), dried over anhydrous sodium sulfate and concentrated in vacuo to afford 1.09 g as a yellow oil. These were combined to afford the product (2.62 g, 6.04 mmol, 96% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.07 min; m/z = 435.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001892] Step 5: tert-butyl 3-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]azetidine-1-car boxylate

[0001893] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (10 mL) was added l-tert-butoxycarbonylazetidine-3-carboxylic acid (232 mg, 1.15 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 72 h. The reaction mixture was diluted with ethyl acetate (25 mL) and washed with brine (25 mL), saturated sodium hydrogen carbonate solution (25 mL), and brine again (25 mL). The organics were dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The reaction mixture was concentrated to dryness under reduced pressure and the residue was purified by reverse-phase column chromatography over C18 (45 g cartridge) eluting with a gradient of 40-80% MeCN in water (0.1% NH ₃ ) to afford the product (385 mg, 0.623 mmol, 54% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.17 min; m/z = 618.3 [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.16 (s, 1H), 8.99 (s, 1H), 8.09 (d, J = 7.6 Hz, 1H), 7.94 (d, J = 7.8 Hz, 1H), 7.84 (t, 1H), 7.57 - 7.48 (m, 4H), 7.47 - 7.45 (m, 1H), 7.44 - 7.40 (m, 2H), 7.21 (q, J = 7.5 Hz, 2H), 7.13 (ddd, J = 7.8, 1.8, 1.0 Hz, 1H), 4.94 (s, 1H), 4.00 (s, 4H), 3.51 - 3.43 (m, 1H), 3.29 (d, J = 5.5 Hz, 1H), 2.97 (dd, J = 13.8, 10.7 Hz, 1H), 1.40 (s, 9H).

[0001894] Step 6: tert-butyl 3-[[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]carbamoyl ]azetidine-1-carboxylate

[0001895] To a magnetically stirred solution of tert-butyl 3-[[3-[[l-(l,3-benzothiazol-2-yl)-2- (3-cyanophenyl)ethyl]sulfamoyl]phenyl]carbamoyl]azetidine-l- carboxylate (385 mg, 0.623 mmol, 1.0 eq.) in EtOH (8 mL) were added hydroxylamine hydrochloride (87.0 mg, 1.25 mmol, 2.0 eq.) and DIPEA (0.24 mL, 1.37 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (0.33 mL, 1.87 mmol, assumed quantitative yield), as a beige foam, which was used in the next step without further purification. UPLC-MS (basic 2 min): Rt = 1.06 min; m/z = 651.3 for [M+H] ⁺

[0001896] Step 7: tert-butyl 3-[[3-[[2-[3-[(E)-N'-acetoxycarbamimidoyl]phenyl]-l-(l,3- benzothiazol-2-yl)ethyl]sulfamoyl]phenyl]carbamoyl]azetidine -1-carboxylate

[0001897] To a magnetically stirred solution of tert-butyl 3-[[3-[[l-(l,3-benzothiazol-2-yl)-2- [3 - [(E)-N'-hydroxycarbamimidoyl]pheny 1] ethyl] sulfamoyl] phenyl] carbamoyl] azetidine-1- carboxylate (406 mg, 0.623 mmol, 1.0 eq.) in acetic acid (6 mL) was added acetic anhydride (0.059 mL, 0.624 mmol, 1.0 eq.) and the reaction mixture was stirred at RT for 72 h. The reaction was redosed with acetic anhydride (0.059 mL, 0.624 mmol, 1.0 eq.) in acetic acid (6 mL) and stirred for 18 h. The reaction mixture was then concentrated to dryness. The residue was initially purified by normal phase column chromatography (12 g cartridge) eluting with 0-100% EtOAc in iso-hexane, then purified again by normal phase column chromatography (12 g cartridge) eluting with 75-100% EtOAc in iso-hexane to afford the product (138 mg, 0.199 mmol, 32% yield) as a colourless glass.

[0001898] UPLC-MS (basic 2 mm): Rt = 1.10 mm; m/z = 693.3 for [M+H] ⁺

[0001899] 1H NMR (400 MHz, DMSO-d6) 5 10.05 (s, 1H), 8.93 (d, J = 8.3 Hz, 1H), 8.04 (ddt, J = 7.9, 1.3, 0.6 Hz, 1H), 7.90 (ddt, J = 8.2, 1.3, 0.7 Hz, 1H), 7.84 (t, J = 2.0 Hz, 1H), 7.57 (t, J = 1.8 Hz, 1H), 7.54 - 7.38 (m, 4H), 7.24 - 7.05 (m, 4H), 6.71 (s, 2H), 4.97 - 4.87 (m, 1H), 4.03 - 3.88 (m, 4H), 3.48 - 3.38 (m, 1H), 3.30 - 3.25 (m, 1H), 3.00 (dd, J = 14.0, 9.7 Hz, 1H), 2.15 (d, J = 0.6 Hz, 3H), 1.40 (d, J = 0.6 Hz, 9H). [0001900] Step 8: tert-butyl 3-[[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]azetidi ne-1-carboxylate

[0001901] To a magnetically stirred solution of tert-butyl 3-[[3-[[2-[3-[(E)-N'- acetoxycarbamimidoyl]phenyl]-l-(l,3-benzothiazol-2- yl)ethyl]sulfamoyl]phenyl]carbamoyl]azetidine-l-carboxylate (138 mg, 0.199 mmol, 1.0 eq.) in acetic acid (4 mb) was added zinc (130 mg, 1.99 mmol, 10.0 eq.). The reaction mixture was stirred at RT for 72 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was submitted for purification via reverse phase preparative HPLC on a Waters XBridge C18 (19 mm x 150 mm, 5 um) eluting with 30-100% MeCN in water (0.1% NH ₄ OH) to afford the product (28 mg, 0.0441 mmol, 22% yield) as a white solid.

[0001902] UPLC-MS (basic 6 mm): Rt = 2.78 mm; m/z = 635.4 for [M+H] ⁺ , 98% purity

[0001903] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]azetidine-3-carbo xamide

[0001904] To a magnetically stirred solution of tert-butyl 3-[[3-[[l-(l,3-benzothiazol-2-yl)-2- (3-carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]carbamoyl]azet idine-1-carboxylate (28 mg, 0.0441 mmol, 1.0 eq.) in 1,4-dioxane (1 mL) was added 4 N HC1 in 1,4-dioxane (1.0 mL, 4.00 mmol, 90.7 eq.) and the resultant suspension was stirred at RT for 18 h. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in water and concentrated under reduced pressure and dried in the vacuum oven. The residue was submitted for purification via reverse phase prepative HPLC on a Waters XBridge C18 (19 mm x 150 mm, 5 um) eluting with 10-100% MeCN in water (0.2% TFA), with a follow-up purification via reverse phase preparative HPLC on a Waters XBridge C18 (19 mm x 150 mm, 5 um) eluting with 10-100% MeCN in water (10 mM ammonium bicarbonate) to afford the product (5.0 mg, 0.00935 mmol, 21% yield) as a white solid.

[0001905] UPLC-MS (acidic 6 min): Rt = 1.53 min; m/z = 535.2 for [M+H] ⁺ , 85% purity

[0001906] 1H NMR (400 MHz, DMSO-d6) 5 9.88 (s, 1H), 8.18 - 7.78 (m, 3H), 7.65 (s, 1H), 7.56 - 7.37 (m, 4H), 7.31 (s, 1H), 7.14 (t, J = 37.4 Hz, 3H), 6.62 (s, 1H), 4.95 (s, 1H), 4.08 - 3.71 (m, 3H), 3.06 - 2.85 (m, 3H). - CH peak not observed, aliphatic impurities at 1.78-1.75 ppm (integrates to 0.23) and 1.28-1.23 ppm (integrates to 0.75), freebase

[0001907] 1H NMR - D ₂ O (400 MHz, DMSO-d6) 5 7.99 (s, 1H), 7.91 - 7.74 (m, 2H), 7.59 (s, 1H), 7.44 (dq, J = 15.4, 7.4 Hz, 4H), 7.33 (d, J = 12.1 Hz, 1H), 7.16 (dt, J = 23.5, 7.9 Hz, 3H), 4.88 (s, 1H), 3.73 (s, 2H), 3.54 (s, 1H), 3.28 (d, J = 15.9 Hz, 2H), 2.98 (q, J = 12.6 Hz, 1H).

Example 98: Exemplary synthesis of Compound 272

[0001908] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001909] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (37.0 g, 105 mmol, 1.0 eq.) and 2-aminothiophenol (13.2 g, 105 mmol, 1.0 eq.) in toluene (500 mb) was added DIPEA (54.9 mL, 315 mmol, 3.0 eq.) and T3P (75.1 mL, 126 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 4 h. After cooling, the reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (500 mL) and stirring for 30 min. The reaction was then diluted with ethyl acetate (600 mL) and water (300 mL). After separation of the phases, the organics were washed with water (500 mL) and brine (500 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (330 g cartridge), in 2 batches, eluting with 0- 50% EtOAc in DCM to afford impure product. This was triturated with isohexane (100ml), filtered, washing with further isohexane, and air dried to afford the product (27.0 g, 71.1 mmol, 68% yield) as a white solid. UPLC-MS (basic 2 min): Rt = 1.22 min; m/z = 380.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.09 (dd, J = 8.0, 1.3 Hz, 1H), 8.02 - 7.88 (m, 2H), 7.81 (t, J =

I.7 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.16 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8,

I I.1 Hz, 1H), 1.31 (s, 9H).

[0001910] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001911] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (27.0 g, 71.2 mmol, 1.0 eq.) and 4 N HC1 in 1,4-di oxane (267 mL, 1067 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was air-dried to afford the product (25.6 g, 81.1 mmol, assumed quantitative yield) as a white solid. UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 280.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.20 (d, J = 4.6 Hz, 3H), 8.14 (ddd, J = 8.0, 1.3, 0.7 Hz, 1H), 8.04 (ddt, J = 8.2, 1.2, 0.6 Hz, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.34 - 5.27 (m, 1H), 3.58 (dd, J = 13.9, 6.0 Hz, 1H), 3.56 (s, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H).

[0001912] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001913] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile (7.70 g, 16.5 mmol, 1.0 eq.) in DMF (45 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (4.6 mL, 33.1 mmol, 2.0 eq.). The resulting mixture was stirred for 10 min. Then, 3 -nitrophenylsulfonyl chloride (4.40 g, 19.8 mmol, 1.2 eq.) was dissolved in 5 mL anhydrous DMF and added over a period of 10 min. The reaction was allowed to stir at the same temperature for 30 min before being allowed to warm to RT and stirred for 2 h. The reaction was slowly added to 100 mL ice water mixture and precipitated solid was filtered off and washed with hexane (100 mL) to obtain the product (7.80 g,16.8 mmol, assumed quantitative yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.11 min; m/z = 465.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.36 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.92 - 7.84 (m, 2H), 7.67 - 7.39 (m, 6H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (dd, J = 10.9, 4.3 Hz, 1H), 3.42 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001914] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001915] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (7.80 g, 13.4 mmol, 1.0 eq.), iron (7.50 g, 134 mmol, 10.0 eq.) and ammonium chloride (3.59 g, 67.2 mmol, 5.0 eq.) in ethanol (30 mL) and water (15 mL) was stirred at reflux, under a balloon of nitrogen, for 4.5 h. The reaction mixture was filtered through Celite, washing with ethanol and DCM and concentrated in vacuo. The residue was redissolved in ethyl acetate (250 mL) and diluted with sat. sodium hydrogen carbonate solution (250 mL). After separation of the phases, the organics were washed with further sat. sodium hydrogen carbonate (250 mL) and water (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was triturated with DCM to afford 3-amino-N-[l-(l,3- benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]benzenesulfonamide (4.30 g, 9.90 mmol, 74% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.06 min; m/z = 435.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001916] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]thiadiazole-5-carboxamide

[0001917] A mixture of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.), l,2,3-thiadiazole-5- carboxylic acid (180 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) in DMF (5 mL), under a balloon of nitrogen, was stirred at RT for 20 h. The reaction mixture was diluted with ethyl acetate (100 mL), washed with brine (100 mL), aq. saturated sodium hydrogen carbonate (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to afford the product (912 mg, 1.67 mmol, assumed quantitative yield) as a brown oil.

[0001918] UPLC-MS (basic 2 mm): Rt = 1.09 mm; m/z = 547.0 [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.93 (s, 1H), 9.54 (s, 1H), 9.08 (d, J = 8.3 Hz, 1H), 8.13 - 8.05 (m, 1H), 7.98 - 7.92 (m, 1H), 7.88 (t, J = 1.9 Hz, 1H), 7.76 (ddd, J = 8.0, 2.1, 1.1 Hz, 1H), 7.60 (t, J = 1.8 Hz, 1H), 7.52 - 7.39 (m, 4H), 7.33 (t, J = 7.9 Hz, 1H), 7.30 - 7.19 (m, 2H), 4.98 (ddd, J = 10.8, 8.2, 4.3 Hz, 1H), 3.40 (dd, J = 13.9, 4.3 Hz, 1H), 2.99 (dd, J = 13.9, 10.8 Hz, 1H).

[0001919] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]thiadiazo le-5-carboxamide

[0001920] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]thiadiazole-5-carboxamide (912 mg, 1.67 mmol, 1.0 eq.), DIPEA (0.87 mL, 5.01 mmol, 3.0 eq.) and hydroxylammonium chloride (232 mg, 3.34 mmol, 2.0 eq.) in ethanol (16.7 mL) was stirred at reflux for 20 h. The resulting mixture was then concentrated in vacuo to afford the product (967 mg, 1.67 mmol, assumed quantitative yield) as an orange oil. UPLC-MS (basic 2 min): Rt = 0.98 min; m/z = 580.0 [M+H] ⁺

[0001921] Step 7: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]thiadiazole-5-car boxamide

[0001922] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]thiadiazo le-5-carboxamide (50 mg, 0.0863 mmol, 1.0 eq.), palladium hydroxide on carbon (20 wt%, 4.8 mg, 0.0345 mmol, 0.4 eq.) and ammonium formate (109 mg, 1.73 mmol, 20 eq.) in ethanol (2 mb) was stirred at 95 °C for 10 h. The reaction mixture was filtered and concentrated in vacuo. The residue was submitted for purification via reverse phase prepative HPLC (Cl XBridge BEH C18, 19 mm x 150 mm, 5 um) eluting with 25-100% MeCN:water (10 mM ammonium bicarbonate) to afford the product (5.0 mg, 0.00887 mmol, 10% yield) as a yellow solid. UPLC-MS (basic 6 min): Rt = 2.36 min; m/z = 564.2 for [M+H] ⁺ , 97% purity. 1H NMR (400 MHz, DMSO-d6) 5 9.39 (s, 1H), 8.05 (d, J = 7.7 Hz, 1H), 7.93 - 7.88 (m, 1H), 7.75 (s, 1H), 7.65 (d, J = 7.9 Hz, 1H), 7.57 (s, 1H), 7.49 - 7.43 (m, 2H), 7.42 - 7.31 (m, 2H), 7.17 (td, J = 7.8, 4.8 Hz, 2H), 7.11 (d, J = 7.6 Hz, 1H), 4.87 (dd, J = 9.5, 4.8 Hz, 1H), 3.28 (dd, J = 13.7, 4.8 Hz, 1H), 2.98 (dd, J = 13.7, 9.6 Hz, 1H).

Example 99: Exemplary synthesis of Compound 273

[0001923] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001924] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (37.0 g, 105 mmol, 1.0 eq.) and 2-aminothiophenol (13.2 g, 105 mmol, 1.0 eq.) in toluene (500 mb) was added DIPEA (54.9 mL, 315 mmol, 3.0 eq.) and T3P (75.1 mL, 126 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 4 h. After cooling, the reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (500 mL) and stirring for 30 min. The reaction was then diluted with ethyl acetate (600 mL) and water (300 mL). After separation of the phases, the organics were washed with water (500 mL) and brine (500 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (330 g cartridge), in 2 batches, eluting with 0- 50% EtOAc in DCM to afford impure product. This was triturated with isohexane (100ml), filtered, washing with further isohexane, and air dried to afford the product (27.0 g, 71.1 mmol, 68% yield) as a white solid. UPLC-MS (basic 2 min): Rt = 1.22 min; m/z = 380.3 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.09 (dd, J = 8.0, 1.3 Hz, 1H), 8.02 - 7.88 (m, 2H), 7.81 (t, J =

I.7 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.16 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8,

I I.1 Hz, 1H), 1.31 (s, 9H).

[0001925] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001926] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (27.0 g, 71.2 mmol, 1.0 eq.) and 4 N HC1 in 1,4-di oxane (267 mL, 1067 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was air-dried to afford the product (25.6 g, 81.1 mmol, assumed quantitative yield) as a white solid. UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 280.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.20 (d, J = 4.6 Hz, 3H), 8.14 (ddd, J = 8.0, 1.3, 0.7 Hz, 1H), 8.04 (ddt, J = 8.2, 1.2, 0.6 Hz, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.34 - 5.27 (m, 1H), 3.58 (dd, J = 13.9, 6.0 Hz, 1H), 3.56 (s, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H). Contains 6 wt% 1,4-di oxane

[0001927] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0001928] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile (7.70 g, 16.5 mmol, 1.0 eq.) in DMF (45 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (4.6 mL, 33.1 mmol, 2.0 eq.). The resulting mixture was stirred for 10 min. Then, 3 -nitrophenylsulfonyl chloride (4.40 g, 19.8 mmol, 1.2 eq.) was dissolved in 5 mL anhydrous DMF and added over a period of 10 min. The reaction was allowed to stir at the same temperature for 30 min before being allowed to warm to RT and stirred for 2 h. The reaction was slowly added to 100 mL ice water mixture and precipitated solid was filtered off and washed with hexane (100 mL) to obtain the product (7.80 g,16.8 mmol, assumed quantitative yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.11 min; m/z = 465.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 9.36 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.92 - 7.84 (m, 2H), 7.67 - 7.39 (m, 6H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (dd, J = 10.9, 4.3 Hz, 1H), 3.42 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0001929] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0001930] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (7.80 g, 13.4 mmol, 1.0 eq.), iron (7.50 g, 134 mmol, 10.0 eq.) and ammonium chloride (3.59 g, 67.2 mmol, 5.0 eq.) in ethanol (30 mL) and water (15 mL) was stirred at reflux, under a balloon of nitrogen, for 4.5 h. The reaction mixture was filtered through Celite, washing with ethanol and DCM and concentrated in vacuo. The residue was redissolved in ethyl acetate (250 mL) and diluted with sat. sodium hydrogen carbonate solution (250 mL). After separation of the phases, the organics were washed with further sat. sodium hydrogen carbonate (250 mL) and water (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was triturated with DCM to afford 3-amino-N-[l-(l,3- benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]benzenesulfonamide (4.30 g, 9.90 mmol, 74% yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 1.06 min; m/z = 435.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0001931] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl]phenyl]- 1 -methyl-triazole-4-carboxamide

[0001932] A mixture of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.), l-methyl-lH-1,2,3- triazole-4-carboxylic acid (175 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) in DMF (5 mL), under a balloon of nitrogen, was stirred at RT for 20 h. The reaction was diluted with ethyl acetate (100 mL), washed with brine (100 mL), aq. saturated sodium hydrogen carbonate (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to afford product (948 mg, 1.74 mmol, assumed quantitative yield) as a brown oil. UPLC-MS (basic 2 min): Rt = 1.04 min; m/z = 544.1 [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 10.57 (s, 1H), 8.99 (d, J = 8.2 Hz, 1H), 8.70 (s, 1H), 8.14 (t, J = 2.0 Hz, 1H), 8.09 (ddt, J = 7.9, 1.4, 0.6 Hz, 1H), 7.98 - 7.92 (m, 1H), 7.84 (dt, J = 8.4, 1.3 Hz, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 - 7.47 (m, 2H), 7.46 - 7.40 (m, 2H), 7.26 (t, J = 7.9 Hz, 1H), 7.22 - 7.15 (m, 2H), 4.98 (ddd, J = 10.7, 8.2, 4.3 Hz, 1H), 4.16 (s, 3H), 3.39 (dd, J = 13.9, 4.4 Hz, 1H), 2.98 (dd, J = 13.9, 10.6 Hz, 1H).

[0001933] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-l-methyl -triazole-4-carboxamide

[0001934] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]-l-methyl-triazole-4-carb oxamide (948 mg, 1.74 mmol, 1.0 eq.), DIPEA (0.91 mL, 5.23 mmol, 3.0 eq.) and hydroxylammonium chloride (242 mg, 3.49 mmol, 2.0 eq.) in ethanol (17.4 mL) was stirred at reflux for 20 h. The resulting mixture was concentrated in vacuo to afford the product (1005 mg, 1.74 mmol, assumed quantitative yield) as a yellow solid. UPLC-MS (basic 2 min): Rt = 0.93 min; m/z = 577.1 [M+H] ⁺

[0001935] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[(l-methyltr iazole-4- carbonyl)amino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate

[0001936] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-l-methyl -triazole-4-carboxamide (905 mg, 1.57 mmol, 1.0 eq.) and acetic anhydride (0.45 mL, 4.71 mmol, 3.0 eq.) in acetic acid (10 mL) was stirred at RT for 20 h. The reaction mixture was concentrated in vacuo and the residue was purified via normal phase column chromatography (24 g cartridge) eluting with 5-100% EtOAc in isohexane to afford the product (381 mg, 0.616 mmol, 39% yield) as a white solid. UPLC-MS (basic 2 mm): Rt = 1.00 mm; m/z = 619.2 for [M+H] ⁺ 1H NMR (400 MHz, DMSO- d6) 5 10.49 (s, 1H), 8.93 (d, J = 8.0 Hz, 1H), 8.68 (s, 1H), 8.20 (t, J = 1.9 Hz, 1H), 8.08 - 8.00 (m, 1H), 7.94 - 7.87 (m, 1H), 7.76 (dt, J = 7.9, 1.7 Hz, 1H), 7.56 (d, J = 1.8 Hz, 1H), 7.48 - 7.35 (m, 3H), 7.24 - 7.13 (m, 3H), 7.08 (t, J = 7.7 Hz, 1H), 6.65 (s, 2H), 4.96 (td, J = 9.1, 5.3 Hz, 1H), 4.15 (s, 3H), 3.31 - 3.26 (m, 1H), 3.01 (dd, J = 13.9, 9.7 Hz, 1H), 2.12 (s, 3H).

[0001937] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-l-methyl-triazol e-4-carboxamide

[0001938] A mixture of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[(l-methyltr iazole-4- carbonyl)amino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate (381 mg, 0.616 mmol, 1.0 eq.) and zinc (805 mg, 12.3 mmol, 20.0 eq.) in acetic acid (6.2 mL) was stirred at RT for 20 h. The reaction mixture was filtered through Celite, washing with copious ethanol, acetonitrile and DCM before concentrated in vacuo. The residue was purified via reverse phase preparative HPLC (Cl XBridge BEH C18, 19 mm x 150 mm, 5 um) eluting with 15-100% MeCN:water (10 mM ammonium bicarbonate) to afford the product (47 mg, 0.0838 mmol, 14% yield) as a white solid. UPLC-MS (basic 6 min): Rt = 2.18 min; m/z = 561.1 for [M+H] ⁺ , 98% purity. 1H NMR (400 MHz, DMSO-d6) 5 8.69 (s, 1H), 8.15 (q, J = 1.3 Hz, 1H), 8.02 - 7.96 (m, 1H), 7.87 (dt, J = 8.2, 1.0 Hz, 1H), 7.70 (td, J = 4.3, 2.1 Hz, 1H), 7.64 (t, J = 1.8 Hz, 1H), 7.47 - 7.39 (m, 2H), 7.35 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 7.26 (d, J = 7.6 Hz, 1H), 7.18 - 7.09 (m, 3H), 4.86 (dd, J = 8.8, 4.9 Hz, 1H), 4.15 (s, 3H), 3.25 (dd, J = 13.5, 4.9 Hz, 1H), 3.01 (dd, J = 13.5, 8.9 Hz, 1H).

Example 100: Exemplary synthesis of Compound 274

[0001939] Step 1: tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-oxo-ethyl]carbamate

[0001940] To a stirred solution of 2-(tert-butoxycarbonylamino)-3-(3-cyanophenyl)propanoic acid (17.00 g, 58.6 mmol, 1.0 eq.) in DMF (140 mL) was added DIPEA (31 mL, 176 mmol, 3.0 eq.), ammonium chloride (7.83 g, 146 mmol, 2.5 eq.) and HATU (33.40 g, 87.8 mmol, 1.5 eq.) and the resultant solution was stirred at RT for 1.5 h. The reaction mixture was quenched with ice-cold water and the precipitated solid was filtered off. The residue was dried overnight in a vacuum oven to afford product (17.28 g, 59.7 mmol, assumed quantitative yield) as an off-white solid. UPLC-MS (basic 2 mm): Rt = 0.90 mm; m/z = 288.1 for [M+H] ⁺ 1H NMR (400 MHz, DMSO-d6) 5 7.70 - 7.65 (m, 2H), 7.63 - 7.59 (m, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.39 (s, 1H), 7.06 (s, 1H), 6.90 (d, J = 9.1 Hz, 1H), 4.11 (td, J = 10.4, 4.1 Hz, 1H), 3.03 (dd, J = 13.8, 4.1 Hz, 1H), 2.76 (dd, J = 13.5, 10.3 Hz, 1H), 1.28 (s, 9H).

[0001941] Step 2: tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-thioxo-ethyl]carbamat e

[0001942] To a magnetically stirred solution of tert-butyl N-[2-amino-l-[(3- cyanophenyl)methyl]-2-oxo-ethyl] carbamate (17.28 g, 59.7 mmol, 1.0 eq.) in THF (200 mL) was added Lawesson reagent (28.99 g, 71.7 mmol, 1.2 eq.) and the resultant mixture stirred at RT for 20 h. The reaction mixture was filtered and the filtrate was concentrated in vacuo. The residue was suspended in EtOAc (200 mL) and aq. saturated NaHCO3 solution (400 mL). The organics were extracted with EtOAc (3 x 200 mL) and after separation of the phases, the organics were washed with brine (200 mL), dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo. The residue was purified by normal phase column chromatography (330 g cartridge) eluting with 0- 30% EtOAc in DCM to afford the product (7.96 g, 26.0 mmol, 44% yield) as a yellow solid.

[0001943] UPLC-MS (basic 4 mm): Rt = 1.59 mm; m/z = 306.2 for [M+H] ⁺

[0001944] 1H NMR analysis (400 MHz, DMSO-d6) 5 9.64 (s, 1H), 9.28 - 9.23 (m, 1H), 7.74 (s, 1H), 7.68 (d, J = 7.7 Hz, 1H), 7.64 (d, J = 7.9 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 6.92 (d, J = 8.9 Hz, 1H), 4.43 (td, J = 9.5, 4.4 Hz, 1H), 3.04 (dd, J = 13.4, 4.8 Hz, 1H), 2.85 (dd, J = 13.5, 9.9 Hz, 1H), 1.29 (s, 9H).

[0001945] Step 3: tert-butyl N-[2-(3-cyanophenyl)-l-(4-hydroxy-4,5-dihydrothiazol-2- y 1) ethyl] carbamate

[0001946] Bromoacetaldehyde diethylacetal (15.40 g, 78.1 mmol, 3.0 eq.) in water (40 mL) was hydrolyzed by stirring with concentrated hydrogen chloride solution (5.4 mL, 156 mmol, 6.0 eq.) at 60 °C for 30 min. The mixture was cooled to RT and added to a magnetically stirred suspension of sodium hydrogen carbonate (21.88 g, 260 mmol, 10.0 eq.) in THF (120 mL) and stirred for 15 min. Then tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-thioxo- ethyl] carbamate (7.96 g, 26.0 mmol, 1.0 eq.) was added and stirred for 18 h at RT. The reaction was diluted in EtOAc (200 mL) and water (200 mL). After separation of the phases, the organics were washed with saturated brine solution (200 mL), dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo. The residue was dried in the vacuum overnight to afford the product (8.45 g, 24.3 mmol, 93% yield) as a beige solid.

[0001947] UPLC-MS (basic 2 mm): Rt = 0.97 mm; m/z = 348.2 for [M+H] ⁺ ; Rt = 1.09 mm; m/z = 330.2 for [M+H] ⁺ (product obtained as a mixture of desired material and dehydrated material)

[0001948] 1H NMR (400 MHz, DMSO-d6) 5 7.69 (d, J = 6.0 Hz, 2H), 7.67 - 7.65 (m, 1H), 7.61 (d, J = 7.9 Hz, 1H), 7.50 (q, J = 7.8 Hz, 2H), 7.44 (d, J = 9.1 Hz, 1H), 6.41 (d, J = 6.0 Hz, 1H), 5.96 - 5.89 (m, 1H), 4.56 - 4.49 (m, 1H), 3.48 - 3.42 (m, 2H), 3.23 (dd, J = 13.7, 4.2 Hz, 1H), 2.98 - 2.93 (m, 1H), 2.89 (dd, J = 13.7, 11.1 Hz, 1H), 1.27 (s, 9H). - 3 extra protons seen in aromatic region

[0001949] Step 4: 3-(2-amino-2-thiazol-2-yl-ethyl)benzonitrile hydrochloride

[0001950] To a stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(4-hydroxy-4,5- dihydrothiazol-2-yl)ethyl]carbamate (8.45 g, 24.3 mmol, 1.0 eq.) in 1,4-dioxane (250 mL) was slowly added hydrogen chloride solution (25 mL, 720 mmol, 29.6 eq.) with the resulting mixture being stirred at RT for 3 h. The reaction mixture was concentrated, dissolved in 1,4-dioxane (150 mL), redosed with hydrogen chloride solution (25 mL, 720 mmol, 29.6 eq.) and stirred at RT for 96 h. The mixture was diluted with excess Et ₂ O, and the precipitate that formed was collected by filtration, washed with copious Et ₂ O and dried in vacuo to afford the product (6.27 g, 23.6 mmol, 97% yield) as a light brown solid.

[0001951] UPLC-MS (basic 2 mm): Rt = 0.84 mm; m/z = 230.2 for [M+H] ⁺

[0001952] 1H NMR (400 MHz, DMSO-d6) 5 8.86 (s, 3H), 7.90 (d, J = 3.2 Hz, 1H), 7.79 (d, J = 3.3 Hz, 1H), 7.72 (ddd, J = 6.1, 2.7, 1.6 Hz, 1H), 7.69 (p, J = 1.6 Hz, 1H), 7.53 - 7.47 (m, 2H), 5.23 - 5.15 (m, 1H), 3.44 (dd, J = 13.8, 6.2 Hz, 1H), 3.29 (dd, J = 13.7, 8.7 Hz, 1H).

[0001953] Step 5: Methyl 3-[[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]sulfamoyl]benzoat e

[0001954] To a solution of 3-(2-amino-2-thiazol-2-yl-ethyl)benzonitrile hydrochloride (3.30 g, 12.5 mmol, 1.0 eq.) in DMF (15 mL), which was cooled to 0 °C and under a balloon of nitrogen, was added triethylamine (5.2 mL, 37.3 mmol, 3.0 eq.). The resulting mixture was then stirred for 10 min before the portion wise addition of methyl 3-(chlorosulfonyl)benzoate (3.51 g, 14.9 mmol, 1.2 eq.) over a 10 min period. The reaction was allowed to stir at the same temperature for 1 h before being allowed to warm to RT and stirred for 16 h. The reaction was slowly added to 40 mL ice water mixture and the precipitated sticky, tar-like solid was filtered off and washed with hexane. The crude was dissolved in DCM and upon addition of iso-hexane, a solid precipitated out which was collected by filtration to afford product (2.30 g, 5.38 mmol, 43% yield) as a brown solid.

[0001955] UPLC-MS (basic 2 mm): Rt = 1.04 mm; m/z = 428.1 for [M+H] ⁺

[0001956] 1H NMR (400 MHz, DMSO-d6) 5 9.02 (d, J = 8.5 Hz, 1H), 8.01 (dt, J = 7.8, 1.4 Hz, 1H), 7.89 (t, J = 1.8 Hz, 1H), 7.72 - 7.69 (m, 2H), 7.63 (d, J = 3.2 Hz, 1H), 7.53 (d, J = 1.7 Hz, 1H), 7.51 - 7.47 (m, 1H), 7.45 (dt, J = 7.7, 1.4 Hz, 1H), 7.41 (dt, J = 7.8, 1.4 Hz, 1H), 7.20 (t, J = 7.7 Hz, 1H), 4.94 (ddd, J = 10.7, 8.5, 4.4 Hz, 1H), 3.91 (s, 3H), 3.28 (d, J = 4.4 Hz, 1H), 2.95 - 2.89 (m, 1H). - residual DMF (1.17% by weight) and DCM (0.81% by weight)

[0001957] Step 6: 3-[[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]sulfamoyl]benzoic acid

[0001958] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-thiazol-2- yl-ethyl]sulfamoyl]benzoate (2.73 g, 6.39 mmol, 1.0 eq.) in THF (50 mL) was added a solution of lithium hydroxide (804 mg, 19.2 mmol, 3.0 eq.) in water (15 mL) and the resultant solution was stirred at RT for 16 h. The reaction mixture was diluted with EtOAc (50 mL) and water (50 mL) and the phases separated. The aqueous phase was acidified with 1 M HC1 and the precipitate filtered and dried in air, before being dried overnight in the vacuum oven, to afford the product (2.07 g, 5.01 mmol, 78% yield) as a brown solid.

[0001959] UPLC-MS (basic 2 mm): Rt = 0.73 mm; m/z = 414.2 for [M+H] ⁺

[0001960] 1H NMR (400 MHz, DMSO-d6) 5 13.34 (s, 1H), 8.97 (d, J = 8.5 Hz, 1H), 7.99 (dt, J = 7.7, 1.3 Hz, 1H), 7.93 (t, J = 1.6 Hz, 1H), 7.68 (d, J = 3.2 Hz, 1H), 7.67 - 7.65 (m, 1H), 7.61 (d, J = 3.2 Hz, 1H), 7.54 (t, J = 1.9 Hz, 1H), 7.48 - 7.42 (m, 3H), 7.23 (t, J = 7.7 Hz, 1H), 4.94 (ddd, J = 10.6, 8.6, 4.6 Hz, 1H), 3.28 (d, J = 4.3 Hz, 1H), 2.93 (dd, J = 13.9, 10.5 Hz, 1H).

[0001961] Step 7: 3-[[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]sulfamoyl]-N-(2- methoxyethyl)benzamide

[0001962] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] benzoic acid (0.50 g, 1.21 mmol, 1.0 eq.) in DMF (10 mL) was added 2- methoxyethylamine (0.13 mL, 1.45 mmol, 1.2 eq.) and DIPEA (0.63 mL, 3.63 mmol, 3.0 eq.), shortly followed by HATU (690 mg, 1.81 mmol, 1.5 eq.) and left to stir at RT for 1.5 h. The reaction mixture was diluted with EtOAc (30 mL), washed with brine (30 mL), saturated Na ₂ CO ₃ solution (30 mL), and brine again (30 mL). The organics were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to afford the product (582 mg, 1.24 mmol, assumed quantitative yield) as a brown oil.

[0001963] UPLC-MS (basic 2 mm): Rt = 0.92 mm; m/z = 471.1 for [M+H] ⁺

[0001964] 1H NMR (400 MHz, DMSO-d6) 5 8.91 (d, J = 8.5 Hz, 1H), 8.69 - 8.63 (m, 1H), 7.93 (dd, J = 1.9, 0.9 Hz, 2H), 7.71 (d, J = 3.3 Hz, 1H), 7.62 (d, J = 3.3 Hz, 1H), 7.58 (ddd, J = 7.8, 2.0, 1.2 Hz, 1H), 7.51 (t, J = 1.7 Hz, 1H), 7.45 - 7.39 (m, 3H), 7.18 (t, J = 7.8 Hz, 1H), 4.97 (ddd, J = 10.7, 8.5, 4.6 Hz, 1H), 3.53 - 3.43 (m, 4H), 3.30 (s, 3H), 3.29 (s, 1H), 2.93 - 2.89 (m, 1H). - residual EtOAc (4.25% by weight), DMF (20.41% by weight) and TMU (5.22% by weight)

[0001965] Step 8: 3-[[2-[3-[(E)-N'-hydroxycarbamimidoyl]phenyl]-l-thiazol-2-yl - ethyl] sulfamoyl] -N-(2-methoxyethyl)benzamide

[0001966] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] -N-(2-methoxyethyl)benzamide (582 mg, 1.24 mmol, 1.0 eq.) in ethanol (10 mL ) was added hydroxylammonium chloride (172 mg, 2.47 mmol, 2.0 eq.) and DIPEA (0.65 mL, 3.71 mmol, 3.0 eq.) with the resultant mixture stirred at 85 °C for 18 h. The mixture was cooled to RT and concentrated to dryness under reduced pressure to afford the product (623 mg, 1.24 mmol, assumed quantitative yield) as an orange/ brown oil.

[0001967] UPLC-MS (basic 2 mm): Rt = 0.80 mm; m/z = 504.2 for [M+H] ⁺

[0001968] Step 9: [(E)-[amino-[3-[2-[[3-(2-methoxyethylcarbamoyl)phenyl]sulfon ylamino]-2- thiazol-2-yl-ethyl]phenyl]methylene]amino] acetate

[0001969] To a magnetically stirred solution of 3-[[2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]-l-thiazol-2-yl-ethyl]sulfamoyl] -N-(2-methoxyethyl)benzamide (623 mg, 1.24 mmol, 1.0 eq.) in acetic acid (8 mL) was added acetic anhydride (0.35 mL, 3.71 mmol, 3.0 eq.). The reaction was left to stir at RT for 1 h. The reaction mixture was concentrated to dryness under reduced pressure and the residue was purified by normal-phase column chromatography over silica (24 g cartridge) eluting with 80-100% EtOAc in DCM to afford the product (312 mg, 0.572 mmol, 46% yield) as a white solid.

[0001970] UPLC-MS (basic 2 mm): Rt = 0.85 mm; m/z = 546.2 for [M+H] ⁺

[0001971] 1H NMR (400 MHz, DMSO-d6) 5 8.87 (d, J = 8.0 Hz, 1H), 8.67 (t, J = 5.4 Hz, 1H), 7.91 (t, J = 1.9 Hz, 1H), 7.87 (dt, 1H), 7.65 (dd, J = 3.2, 0.6 Hz, 1H), 7.57 - 7.53 (m, 2H), 7.44 (t, J = 2.0 Hz, 1H), 7.40 (d, J = 5.6 Hz, 1H), 7.36 (t, J = 7.9 Hz, 1H), 7.18 (d, J = 7.7 Hz, 1H), 7.07 (t, J = 7.6 Hz, 1H), 6.68 (s, 2H), 4.90 (s, 1H), 3.51 - 3.43 (m, 4H), 3.29 (d, J = 0.6 Hz, 3H), 3.23 (dd, J = 13.8, 5.1 Hz, 1H), 2.91 (dd, J = 9.8 Hz, 1H), 2.16 (d, J = 0.6 Hz, 3H). - residual EtOAc (1.09% by weight) and DMF (2.45% by weight)

[0001972] Step 10: 3-[[2-(3-carbamimidoylphenyl)-l-thiazol-2-yl-ethyl]sulfamoyl ]-N-(2- methoxyethyl)benzamide

[0001973] A mixture of [(E)-[amino-[3-[2-[[3-(2- methoxyethylcarbamoyl)phenyl]sulfonylamino]-2-thiazol-2-yl-e thyl]phenyl]methylene]amino] acetate (312 mg, 0.572 mmol, 1.0 eq.) and zinc (748 mg, 11.4 mmol, 20.0 eq.) in acetic acid (5.7 mb) was stirred at RT for 20 h. The reaction mixture was filtered through Celite, washing with copious ethanol, acetonitrile and DCM before concentrating in vacuo. The residue was purified via reverse phase preparative HPLC (Cl XBridge BEH C18, 19 mm x 150 mm, 5 um) eluting with 5-100% MeCN:water (10 mM ammonium bicarbonate) to afford the product (136 mg, 0.279 mmol, 49% yield) as a white solid.

[0001974] UPLC-MS (basic 6 mm): Rt = 1.45 mm; m/z = 488.1 for [M+H] ⁺ , 99% purity.

[0001975] 1H NMR (400 MHz, DMSO-d6) 5 8.66 (s, 1H), 7.94 (t, J = 1.8 Hz, 1H), 7.80 (dt, J = 7.9, 1.4 Hz, 1H), 7.61 (d, J = 3.3 Hz, 1H), 7.56 - 7.51 (m, 2H), 7.46 (d, J = 3.2 Hz, 1H), 7.43 (d, J = 7.8 Hz, 1H), 7.32 (t, J = 7.7 Hz, 1H), 7.18 (d, J = 7.6 Hz, 1H), 7.11 (t, J = 7.6 Hz, 1H), 4.77 (dd, J = 8.9, 4.9 Hz, 1H), 3.51 - 3.40 (m, 4H), 3.28 (s, 3H), 3.17 (dd, J = 13.4, 4.9 Hz, 1H), 2.89 (dd, J = 13.4, 8.9 Hz, 1H). Freebase, 1 exchangeable visible

Example 101: Exemplary synthesis of Compound 252

[0001976] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0001977] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (16.2 g, 55.8 mmol, 1.0 eq.) in toluene (300 mL) were added 2- aminothiophenol (6.6 mL, 61.4 mmol, 1.1 eq.), T3P (25.0 mL, 41.9 mmol, 0.75 eq.) and DIPEA (15.0 mL, 83.7 mmol, 1.5 eq.). The resulting mixture was stirred at 115 °C for 53 h. The reaction mixture was cooled to RT and concentrated to dryness. The residue was purified by normal phase column chromatography (330 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (9.55 g, 22.4 mmol, 40% yield) as a red solid.

[0001978] 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (d, J = 8.1 Hz, 1H), 7.89 (d, J = 8.9 Hz, 1H), 7.77 (s, 1H), 7.70 - 7.65 (m, 2H), 7.52 - 7.45 (m, 2H), 7.43 - 7.37 (m, 1H), 5.17 - 5.06 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.08 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 8H).

[0001979] UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.1 for [M+H] ⁺

[0001980] Setp 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0001981] A magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (9.55 g, 25.2 mmol, 1.0 eq.) in 4 N HC1 in 1,4-dioxane (50.0 mb, 200 mmol, 7.9 eq.) was stirred at RT for 18 h. The reaction mixture was then concentrated to dryness to afford the product (9.91 g, 25.4 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification.

[0001982] 1H NMR (400 MHz, DMSO-d6) 5 8.98 (s, 3H), 8.14 - 8.09 (m, 1H), 8.02 (d, J = 8.1 Hz, 1H), 7.80 - 7.76 (m, 1H), 7.73 - 7.68 (m, 1H), 7.54 (ddq, J = 8.3, 5.6, 1.7 Hz, 2H), 7.46 (tt, J = 7.7, 1.6 Hz, 2H), 5.30 (s, 1H), 3.46 (dd, J = 14.2, 6.4 Hz, 1H), 3.34 (dd, J = 13.9, 8.4 Hz, 1H).

[0001983] UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 280.0 for [M+H] ⁺

[0001984] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0001985] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (1.62 g, 5.13 mmol, 1.0 eq.) in DMF (15 mL) cooled to 0 °C was added tri ethylamine (2.1 mL, 15.4 mmol, 3.0 eq.) and the reaction mixture was stirred for 10 min. Methy 1-3 -chlorosulfonylbenzoate (1.44 g, 6.16 mmol, 1.2 eq.) was added portion wise over 10 min and the reaction mixture was allowed to warm to RT and stir for 2 h. The reaction was quenched via the addition of water (50 mL). The organics were extracted with ethyl acetate (100 mL), washed with water (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, filtered and air dried. The filtrate was concentrated to dryness and triturated with DCM, filtered and air dried. The solids were combined to afford product (1.30 g, 2.72 mmol, 53% yield) as a white solid.

[0001986] 1H NMR analysis (400 MHz, DMSO-d6) 5 9.16 (d, J = 8.4 Hz, 1H), 8.07 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 7.94 - 7.85 (m, 3H), 7.72 (ddd, J = 7.9, 2.0, 1.2 Hz, 1H), 7.61 (t, J = 1.7 Hz, 1H), 7.55 - 7.40 (m, 5H), 7.22 (t, J = 7.7 Hz, 1H), 5.07 (ddd, J = 10.8, 8.5, 4.3 Hz, 1H), 3.88 (s, 3H), 3.39 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.9 Hz, 1H)

[0001987] UPLC-MS (basic 2 mm) Rt = 1.12 mm. m/z = 478.2 for [M+H] ⁺

[0001988] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0001989] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (1.30 g, 2.72 mmol, 1.0 eq.) in THF (23 mL) was added a solution of lithium hydroxide (0.342 g, 8.15 mmol, 3.0 eq.) in water (7 mL) and the resulting mixture was stirred at RT for 3 h. The reaction volume was reduced by half and the reaction was diluted with EtOAc (50 mL) and water (50 mL). The phases were separated, and the aqueous phase was acidified to pH 3 via the addition of 1 M HC1. The precipitate was collected by filtration, washing with water, and air dried to afford product (1.42 g, 3.07 mmol, assumed quantitative yield) as a white solid, which was used in the next step without further purification.

[0001990] 1H NMR analysis (400 MHz, DMSO-d6) 5 13.29 (s, 1H), 9.13 (d, J = 8.5 Hz, 1H), 8.08 (d, J = 7.9 Hz, 1H), 7.96 - 7.89 (m, 3H), 7.70 - 7.63 (m, 1H), 7.60(s, 1H), 7.51 (t, J = 8.3 Hz, 2H), 7.48 - 7.36 (m, 3H), 7.23 (t, J = 7.7 Hz, 1H), 5.11 - 5.00 (m, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H)

[0001991] UPLC-MS (basic 2 mm) Rt = 0.82 mm. m/z = 464.2 for [M+H] ⁺

[0001992] Step 5: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-(morp holine-4- carbonyl)benzenesulfonamide

[0001993] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (0.500 g, 1.08 mmol, 1.0 eq.) in DMF (5 mL) were added morpholine (0.11 mL, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.24 mmol, 3.0 eq.) and HATU (0.620 g, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 120 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with water (2 x 25 mL), brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25 mL). The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness to afford the product (0.420 g, 0.787 mmol, 73% yield) as an off-white solid that was used without further purification.

[0001994] 1H NMR (400 MHz, DMSO-d6) 5 9.04 (s, 1H), 8.01 (dd, J = 8.0, 1.3 Hz, 1H), 7.87 (dd, J = 8.2, 1.2 Hz, 1H), 7.66 (t, J = 1.7 Hz, 1H), 7.55 - 7.47 (m, 4H), 7.44 (td, J = 7.8, 1.4 Hz, 2H), 7.38 (td, J = 7.7, 1.3 Hz, 1H), 7.30 (q, J = 7.7 Hz, 2H), 5.10 - 5.04 (m, 1H), 3.64 - 3.40 (m, 6H), 3.39 - 3.32 (m, 1H), 3.15 - 2.96 (m, 3H).

[0001995] UPLC-MS (basic 2 mm): Rt = 1.03 mm, m/z = 533.3 [M+H] ⁺

[0001996] Step 6: 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(morpholine-4- carbonyl)phenyl]sulfonylamino]ethyl]-N'-hydroxy-benzamidine

[0001997] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-(morpholine-4-carbonyl)benzenesulfonami de (474 mg, 0.890 mmol, 1.0 eq.) in EtOH (5 mL) were added DIPEA (0.47 mL, 2.67 mmol, 3.0 eq.) and hydroxylamine hydrochloride (124 mg, 1.78 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 16 h, then concentrated to dryness to afford product (780 mg, 1.38 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification.

[0001998] UPLC-MS (basic 2 mm): Rt = 0.91 mm, m/z = 566.3 [M+H] ⁺

[0001999] Step 7: [amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(morpholine-4- carbonyl)phenyl]sulfonylamino]ethyl]phenyl]methylene]amino] acetate

[0002000] To a magnetically stirred solution of 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(morpholine- 4-carbonyl)phenyl]sulfonylamino]ethyl]-N'-hydroxy-benzamidin e (780 mg, 1.38 mmol, 1.0 eq.) in acetic acid (8 mb) was added acetic anhydride (0.65 mL, 6.89 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 17 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography over silica (40 g cartridge) eluting with 0-20% MeOH in DCM to afford product (456 mg, 0.750 mmol, 54% yield) as a yellow oil.

[0002001] UPLC-MS (basic 2 mm): Rt = 0.96 mm, m/z = 608.2 [M+H] ⁺

[0002002] 1H NMR (400 MHz, DMSO-d6) 5 9.04 (s, 1H), 7.99 (ddd, J = 7.9, 1.3, 0.6 Hz, 1H), 7.88 - 7.83 (m, 1H), 7.59 - 7.57 (m, 1H), 7.53 (t, J = 1.8 Hz, 1H), 7.50 - 7.46 (m, 1H), 7.43 (tt, J = 7.4, 1.3 Hz, 2H), 7.40 - 7.35 (m, 2H), 7.26 (d, J = 7.8 Hz, 1H), 7.25 - 7.21 (m, 1H), 7.12 (t, J = 7.7 Hz, 1H), 6.72 (s, 2H), 5.01 (s, 1H), 3.64 - 3.39 (m, 7H), 3.13 (s, 2H), 3.01 (dd, J = 13.9, 9.7 Hz, 2H), 2.12 - 2.09 (m, 3H).

[0002003] Step 8: 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(morpholine-4- carbonyl)phenyl]sulfonylamino]ethyl]benzamidine

[0002004] To a magnetically stirred solution of [amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- (morpholine-4-carbonyl)phenyl]sulfonylamino]ethyl]phenyl]met hylene]amino] acetate (456 mg, 0.750 mmol, 1.0 eq.) in acetic acid (5 mL) was added zinc (491 mg, 7.50 mmol, 10.0 eq.). The reaction mixture was stirred at RT for 17 h. The reaction mixture was filtered, washing with copious MeCN and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative HPLC on a Gemini NX C18 (30 mm x 150 mm, 5 um) eluting with 5-100% MeCN in water (0.2% v/v NH ₃ ) to afford the product (71.0 mg, 0.128 mmol, 17% yield) as a white solid.

[0002005] UPLC-MS (basic 18 mm): Rt = 6.49 mm, m/z = 549.0 [M+H] ⁺ , 99% purity.

[0002006] 1H NMR (400 MHz, DMSO-d6) 5 7.94 (d, J = 7.3 Hz, 1H), 7.86 - 7.82 (m, 1H), 7.75 - 7.71 (m, 1H), 7.54 - 7.50 (m, 2H), 7.50 - 7.48 (m, 1H), 7.43 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.38 (d, J = 7.7 Hz, 1H), 7.36 - 7.31 (m, 1H), 7.29 - 7.23 (m, 3H), 4.90 - 4.81 (m, 1H).

[0002007] 1H NMR- D ₂ O (400 MHz, DMSO-d6) 5 7.89 (d, J = 8.0 Hz, 1H), 7.81 (d, J = 8.1 Hz, 1H), 7.67 (s, 1H), 7.54 - 7.49 (m, 1H), 7.49 - 7.45 (m, 1H), 7.45 - 7.40 (m, 2H), 7.37 - 7.30 (m, 2H), 7.28 - 7.21 (m, 3H), 4.85 - 4.77 (m, 1H), 3.55 (s, 4H), 3.34 (s, 2H), 3.20 (dd, J = 13.4, 4.5 Hz, 1H), 3.01 (dd, J = 13.4, 8.7 Hz, 3H).

[0002008] Step 9: 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(morpholine-4- carbonyl)phenyl]sulfonylamino]ethyl]benzamidine

[0002009] 3 - [2-( 1 ,3 -benzothiazol-2-y l)-2- [ [3 -(morpholine-4- carbonyl)phenyl]sulfonylamino]ethyl]benzamidine (71.0 mg, 0.128 mmol, 1.0 eq.) was submitted to Reach for chiral purification via SFC on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the 1 ^st eluting enantiomer of the product (24.0 mg, 0.0428 mmol, 38% yield) as an white solid.

[0002010] UPLC-MS (basic 6 mm): Rt = 1.91 mm, m/z = 550.3 [M+H] ⁺ , 98% purity.

[0002011] 1H NMR (400 MHz, DMSO-d6) 5 7.94 - 7.90 (m, 1H), 7.84 (d, J = 7.9 Hz, 1H), 7.74 (d, J = 1.8 Hz, 1H), 7.55 - 7.49 (m, 2H), 7.48 (d, J = 2.1 Hz, 1H), 7.42 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.37 (d, J = 7.7 Hz, 1H), 7.33 (td, J = 7.6, 1.2 Hz, 1H), 7.29 - 7.23 (m, 3H), 5.76 (s, OH), 4.84 (dd, J = 8.7, 4.5 Hz, 1H), 3.02 (dd, J = 13.3, 8.8 Hz, 1H).

[0002012] 1H NMR - D2O (400 MHz, DMSO-d6) 5 7.87 (d, J = 7.9 Hz, 1H), 7.79 (d, J = 8.1 Hz, 1H), 7.63 (s, 1H), 7.52 - 7.47 (m, 1H), 7.47 - 7.41 (m, 2H), 7.40 - 7.37 (m, 1H), 7.37 - 7.29 (m, 2H), 7.27 - 7.20 (m, 3H), 4.75 (dd, J = 8.9, 4.4 Hz, 1H), 3.54 (s, 5H), 3.32 (s, 2H), 3.17 (dd, J = 13.3, 4.4 Hz, 1H), 2.99 (dd, J = 13.3, 8.8 Hz, 2H).

Example 102: Exemplary synthesis of Compound 252

[0002013] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002014] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (16.2 g, 55.8 mmol, 1.0 eq.) in toluene (300 mL) were added 2- aminothiophenol (6.6 mL, 61.4 mmol, 1.1 eq.), T3P (25.0 mL, 41.9 mmol, 0.75 eq.) and DIPEA (15.0 mL, 83.7 mmol, 1.5 eq.). The resulting mixture was stirred at 115 °C for 53 h. The reaction mixture was cooled to RT and concentrated to dryness. The residue was purified by normal phase column chromatography (330 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (9.55 g, 22.4 mmol, 40% yield) as a red solid.

[0002015] 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (d, J = 8.1 Hz, 1H), 7.89 (d, J = 8.9 Hz, 1H), 7.77 (s, 1H), 7.70 - 7.65 (m, 2H), 7.52 - 7.45 (m, 2H), 7.43 - 7.37 (m, 1H), 5.17 - 5.06 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.08 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 8H).

[0002016] UPLC-MS (basic 2 min): Rt = 1.23 min; m/z = 380.1 for [M+H] ⁺

[0002017] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002018] A magnetically stirred solution of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (9.55 g, 25.2 mmol, 1.0 eq.) in 4 N HC1 in 1,4-dioxane (50.0 mb, 200 mmol, 7.9 eq.) was stirred at RT for 18 h. The reaction mixture was then concentrated to dryness to afford the product (9.91 g, 25.4 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification.

[0002019] 1H NMR (400 MHz, DMSO-d6) 5 8.98 (s, 3H), 8.14 - 8.09 (m, 1H), 8.02 (d, J = 8.1 Hz, 1H), 7.80 - 7.76 (m, 1H), 7.73 - 7.68 (m, 1H), 7.54 (ddq, J = 8.3, 5.6, 1.7 Hz, 2H), 7.46 (tt, J = 7.7, 1.6 Hz, 2H), 5.30 (s, 1H), 3.46 (dd, J = 14.2, 6.4 Hz, 1H), 3.34 (dd, J = 13.9, 8.4 Hz, 1H).

[0002020] UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 280.0 for [M+H] ⁺

[0002021] Step 3: Methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate

[0002022] To a magnetically stirred solution of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (1.62 g, 5.13 mmol, 1.0 eq.) in DMF (15 mL) cooled to 0 °C was added tri ethylamine (2.1 mL, 15.4 mmol, 3.0 eq.) and the reaction mixture was stirred for 10 min. Methy 1-3 -chlorosulfonylbenzoate (1.44 g, 6.16 mmol, 1.2 eq.) was added portion wise over 10 min and the reaction mixture was allowed to warm to RT and stir for 2 h. The reaction was quenched via the addition of water (50 mL). The organics were extracted with ethyl acetate (100 mL), washed with water (2 x 50 mL) and dried over anhydrous sodium sulfate before filtering and concentrating to dryness. The residue was triturated with DCM, filtered and air dried. The filtrate was concentrated to dryness and triturated with DCM, filtered and air dried. The solids were combined to afford product (1.30 g, 2.72 mmol, 53% yield) as a white solid.

[0002023] 1H NMR analysis (400 MHz, DMSO-d6) 5 9.16 (d, J = 8.4 Hz, 1H), 8.07 (ddd, J = 8.0, 1.4, 0.7 Hz, 1H), 7.94 - 7.85 (m, 3H), 7.72 (ddd, J = 7.9, 2.0, 1.2 Hz, 1H), 7.61 (t, J = 1.7 Hz, 1H), 7.55 - 7.40 (m, 5H), 7.22 (t, J = 7.7 Hz, 1H), 5.07 (ddd, J = 10.8, 8.5, 4.3 Hz, 1H), 3.88 (s, 3H), 3.39 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.9 Hz, 1H)

[0002024] UPLC-MS (basic 2 mm) Rt = 1.12 mm. m/z = 478.2 for [M+H] ⁺

[0002025] Step 4: 3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulfamo yl]benzoic acid

[0002026] To a magnetically stirred suspension of methyl 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoate (1.30 g, 2.72 mmol, 1.0 eq.) in THF (23 mL) was added a solution of lithium hydroxide (0.342 g, 8.15 mmol, 3.0 eq.) in water (7 mL) and the resulting mixture was stirred at RT for 3 h. The reaction volume was reduced by half and the reaction was diluted with EtOAc (50 mL) and water (50 mL). The phases were separated, and the aqueous phase was acidified to pH 3 via the addition of 1 M HC1. The precipitate was collected by filtration, washing with water, and air dried to afford product (1.42 g, 3.07 mmol, assumed quantitative yield) as a white solid, which was used in the next step without further purification.

[0002027] 1H NMR analysis (400 MHz, DMSO-d6) 5 13.29 (s, 1H), 9.13 (d, J = 8.5 Hz, 1H), 8.08 (d, J = 7.9 Hz, 1H), 7.96 - 7.89 (m, 3H), 7.70 - 7.63 (m, 1H), 7.60(s, 1H), 7.51 (t, J = 8.3 Hz, 2H), 7.48 - 7.36 (m, 3H), 7.23 (t, J = 7.7 Hz, 1H), 5.11 - 5.00 (m, 1H), 3.40 (dd, J = 13.9, 4.4 Hz, 1H), 3.01 (dd, J = 13.9, 10.8 Hz, 1H)

[0002028] UPLC-MS (basic 2 mm) Rt = 0.82 mm. m/z = 464.2 for [M+H] ⁺

[0002029] Step 5: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-(morp holine-4- carbonyl)benzenesulfonamide

[0002030] To a magnetically stirred solution of 3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]benzoic acid (0.500 g, 1.08 mmol, 1.0 eq.) in DMF (5 mL) were added morpholine (0.11 mL, 1.29 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.24 mmol, 3.0 eq.) and HATU (0.620 g, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 120 h. The reaction mixture was diluted with EtOAc (25 mL) and washed with water (2 x 25 mL), brine (25 mL), aq. saturated Na ₂ CO ₃ (25 mL) and brine (25 mL). The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness to afford the product (0.420 g, 0.787 mmol, 73% yield) as an off-white solid that was used without further purification.

[0002031] 1H NMR (400 MHz, DMSO-d6) 5 9.04 (s, 1H), 8.01 (dd, J = 8.0, 1.3 Hz, 1H), 7.87 (dd, J = 8.2, 1.2 Hz, 1H), 7.66 (t, J = 1.7 Hz, 1H), 7.55 - 7.47 (m, 4H), 7.44 (td, J = 7.8, 1.4 Hz, 2H), 7.38 (td, J = 7.7, 1.3 Hz, 1H), 7.30 (q, J = 7.7 Hz, 2H), 5.10 - 5.04 (m, 1H), 3.64 - 3.40 (m, 6H), 3.39 - 3.32 (m, 1H), 3.15 - 2.96 (m, 3H).

[0002032] UPLC-MS (basic 2 mm): Rt = 1.03 mm, m/z = 533.3 [M+H] ⁺

[0002033] Step 6: 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(morpholine-4- carbonyl)phenyl]sulfonylamino]ethyl]-N'-hydroxy-benzamidine

[0002034] To a magnetically stirred solution of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]-3-(morpholine-4-carbonyl)benzenesulfonami de (474 mg, 0.890 mmol, 1.0 eq.) in EtOH (5 mL) were added DIPEA (0.47 mL, 2.67 mmol, 3.0 eq.) and hydroxylamine hydrochloride (124 mg, 1.78 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 16 h, then concentrated to dryness to afford product (780 mg, 1.38 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification.

[0002035] UPLC-MS (basic 2 mm): Rt = 0.91 mm, m/z = 566.3 [M+H] ⁺

[0002036] Step 7: [amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(morpholine-4- carbonyl)phenyl]sulfonylamino]ethyl]phenyl]methylene]amino] acetate

[0002037] To a magnetically stirred solution of 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(morpholine- 4-carbonyl)phenyl]sulfonylamino]ethyl]-N'-hydroxy-benzamidin e (780 mg, 1.38 mmol, 1.0 eq.) in acetic acid (8 mb) was added acetic anhydride (0.65 mL, 6.89 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 17 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography over silica (40 g cartridge) eluting with 0-20% MeOH in DCM to afford product (456 mg, 0.750 mmol, 54% yield) as a yellow oil.

[0002038] UPLC-MS (basic 2 mm): Rt = 0.96 mm, m/z = 608.2 [M+H] ⁺

[0002039] 1H NMR (400 MHz, DMSO-d6) 5 9.04 (s, 1H), 7.99 (ddd, J = 7.9, 1.3, 0.6 Hz, 1H), 7.88 - 7.83 (m, 1H), 7.59 - 7.57 (m, 1H), 7.53 (t, J = 1.8 Hz, 1H), 7.50 - 7.46 (m, 1H), 7.43 (tt, J = 7.4, 1.3 Hz, 2H), 7.40 - 7.35 (m, 2H), 7.26 (d, J = 7.8 Hz, 1H), 7.25 - 7.21 (m, 1H), 7.12 (t, J = 7.7 Hz, 1H), 6.72 (s, 2H), 5.01 (s, 1H), 3.64 - 3.39 (m, 7H), 3.13 (s, 2H), 3.01 (dd, J = 13.9, 9.7 Hz, 2H), 2.12 - 2.09 (m, 3H).

[0002040] Step 8: 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(morpholine-4- carbonyl)phenyl]sulfonylamino]ethyl]benzamidine

[0002041] To a magnetically stirred solution of [amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- (morpholine-4-carbonyl)phenyl]sulfonylamino]ethyl]phenyl]met hylene]amino] acetate (456 mg, 0.750 mmol, 1.0 eq.) in acetic acid (5 mL) was added zinc (491 mg, 7.50 mmol, 10.0 eq.). The reaction mixture was stirred at RT for 17 h. The reaction mixture was filtered, washing with copious MeCN and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative HPLC on a Gemini NX C18 (30 mm x 150 mm, 5 um) eluting with 5-100% MeCN in water (0.2% v/v NH ₃ ) to afford the product (71.0 mg, 0.128 mmol, 17% yield) as a white solid.

[0002042] UPLC-MS (basic 18 mm): Rt = 6.49 mm, m/z = 549.0 [M+H] ⁺ , 99% purity.

[0002043] 1H NMR (400 MHz, DMSO-d6) 5 7.94 (d, J = 7.3 Hz, 1H), 7.86 - 7.82 (m, 1H), 7.75 - 7.71 (m, 1H), 7.54 - 7.50 (m, 2H), 7.50 - 7.48 (m, 1H), 7.43 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.38 (d, J = 7.7 Hz, 1H), 7.36 - 7.31 (m, 1H), 7.29 - 7.23 (m, 3H), 4.90 - 4.81 (m, 1H).

[0002044] 1H NMR- D ₂ O (400 MHz, DMSO-d6) 5 7.89 (d, J = 8.0 Hz, 1H), 7.81 (d, J = 8.1 Hz, 1H), 7.67 (s, 1H), 7.54 - 7.49 (m, 1H), 7.49 - 7.45 (m, 1H), 7.45 - 7.40 (m, 2H), 7.37 - 7.30 (m, 2H), 7.28 - 7.21 (m, 3H), 4.85 - 4.77 (m, 1H), 3.55 (s, 4H), 3.34 (s, 2H), 3.20 (dd, J = 13.4, 4.5 Hz, 1H), 3.01 (dd, J = 13.4, 8.7 Hz, 3H).

[0002045] Step 9: 3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(morpholine-4- carbonyl)phenyl]sulfonylamino]ethyl]benzamidine

[0002046] 3 - [2-( 1 ,3 -benzothiazol-2-y l)-2- [ [3 -(morpholine-4- carbonyl)phenyl]sulfonylamino]ethyl]benzamidine (71.0 mg, 0.128 mmol) was submitted to Reach for chiral purification via SFC on a Lux C4 (21.2 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the 2 ^nd eluting enantiomer of the product (25.0 mg, 0.0450 mmol, 40% yield) as a white solid.

[0002047] UPLC-MS (basic 6 mm): Rt = 1.96 mm, m/z = 550.2 [M+H] ⁺ , 99% purity.

[0002048] 1H NMR (400 MHz, DMSO-d6) 5 7.90 - 7.86 (m, 1H), 7.80 (dt, J = 8.1, 1.0 Hz, 1H), 7.70 (d, J = 2.2 Hz, 1H), 7.51 - 7.46 (m, 2H), 7.44 (q, J = 1.3 Hz, 1H), 7.38 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.32 (d, J = 7.6 Hz, 1H), 7.28 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 7.25 - 7.19 (m, 3H), 5.72 (s, OH), 4.80 (dd, J = 8.7, 4.5 Hz, 1H), 3.21 (dd, J = 13.2, 4.5 Hz, 1H), 2.98 (dd, J = 13.3, 8.8 Hz, 1H).

[0002049] 1H NMR (400 MHz, DMSO-d6) 5 7.87 (dd, J = 8.1, 1.2 Hz, 1H), 7.80 (d, J = 7.7 Hz, 1H), 7.66 - 7.63 (m, 1H), 7.50 (ddd, J = 6.3, 3.0, 1.8 Hz, 1H), 7.48 - 7.43 (m, 1H), 7.42 - 7.39 (m, 2H), 7.36 - 7.29 (m, 2H), 7.27 - 7.20 (m, 3H), 4.75 (dd, J = 8.6, 4.5 Hz, 1H), 3.55 (s, 4H), 3.32 (s, 3H), 3.17 (dd, J = 13.3, 4.5 Hz, 1H), 2.99 (dd, J = 13.3, 8.6 Hz, 2H).

Example 103: Exemplary synthesis of Compound 277

[0002050] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002051] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (15.0 g, 51.7 mmol, 1.0 eq.) and 2-aminothiophenol (6.49 g, 51.7 mmol, 1.0 eq.) in toluene (304 mb) was added DIPEA (27.0 mL, 155 mmol, 3.0 eq.) and T3P (37.0 mL, 126 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 5 h. After cooling, the reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and the reaction was then diluted with ethyl acetate (300 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL) and brine (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (330 g cartridge), eluting with 0-40% EtOAc in DCM to afford the product (10.1 g, 26.6 mmol, 52% yield) as a yellow solid.

[0002052] UPLC-MS (basic 2 mm): Rt = 1.22 mm, m/z = 380.2 [M+H] ⁺

[0002053] 1H NMR (400 MHz, DMSO-d6) 5 8.12 - 8.07 (m, 1H), 7.98 (dt, J = 8.1, 1.1 Hz, 1H), 7.92 (d, J = 8.8 Hz, 1H), 7.81 (d, J = 1.8 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.48 (m, 3H), 7.44 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.16 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002054] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002055] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (10.1 g, 26.6 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (100 mL, 399 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated in vacuo to afford the product (9.92 g, 31.4 mmol, assumed quantitative yield) as a pink solid.

[0002056] UPLC-MS (basic 2 mm): Rt = 1.02 mm, m/z = 280.1 [M+H] ⁺

[0002057] 1H NMR (400 MHz, DMSO-d6) 5 9.02 (s, 3H), 8.15 (ddd, J = 8.0, 1.3, 0.6 Hz, 1H), 8.11 - 8.02 (m, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.74 (dt, J = 7.7, 1.4 Hz, 1H), 7.61 - 7.55 (m, 2H), 7.50 (td, J = 7.8, 1.7 Hz, 2H), 5.34 (s, 1H), 3.53 - 3.45 (m, 1H), 3.38 (dd, J = 13.9, 8.4 Hz, 1H).

[0002058] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002059] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile; hydrochloride (3.90 g, 12.3 mmol, 1.0 eq.) in DMF (40 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (5.2 mL, 37.0 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min. Then, 3 -nitrophenylsulfonyl chloride (3.28 g, 14.8 mmol, 1.2 eq.) was dissolved in 5 mL anhydrous DMF and added over a period of 10 min. The reaction was allowed to stir at the same temperature for 2 h before the reaction was slowly added to 200 mL water and 100 mL brine. After separation of the phases, the organics were washed with further water (2 x 250 mL), dried over Na ₂ SO ₄ , filtered and concentrated under vacuum. The residue was triturated with DCM and dried to obtain the product (2.60 g, 5.60 mmol, 45% yield) as an off-white solid.

[0002060] UPLC-MS (basic 2 mm): Rt = 1.11 mm, m/z = 465.1 [M+H] ⁺

[0002061] 1H NMR (400 MHz, DMSO-d6) 5 9.36 (s, 1H), 8.19 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.06 (m, 2H), 7.92 - 7.86 (m, 2H), 7.64 (d, J = 1.7 Hz, 1H), 7.60 (d, J = 8.0 Hz, 1H), 7.58 - .48 (m, 2H), 7.47 - 7.41 (m, 2H), 7.24 (t, J = 7.7 Hz, 1H), 5.22 - 5.13 (m, 1H), 3.41 (dd, J = 14.0, 4.4 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H)

[0002062] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002063] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (2.60 g, 5.60 mmol, 1.0 eq.), iron (3.13 g, 56.0 mmol, 10.0 eq.) and ammonium chloride (1.50 g, 28.0 mmol, 5.0 eq.) in ethanol (30 mL) and water (15 mL) was stirred at reflux, under a balloon of nitrogen, for 4 h. The reaction mixture was filtered through Celite, washing with ethanol and DCM and concentrated in vacuo. The residue was redissolved in ethyl acetate (250 mL) and diluted with sat. sodium hydrogen carbonate solution (250 mL). After separation of the phases, the organics were washed with further sat. sodium hydrogen carbonate (250 mL) and water (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was triturated with DCM to afford the product (1.95 g, 4.48 mmol, 80% yield) as a yellow solid.

[0002064] UPLC-MS (basic 2 mm): Rt = 1.06 mm; m/z = 435.3 for [M+H] ⁺

[0002065] 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 7.0 Hz, 1H), 8.09 (ddt, J = 7.9, 1.5, 0.7 Hz, 1H), 7.95 (dq, J = 8.0, 0.9 Hz, 1H), 7.60 - 7.39 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.58 (dddd, J = 8.5, 2.8, 2.0, 0.9 Hz, 2H), 5.41 (s, 2H), 4.89 (s, 1H), 3.40 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 9.9 Hz, 1H)

[0002066] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]benzamide

[0002067] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) were added benzoic acid (169 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.24 mmol, 3.0 eq.) and HATU (0.620 g, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 96 h. The reaction was concentrated to dryness to give a residue, which was purified by column chromatography over silica (40 g cartridge) eluting with 0-100% EtOAc in isohexane to afford the product (453 mg, 0.841 mmol, 73% yield) as an off-white solid.

[0002068] 1H NMR (400 MHz, DMSO-d6) 5 10.32 (s, 1H), 8.97 (d, J = 8.2 Hz, 1H), 8.08 - 8.01 (m, 2H), 7.97 - 7.89 (m, 3H), 7.78 (ddd, J = 8.1, 2.1, 1.1 Hz, 1H), 7.61 - 7.50 (m, 4H), 7.49 - 7.43 (m, 2H), 7.43 - 7.37 (m, 2H), 7.27 - 7.11 (m, 3H), 4.94 (ddd, J = 10.6, 8.2, 4.3 Hz, 1H), 3.36 (dd, J = 13.9, 4.4 Hz, 1H), 2.95 (dd, J = 13.9, 10.7 Hz, 1H).

[0002069] UPLC-MS (basic 2 mm): Rt = 1.15 mm, m/z = 539.2 [M+H] ⁺

[0002070] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]benzamide

[0002071] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]benzamide (453 mg, 0.841 mmol, 1.0 eq.) in ethanol (5 mL) were added DIPEA (0.44 mL, 2.52 mmol, 3.0 eq.) and hydroxylamine hydrochloride (117 mg, 1.68 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 23 h, then concentrated to dryness to afford product (738 mg, 1.29 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification.

[0002072] UPLC-MS (basic 2 mm): Rt = 1.04 mm, m/z = 572.3 [M+H] ⁺

[0002073] Step 7: [amino-[3-[2-[(3-benzamidophenyl)sulfonylamino]-2-(l,3-benzo thiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[0002074] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]benzamide (738 mg, 1.29 mmol, 1.0 eq.) in acetic acid (8 mb) was added acetic anhydride (0.37 mL, 3.87 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 18.5 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography over silica (40 g cartridge) eluting with 0-100% EtOAc in hexane to afford product (169 mg, 0.275 mmol, 21% yield) as a yellow oil.

[0002075] UPLC-MS (basic 2 mm): Rt = 1.08 mm, m/z = 614.3 [M+H] ⁺

[0002076] 1H NMR (400 MHz, DMSO-d6) 5 10.26 (s, 1H), 8.90 (d, J = 7.8 Hz, 1H), 8.04 (t, J = 2.0 Hz, 1H), 8.03 - 8.00 (m, 1H), 7.94 - 7.91 (m, 2H), 7.89 - 7.85 (m, 1H), 7.72 - 7.68 (m, 1H), 7.61 - 7.55 (m, 1H), 7.53 - 7.49 (m, 3H), 7.45 - 7.34 (m, 4H), 7.21 - 7.16 (m, 2H), 7.13 (dt, J = 8.0, 1.4 Hz, 1H), 7.06 (t, J = 7.7 Hz, 1H), 6.65 (s, 2H), 4.96 - 4.87 (m, 1H), 2.97 (dd, J = 13.9, 9.7 Hz, 1H), 2.08 (s, 3H).

[0002077] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]benzamide

[0002078] To a magnetically stirred solution of [amino- [3- [2- [(3- benzamidophenyl)sulfonylamino]-2-(l,3-benzothiazol-2-yl)ethy l]phenyl]methylene]amino] acetate (169 mg, 0.275 mmol, 1.0 eq.) in acetic acid (2 mL) was added zinc (180 mg, 2.75 mmol, 10.0 eq.). The reaction mixture was stirred at RT for 23 h. The reaction mixture was filtered, washing with copious MeCN and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative HPLC on a Cl XBridge BEH C18 (19 mm x 150 mm, 5 um) eluting with 30-100% MeCN in water (0.2% ammonium bicarbonate) to afford the product (79.0 mg, 0.138 mmol, 50% yield) as a white solid.

[0002079] UPLC-MS (acidic 6 mm): Rt = 2.55 mm, m/z = 556.2 [M+H] ⁺

[0002080] 1H NMR (400 MHz, DMSO-d6) 5 8.01 - 7.99 (m, 1H), 7.98 - 7.90 (m, 3H), 7.84 - 7.80 (m, 1H), 7.71 (dt, J = 6.9, 2.3 Hz, 1H), 7.62 - 7.54 (m, 2H), 7.53 - 7.48 (m, 2H), 7.45 -

[0002081] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002082] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (37.0 g, 105 mmol, 1.0 eq.) and 2-aminothiophenol (11.0 mL, 105 mmol, 1.0 eq.) in toluene (500 mL) was added DIPEA (55.0 mL, 315 mmol, 3.0 eq.) and T3P (50% in EtOAc, 75.0 mL, 126 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 4 h. After cooling, the reaction was then diluted with EtOAc (600 mb) and water (300 mL). After separation of the phases the organics were washed with water (500 mL) and brine (500 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (330 g cartridge), eluting with 0-50% EtOAc in DCM to afford the product (27.0 g, 71.1 mmol, 68% yield) as a yellow solid.

[0002083] UPLC-MS (basic 2 mm): Rt = 1.22 mm, m/z = 380.3 [M+H] ⁺

[0002084] 1H NMR (400 MHz, DMSO-d6) 5 8.09 (dd, J = 8.0, 1.3 Hz, 1H), 8.02 - 7.88 (m, 2H), 7.81 (t, J = 1.7 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.16 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002085] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002086] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (27.0 g, 71.1 mmol, 1.0 eq.) and 4 N HC1 in 1,4-di oxane (267 mL, 1.07 mol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated in vacuo and the resulting solid triturated with diethyl ether (20 mL) to afford the product (25.6 g, 81.1 mmol, assumed quantitative yield) as an off-white solid.

[0002087] UPLC-MS (basic 2 mm): Rt = 1.03 mm, m/z = 280.1 [M+H] ⁺

[0002088] 1H NMR (400 MHz, DMSO-d6) 5 8.0, 1.3, 0.7 Hz, 1H), 8.04 (ddt, J = 8.2, 1.2, 0.6 Hz, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.34 - 5.27 (m, 1H), 3.58 (dd, J = 13.9, 6.0 Hz, 1H), 3.56 (s, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H).

[0002089] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002090] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile; hydrochloride (7.70 g, 16.5 mmol, 1.0 eq.) in DMF (45 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (4.6 mL, 33.1 mmol, 2.0 eq.). The resulting mixture was stirred for 10 min. Then, 3 -nitrophenylsulfonyl chloride (3.28 g, 14.8 mmol, 1.2 eq.) was dissolved in 5 mL anhydrous DMF and added over a period of 10 min. The reaction was allowed to stir at the same temperature for 2 h before the reaction was slowly added to 100 mL ice water. The resulting precipitate was filtered off and washed with hexane (100 mL) to obtain the product (7.80 g, 7.69 mmol, assumed quantitative yield) as a yellow solid.

[0002091] UPLC-MS (basic 2 mm): Rt = 1.11 mm, m/z = 465.1 [M+H] ⁺

[0002092] 1H NMR (400 MHz, DMSO-d6) 5 9.36 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.92 - 7.84 (m, 2H), 7.67 - 7.39 (m, 6H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (dd, J = 10.9, 4.3 Hz, 1H), 3.42 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0002093] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002094] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (7.80 g, 13.4 mmol, 1.0 eq.), iron (7.50 g, 134 mmol, 10.0 eq.) and ammonium chloride (3.59 g, 67.2 mmol, 5.0 eq.) in ethanol (30 mL) and water (15 mL) was stirred at reflux, under a balloon of nitrogen, for 4.5 h. The reaction mixture was filtered through Celite, washing with ethanol and DCM and concentrated in vacuo. The residue was redissolved in ethyl acetate (250 mL) and diluted with sat. sodium hydrogen carbonate solution (250 mL). After separation of the phases, the organics were washed with further sat. sodium hydrogen carbonate (250 mL) and water (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was triturated with DCM to afford the product (4.30 g, 9.90 mmol, 74% yield) an off-white solid.

[0002095] UPLC-MS (basic 2 mm): Rt = 1.06 mm; m/z = 435.1 for [M+H] ⁺

[0002096] 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.12 - 8.05 (m, 1H), 7.98 - 7.91 (m, 1H), 7.60 - 7.39 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.62 - 6.54 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.9, 8.1, 4.9 Hz, 1H), 3.36 (dd, J = 13.8, 4.9 Hz, 1H), 2.98 (dd, J = 13.8, 9.9 Hz, 1H

[0002097] Step 5 : N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 -cyanophenyl) ethyl] sulfamoyl] phenyl] - 2-methyl-oxazole-4-carboxamide

[0002098] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) were added 2-methyl-l,3-oxazole-4-carboxylic acid (175 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.24 mmol, 3.0 eq.) and HATU (0.620 g, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 72 h. The reaction was concentrated to dryness to give a residue, which was purified by normal phase column chromatography (40 g cartridge) eluting with 0-100% EtOAc in isohexane to afford the product (462 mg, 0.850 mmol, 74% yield) as an off-white solid.

[0002099] 1H NMR (400 MHz, DMSO-d6) 5 10.20 (s, 1H), 8.94 (d, J = 8.2 Hz, 1H), 8.63 (s, 1H), 8.08 - 8.04 (m, 2H), 7.93 - 7.89 (m, 1H), 7.78 (ddd, J = 8.1, 2.1, 1.1 Hz, 1H), 7.56 - 7.52 (m, 1H), 7.49 - 7.36 (m, 4H), 7.21 (t, J = 8.0 Hz, 1H), 7.18 - 7.11 (m, 2H), 4.94 (ddd, J = 10.6, 8.2, 4.4 Hz, 1H), 3.35 (dd, J = 13.9, 4.4 Hz, 1H), 2.94 (dd, J = 13.8, 10.6 Hz, 1H), 2.50 (s, 3H).

[0002100] UPLC-MS (basic 2 mm): Rt = 1.09 mm, m/z = 544.2 [M+H] ⁺

[0002101] Step 6: A-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-2-methyl -oxazole-4-carboxamide

[0002102] To a magnetically stirred solution ofN-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]-2-methyl-oxazole-4-carbo xamide (595 mg, 1.09 mmol, 1.0 eq.) in ethanol (6 mL) were added DIPEA (0.57 mL, 3.28 mmol, 3.0 eq.) and hydroxylamine hydrochloride (152 mg, 2.19 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 19 h, then further DIPEA (0.25 mL, 1.44 mmol, 1.3 eq.) and hydroxylamine hydrochloride (75 mg, 1.08 mmol, 0.99 eq.) were added. After a further 5 h the reaction was concentrated to dryness to afford product (1.15 g, 2.00 mmol, assumed quantitative yield), as a white solid, which was used in the next step without further purification.

[0002103] UPLC-MS (basic 2 mm): Rt = 0.98 mm, m/z = 577.2 [M+H] ⁺

[0002104] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[(2-methyloxazol e-4- carbonyl)amino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate

[0002105] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-2-methyl -oxazole-4-carboxamide (1.15 g, 2.00 mmol, 1.0 eq.) in acetic acid (12 mL) was added acetic anhydride (0.57 mL, 5.99 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 17 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography over silica (40 g cartridge) eluting with 0-100% EtOAc in hexane to afford product (298 mg, 0.482 mmol, 24% yield) as a white solid.

[0002106] UPLC-MS (basic 2 mm): Rt = 1.02 mm, m/z = 619.3 [M+H] ⁺

[0002107] 1H NMR (400 MHz, DMSO-d6) 5 10.12 (s, 1H), 8.89 (s, 1H), 8.61 (s, 1H), 8.12 (t, J = 1.9 Hz, 1H), 8.03 - 7.99 (m, 1H), 7.90 - 7.85 (m, 1H), 7.71 (dt, J = 8.1, 1.6 Hz, 1H), 7.52 (t, J = 1.9 Hz, 1H), 7.46 - 7.40 (m, 1H), 7.40 - 7.34 (m, 2H), 7.19 - 7.09 (m, 3H), 7.03 (t, J = 7.7 Hz, 1H), 6.62 (s, 2H), 4.91 (s, 1H), 2.96 (dd, J = 13.8, 9.7 Hz, 1H), 2.49 (s, 3H), 2.09 (s, 3H).

[0002108] Step 8: A-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylpheny l)ethyl] sulfamoyl] phenyl] -2-methyl-oxazole-4-carboxami de

[0002109] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- [(2-methyloxazole-4-carbonyl)amino]phenyl]sulfonylamino]ethy l]phenyl]methylene]amino] acetate (298 mg, 0.482 mmol, 1.0 eq.) in acetic acid (4 mL) was added zinc (315 mg, 4.82 mmol, 10.0 eq.). The reaction mixture was stirred at RT for 21 h. The reaction mixture was filtered, washing with copious MeCN and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative HPLC on a Cl XBridge BEH C18 (19 mm x 150 mm, 5 um) eluting with 30-100% MeCN in water (0.1% ammonium hydroxide) to afford the product (53.0 mg, 0.089 mmol, 18% yield) as an off-white solid.

[0002110] UPLC-MS (basic 6 mm): Rt = 0.91 mm, m/z = 561.3 [M+H] ⁺

[0002111] 1H NMR (400 MHz, DMSO-d6) 5 8.61 (s, 1H), 8.07 - 8.03 (m, 1H), 7.96 (dd, J = 7.9, 1.3 Hz, 1H), 7.86 - 7.81 (m, 1H), 7.65 (td, J = 4.5, 2.2 Hz, 1H),7.6O (s, 1H), 7.44 - 7.37 (m, 2H), 7.35 - 7.29 (m, 1H), 7.22 (d, J = 7.6 Hz, 1H), 7.15 - 7.05 (m, 3H), 4.83 (dd, J = 8.9, 4.9 Hz, 1H), 3.22 (dd, J = 13.5, 4.9 Hz, 1H), 2.97 (dd, J = 13.5, 8.9 Hz, 1H), 2.49 (s, 3H).

[0002112] 1H NMR-D20 (400 MHz, DMSO-d6) 5 8.53 (d, J = 1.6 Hz, 1H), 7.95 - 7.89 (m, 2H), 7.81 (d, J = 8.0 Hz, 1H), 7.57 (ddd, J = 8.2, 4.3, 2.1 Hz, 2H), 7.42 - 7.36 (m, 2H), 7.31 (td, J = 7.7, 1.2 Hz, 1H), 7.23 (d, J = 7.7 Hz, 1H), 7.16 - 7.04 (m, 3H), 4.78 (dd, J = 9.0, 4.7 Hz, 1H), 3.19 (dd, J = 13.5, 4.6 Hz, 1H), 2.95 (dd, J = 13.5, 9.1 Hz, 1H).

Example 105: Exemplary synthesis of Compound 279

[0002113] Step 1: tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-oxo-ethyl]carbamate

[0002114] To a stirred solution of 2-(tert-butoxycarbonylamino)-3-(3-cyanophenyl)propanoic acid (17.00 g, 58.6 mmol, 1.0 eq.) in DMF (140 mL) was added DIPEA (31 mL, 176 mmol, 3.0 eq.), ammonium chloride (7.83 g, 146 mmol, 2.5 eq.) and HATU (33.40 g, 87.8 mmol, 1.5 eq.) and the resultant solution was stirred at RT for 1.5 h. The reaction mixture was quenched with ice-cold water and the precipitated solid was filtered off. The residue was dried overnight in a vacuum oven to afford product (17.28 g, 59.7 mmol, assumed quantitative yield) as an off-white solid.

[0002115] ¹ H NMR (400 MHz, DMSO-d6) 5 7.70 - 7.65 (m, 2H), 7.63 - 7.59 (m, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.39 (s, 1H), 7.06 (s, 1H), 6.90 (d, J = 9.1 Hz, 1H), 4.11 (td, J = 10.4, 4.1 Hz, 1H), 3.03 (dd, J = 13.8, 4.1 Hz, 1H), 2.76 (dd, J = 13.5, 10.3 Hz, 1H), 1.28 (s, 9H).

[0002116] UPLC-MS (basic 2 mm): Rt = 0.90 mm; m/z = 288.1 for [M+H] ⁺

[0002117] Step 2: tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-thioxo-ethyl]carbamat e

[0002118] To a magnetically stirred solution of tert-butyl N-[2-amino-l-[(3- cyanophenyl)methyl]-2-oxo-ethyl] carbamate (17.28 g, 59.7 mmol, 1.0 eq.) in THF (200 mL) was added Lawesson reagent (28.99 g, 71.7 mmol, 1.2 eq.) and the resultant mixture stirred at RT for 20 h. The reaction mixture was filtered and the filtrate was concentrated in vacuo. The residue was suspended in EtOAc (200 mL) and aq. saturated Na ₂ CO ₃ solution (400 mL). The organics were extracted with EtOAc (3 x 200 mL) and after separation of the phases, the organics were washed with brine (200 mL), dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo. The residue was purified by normal phase column chromatography (330 g cartridge) eluting with 0- 30% EtOAc in DCM to afford the product (7.96 g, 26.0 mmol, 44% yield) as a yellow solid.

[0002119] ¹ H NMR analysis (400 MHz, DMSO-d6) 5 9.64 (s, 1H), 9.28 - 9.23 (m, 1H), 7.74 (s, 1H), 7.68 (d, J = 7.7 Hz, 1H), 7.64 (d, J = 7.9 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 6.92 (d, J = 8.9 Hz, 1H), 4.43 (td, J = 9.5, 4.4 Hz, 1H), 3.04 (dd, J = 13.4, 4.8 Hz, 1H), 2.85 (dd, J = 13.5, 9.9 Hz, 1H), 1.29 (s, 9H).

[0002120] UPLC-MS (basic 4 mm): Rt = 1.59 mm; m/z = 306.2 for [M+H] ⁺

[0002121] Step 3: tert-butyl N-[2-(3-cyanophenyl)-l-(4-hydroxy-4,5-dihydrothiazol-2- y 1) ethyl] carbamate

[0002122] Bromoacetaldehyde diethylacetal (15.40 g, 78.1 mmol, 3.0 eq.) in water (40 mL) was hydrolyzed by stirring with concentrated hydrogen chloride solution (5.4 mL, 156 mmol, 6.0 eq.) at 60 °C for 30 min. The mixture was cooled to RT and added to a magnetically stirred suspension of sodium hydrogen carbonate (21.9 g, 260 mmol, 10.0 eq.) in THF (120 mL) and stirred for 15 min. Then tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-thioxo- ethyl] carbamate (7.96 g, 26.0 mmol, 1.0 eq.) was added and stirred for 18 h at RT. The reaction was diluted in EtOAc (200 mL) and water (200 mL). After separation of the phases, the organics were washed with saturated brine solution (200 mL), dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo. The residue was dried in the vacuum overnight to afford the product (8.45 g, 24.3 mmol, 93% yield) as a beige solid.

[0002123] ¹ H NMR (400 MHz, DMSO-d6) 5 7.69 (d, J = 6.0 Hz, 2H), 7.67 - 7.65 (m, 1H), 7.61 (d, J = 7.9 Hz, 1H), 7.50 (q, J = 7.8 Hz, 2H), 7.44 (d, J = 9.1 Hz, 1H), 6.41 (d, J = 6.0 Hz, 1H), 5.96 - 5.89 (m, 1H), 4.56 - 4.49 (m, 1H), 3.48 - 3.42 (m, 2H), 3.23 (dd, J = 13.7, 4.2 Hz, 1H), 2.98 - 2.93 (m, 1H), 2.89 (dd, J = 13.7, 11.1 Hz, 1H), 1.27 (s, 9H).

[0002124] UPLC-MS (basic 2 mm): Rt = 0.97 mm; m/z = 348.2 for [M+H] ⁺ ; Rt = 1.09 mm; m/z = 330.2 for [M+H] ⁺ (product obtained as a mixture of desired material and dehydrated material)

[0002125] Step 4: 3-(2-amino-2-thiazol-2-yl-ethyl)benzonitrile hydrochloride

[0002126] To a stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(4-hydroxy-4,5- dihydrothiazol-2-yl)ethyl]carbamate (8.45 g, 24.3 mmol, 1.0 eq.) in 1,4-dioxane (250 mL) was slowly added hydrogen chloride solution (25.0 mL, 720 mmol, 29.6 eq.) with the resulting mixture being stirred at RT for 3 h. The reaction mixture was concentrated, dissolved in 1 ,4- dioxane (150 mL), redosed with hydrogen chloride solution (25.0 mL, 720 mmol, 29.6 eq.) and stirred at RT for 96 h. The mixture was diluted with excess Et ₂ O, and the precipitate that formed was collected by filtration, washed with copious Et ₂ O and dried in vacuo to afford the product (6.27 g, 23.6 mmol, 97% yield) as a light brown solid.

[0002127] ¹ H NMR (400 MHz, DMSO-d6) 5 8.86 (s, 3H), 7.90 (d, J = 3.2 Hz, 1H), 7.79 (d, J = 3.3 Hz, 1H), 7.72 (ddd, J = 6.1, 2.7, 1.6 Hz, 1H), 7.69 (p, J = 1.6 Hz, 1H), 7.53 - 7.47 (m, 2H), 5.23 - 5.15 (m, 1H), 3.44 (dd, J = 13.8, 6.2 Hz, 1H), 3.29 (dd, J = 13.7, 8.7 Hz, 1H).

[0002128] UPLC-MS (basic 2 mm): Rt = 0.84 mm; m/z = 230.2 for [M+H] ⁺

[0002129] Step 5: Methyl 3-[[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]sulfamoyl]benzoat e

[0002130] To a solution of 3-(2-amino-2-thiazol-2-yl-ethyl)benzonitrile hydrochloride (3.30 g, 12.5 mmol, 1.0 eq.) in DMF (15 mL), which was cooled to 0 °C and under a balloon of nitrogen, was added triethylamine (5.2 mL, 37.3 mmol, 3.0 eq.). The resulting mixture was then stirred for 10 min before the portion wise addition of methyl 3-(chlorosulfonyl)benzoate (3.51 g, 14.9 mmol, 1.2 eq.) over a 10 min period. The reaction was allowed to stir at the same temperature for 1 h before being allowed to warm to RT and stirred for 16 h. The reaction was slowly added to 40 mL ice water mixture and the precipitated sticky, tar-like solid was filtered off and washed with hexane. The crude was dissolved in DCM and upon addition of iso-hexane, a solid precipitated out which was collected by filtration to afford product (2.30 g, 5.38 mmol, 43% yield) as a brown solid.

[0002131] ¹ H NMR (400 MHz, DMSO-d6) 5 9.02 (d, J = 8.5 Hz, 1H), 8.01 (dt, J = 7.8, 1.4 Hz, 1H), 7.89 (t, J = 1.8 Hz, 1H), 7.72 - 7.69 (m, 2H), 7.63 (d, J = 3.2 Hz, 1H), 7.53 (d, J = 1.7 Hz, 1H), 7.51 - 7.47 (m, 1H), 7.45 (dt, J = 7.7, 1.4 Hz, 1H), 7.41 (dt, J = 7.8, 1.4 Hz, 1H), 7.20 (t, J = 7.7 Hz, 1H), 4.94 (ddd, J = 10.7, 8.5, 4.4 Hz, 1H), 3.91 (s, 3H), 3.28 (d, J = 4.4 Hz, 1H), 2.95 - 2.89 (m, 1H). - residual DMF (1.17% by weight) and DCM (0.81% by weight)

[0002132] UPLC-MS (basic 2 mm): Rt = 1.04 mm; m/z = 428.1 for [M+H]

[0002134] Step 6: 3-[[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]sulfamoyl]benzoic acid

[0002135] To a magnetically stirred suspension of methyl 3-[[2-(3-cyanophenyl)-l-thiazol-2- yl-ethyl]sulfamoyl]benzoate (2.73 g, 6.39 mmol, 1.0 eq.) in THF (50 mL) was added a solution of lithium hydroxide (804 mg, 19.2 mmol, 3.0 eq.) in water (15 mL) and the resultant solution was stirred at RT for 16 h. The reaction mixture was diluted with EtOAc (50 mL) and water (50 mL) and the phases separated. The aqueous phase was acidified with 1 M HC1 and the precipitate filtered and dried in air, before being dried overnight in the vacuum oven, to afford the product (2.07 g, 5.01 mmol, 78% yield) as a brown solid.

[0002136] ¹ H NMR (400 MHz, DMSO-d6) 5 13.34 (s, 1H), 8.97 (d, J = 8.5 Hz, 1H), 7.99 (dt, J = 7.7, 1.3 Hz, 1H), 7.93 (t, J = 1.6 Hz, 1H), 7.68 (d, J = 3.2 Hz, 1H), 7.67 - 7.65 (m, 1H), 7.61 (d, J = 3.2 Hz, 1H), 7.54 (t, J = 1.9 Hz, 1H), 7.48 - 7.42 (m, 3H), 7.23 (t, J = 7.7 Hz, 1H), 4.94 (ddd, J = 10.6, 8.6, 4.6 Hz, 1H), 3.28 (d, J = 4.3 Hz, 1H), 2.93 (dd, J = 13.9, 10.5 Hz, 1H).

[0002137] UPLC-MS (basic 2 mm): Rt = 0.73 mm; m/z = 414.2 for [M+H] ⁺

[0002138] Step 7: tert-butyl N-[2-[[3-[[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] benzoyl] amino] ethyl] carbamate

[0002139] To a magnetically stirred solution of 3-[[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] benzoic acid (0.50 g, 1.21 mmol, 1.0 eq.) in DMF (10 mL) was added added tert-butyl N-(2-aminoethyl)carbamate (0.23 mL, 1.45 mmol, 1.2 eq.) and DIPEA (0.63 mL, 3.63 mmol, 3.0 eq. ), shortly followed by HATU (690 mg, 1.81 mmol, 1.5 eq. ) and left to stir at RT for 1.5 h. The reaction mixture was diluted with EtOAc (30 mL), washed with brine (30 mL), saturated Na ₂ CO ₃ solution (30 mL), and brine again (30 mL). The organics were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to afford the product (712 mg, 1.28 mmol, assumed quantitative yield) as a beige foam.

[0002140] ¹ H NMR (400 MHz, DMSO-d6) 5 8.91 (d, J = 8.5 Hz, 1H), 8.63 - 8.56 (m, 1H), 7.94 - 7.90 (m, 2H), 7.70 (dd, J = 3.2, 0.7 Hz, 1H), 7.62 (dd, J = 3.2, 0.7 Hz, 1H), 7.58 - 7.54 (m, 1H), 7.51 (t, J = 1.8 Hz, 1H), 7.42 (ddd, J = 7.7, 4.7, 3.0 Hz, 3H), 7.18 (t, J = 7.7 Hz, 1H),

6.92 (t, J = 5.6 Hz, 1H), 5.00 - 4.90 (m, 1H), 3.30 - 3.27 (m, 1H), 3.16 - 3.11 (m, 2H), 2.93 - 2.89 (m, 2H), 2.87 (s, 1H), 1.37 (s, 9H).

[0002141] UPLC-MS (basic 2 min): Rt = 1.02 min; m/z = 556.3 for [M+H] ⁺

[0002142] Step 8: tert-butyl N-[2-[[3-[[2-[3-[(E)-N'-hydroxycarbamimidoyl]phenyl]-l-thiaz ol- 2-yl-ethy 1] sulfamoyl] benzoyl] amino] ethyl] carbamat

[0002143] To a magnetically stirred solution of tert-butyl N-[2-[[3-[[2-(3-cyanophenyl)-l- thiazol-2-yl-ethyl]sulfamoyl]benzoyl]amino]ethyl]carbamate (712 mg, 1.28 mmol, 1.0 eq.) in ethanol (10 mL) was added hydroxylammonium chloride (178 mg, 2.56 mmol, 2.0 eq.) and DIPEA (0.67 mL, 3.84 mmol, 3.0 eq.) with the resultant mixture stirred at 85 °C for 18 h. The mixture was cooled to RT and concentrated to dryness under reduced pressure to afford the product (754 mg, 1.28 mmol, assumed quantitative yield) as an orange/brown oil

[0002144] UPLC-MS (basic 2 mm): Rt = 0.92 mm; m/z = 589.3 for [M+H] ⁺

[0002145] Step 9: [(E)- [amino- [3- [2- [[3- [2-(tert- butoxycarbonylamino)ethylcarbamoyl] phenyl] sulfonylamino] -2-thiazol-2-yl- ethyl]phenyl]methylene]amino] acetate

[0002146] To a magnetically stirred solution of tert-butyl N-[2-[[3-[[2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]-l-thiazol-2-yl-ethyl]sulfamoyl] benzoyl]amino]ethyl]carbamate (754 mg, 1.28 mmol, 1.0 eq.) in acetic acid (8 mL) was added acetic anhydride (0.36 mL, 3.84 mmol, 3.0 eq.). The reaction was left to stir at RT for 1 h. The reaction mixture was concentrated to dryness under reduced pressure and the residue was purified by normal-phase column chromatography over silica (24 g cartridge) eluting with 80-100% EtOAc in DCM to afford the product (554 mg, 0.878 mmol, 69% yield) as a white solid.

[0002147] ¹ H NMR (400 MHz, DMSO-d6) 5 8.87 (d, J = 8.4 Hz, 1H), 8.60 (t, J = 5.5 Hz, 1H),

7.93 (s, 1H), 7.86 (d, J = 7.8 Hz, 1H), 7.65 (dd, J = 3.2, 0.9 Hz, 1H), 7.59 - 7.51 (m, 2H), 7.46 (s, 1H), 7.42 - 7.33 (m, 2H), 7.18 (d, J = 7.6 Hz, 1H), 7.08 (t, J = 7.7 Hz, 1H), 6.91 (t, 1H), 6.69 (s,

2H), 4.93 - 4.85 (m, 1H), 3.32 - 3.28 (m, 2H), 3.23 (dd, J = 13.8, 5.3 Hz, 1H), 3.13 (q, J = 6.3 Hz, 2H), 2.90 (dd, 1H), 2.16 (d, J = 0.9 Hz, 3H), 1.37 (d, J = 0.9 Hz, 9H).

[0002148] UPLC-MS (basic 2 min): Rt = 0.96 min; m/z = 631.3 for [M+H] ⁺

[0002149] Step 10: tert-butyl N-[2-[[3-[[2-(3-carbamimidoylphenyl)-l-thiazol-2-yl- ethyl]sulfamoyl]benzoyl]amino]ethyl]carbamate

[0002150] A mixture [(E)-[amino-[3-[2-[[3-[2-(tert- butoxycarbonylamino)ethylcarbamoyl] phenyl] sulfonylamino] -2-thiazol-2-yl- ethyl]phenyl]methylene]amino] acetate (554 mg, 0.878 mmol, 1.0 eq.) and zinc (1.15 g, 17.6 mmol, 20.0 eq.) in acetic acid (8.8 mL) was stirred at RT for 20 h. The reaction mixture was filtered through Celite, washing with copious ethanol, acetonitrile and DCM before concentrating in vacuo. The residue was purified via reverse phase preparative HPLC (Cl XBridge BEH C18, 19 mm x 150 mm, 5 um) eluting with 5-100% MeCN:water (10 mM ammonium bicarbonate) to afford the product (175 mg, 0.306 mmol, 35% yield) as a white solid.

[0002151] UPLC-MS (basic 6 mm): Rt = 2.13 mm; m/z = 573.3 for [M+H] ⁺ , 97% purity.

[0002152] Setp 11: N-(2-aminoethyl)-3-[[2-(3-carbamimidoylphenyl)-l-thiazol-2-y l- ethyl]sulfamoyl]benzamide

[0002153] To tert-butyl N-[2-[[3-[[2-(3-carbamimidoylphenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] benzoyl] amino] ethyl] carbamate (175 mg, 0.306 mmol, 1.0 eq.) was added hydrogen chloride 4 N in 1,4-dioxane (1.0 mL, 4.00 mmol, 13.1 eq.) and the resultant suspension was stirred at RT for 16 h before being concentrated to dryness. The residue was suspended in MeCN/water and concentrated to dryness, then dried in a vacuum oven to afford the product (168 mg, 0.308 mmol, assumed quantitative yield) as a beige solid.

[0002154] ¹ H NMR (400 MHz, DMSO-d6) 5 9.27 (s, 2H), 9.17 (s, 2H), 8.97 (t, 1H), 8.93 (d, J = 8.4 Hz, 1H), 8.18 (s, 3H), 8.03 (dt, J = 7.3, 1.6 Hz, 2H), 7.70 (d, J = 3.3 Hz, 2H), 7.61 (d, J = 3.3 Hz, 1H), 7.57 (dd, J = 1.9, 1.0 Hz, 1H), 7.55 (t, J = 1.5 Hz, 1H), 7.43 - 7.35 (m, 2H), 7.20 (t,

J = 7.7 Hz, 1H), 5.01 (ddd, J = 10.0, 8.3, 4.9 Hz, 1H), 3.61 - 3.52 (m, 2H), 3.32 (dd, J = 13.9, 4.9

Hz, 1H), 3.03 (q, J = 5.9 Hz, 2H), 2.96 (dd, J = 13.9, 10.0 Hz, 1H).

[0002155] UPLC-MS (basic 6 min): rt = 1.08 min; m/z = 473.3 for [M+H] ⁺ , 98% purity.

Example 106: Exemplary synthesis of Compound 280

[0002156] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002157] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (13.6 g, 46.8 mmol, 1.0 eq.) and 2-aminothiophenol (5.87 g, 46.8 mmol, 1.0 eq.) in toluene (276 mL) was added DIPEA (24.0 mL, 141 mmol, 3.0 eq.) and T3P (33.0 mL, 56.2 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 4 h. After cooling, the reaction was quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and the reaction was then diluted with ethyl acetate (500 mL) and water (250 mL). After separation of the phases, the organics were washed with water (500 mL) and brine (500 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (330 g cartridge), eluting with 0-50% EtOAc in DCM to afford the product (8.70 g, 22.9 mmol, 49% yield) as a yellow solid.

[0002158] UPLC-MS (basic 2 mm): Rt = 1.22 mm, m/z = 380.3 [M+H] ⁺

[0002159] 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 8.2 Hz, 1H), 7.98 (ddd, J = 8.1, 1.2, 0.6 Hz, 1H), 7.92 (d, J = 8.9 Hz, 1H), 7.81 (s, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.52 (ddt, J = 7.9, 7.2, 2.0 Hz, 2H), 7.44 (ddd, J = 8.4, 7.4, 1.2 Hz, 1H), 5.22 - 5.11 (m, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002160] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002161] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (27.0 g, 71.1 mmol, 1.0 eq.) and 4 N HC1 in 1,4-di oxane (267 mL, 1.07 mol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated in vacuo and the resulting solid was triturated with diethyl ether (20 mL) to afford the product (25.6 g, 81.1 mmol, assumed quantitative yield) as an off-white solid.

[0002162] UPLC-MS (basic 2 mm): Rt = 1.03 mm, m/z = 280.1 [M+H] ⁺

[0002163] 1H NMR (400 MHz, DMSO-d6) 5 9.20 (d, J = 4.6 Hz, 3H), 8.14 (ddd, J = 8.0, 1.3, 0.7 Hz, 1H), 8.04 (ddt, J = 8.2, 1.2, 0.6 Hz, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.34 - 5.27 (m, 1H), 3.58 (dd, J = 13.9, 6.0 Hz, 1H), 3.56 (s, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H).

[0002164] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002165] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile; hydrochloride (6.00 g, 19.0 mmol, 1.0 eq.) in DMF (60 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (5.3 mL, 38.0 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min. Then, 3 -nitrophenylsulfonyl chloride (5.05 g, 22.8 mmol, 1.2 eq.) was dissolved in 5 mL anhydrous DMF and added over a period of 10 min. The reaction was allowed to stir at the same temperature for 30 min before stirring at room temperature for 2 h. The reaction was slowly added to 100 mL ice water and extracted with EtOAc (100 mL). The organics were separated and washed with water (100 mL) and brine (100 mL), dried over Na ₂ SO ₄ , filtered and concentrated under vacuum. The residue was triturated with DCM/hexane and dried to obtain the product (9.10 g, 19.6 mmol, assumed quantitative yield) as a yellow solid.

[0002166] UPLC-MS (basic 2 mm): Rt = 1.10 mm, m/z = 465.1 [M+H] ⁺

[0002167] 1H NMR (400 MHz, DMSO-d6) 5 9.33 (s, 1H), 8.15 (ddt, J = 8.3, 2.3, 1.1 Hz, 1H), 8.08 - 8.00 (m, 2H), 7.87 - 7.80 (m, 2H), 7.62 - 7.33 (m, 6H), 7.20 (dd, J = 8.2, 7.2 Hz, 1H), 5.12 (dd, J = 10.7, 4.3 Hz, 1H), 3.37 (dd, J = 13.9, 4.5 Hz, 1H), 3.00 (dd, J = 13.7, 10.7 Hz, 1H).

[0002168] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002169] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (9.10 g, 15.7 mmol, 1.0 eq.), iron (8.75 g, 157 mmol, 10.0 eq.) and ammonium chloride (4.19 g, 78.4 mmol, 5.0 eq.) in ethanol (90 mL) and water (20 mL) was stirred at reflux, under a balloon of nitrogen, for 4.5 h. The reaction mixture was filtered through Celite, washing with ethanol and DCM and concentrated in vacuo. The residue was redissolved in ethyl acetate (250 mL) and diluted with sat. sodium hydrogen carbonate solution (250 mL). After separation of the phases, the organics were washed with further sat. sodium hydrogen carbonate (250 mL) and water (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was triturated with DCM to afford the product (4.06 g, 9.34 mmol, 60% yield) as a yellow solid.

[0002170] UPLC-MS (basic 2 mm): Rt = 1.06 mm; m/z = 435.1 for [M+H] ⁺

[0002171] Step 5: 1H NMR (400 MHz, DMSO-d6) 5 8.68 (d, J = 7.1 Hz, 1H), 8.08 - 8.01 (m, 1H), 7.94 - 7.87 (m, 1H), 7.54 - 7.37 (m, 5H), 7.29 (t, J = 7.7 Hz, 1H), 6.88 (t, J = 7.9 Hz, 1H), 6.69 (t, J = 2.1 Hz, 1H), 6.54 (dt, J = 7.7, 2.2 Hz, 2H), 5.36 (s, 2H), 4.85 (s, 1H), 3.37 - 3.29 (m, 1H), 2.94 (dd, J = 13.8, 9.9 Hz, 1H).

[0002172] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]tetrahydropyran-4-carboxa mide

[0002173] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added tetrahydropyran-4-carboxylic acid (180 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.56 mL, 3.24 mmol, 3.0 eq.) and HATU (0.620 g, 1.62 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 20 h. The reaction was concentrated to dryness, dissolved in EtOAc (40 mL) and washed with water (2 x 40 mL), saturated Na ₂ CO ₃ solution (40 mL) and saturated brine solution (40 mL). The phases were separated, and the organics were dried over Na ₂ SO ₄ , filtered and concentrated in vacuo to afford the product (636 mg, 1.16 mmol, assumed quantitative yield) as an off-white solid.

[0002174] 1H NMR (400 MHz, DMSO-d6) 5 9.97 (s, 1H), 8.92 (d, J = 8.3 Hz, 1H), 8.08 - 8.02 (m, 1H), 7.93 - 7.88 (m, 1H), 7.82 (t, J = 2.0 Hz, 1H), 7.53 - 7.37 (m, 6H), 7.17 (td, J = 7.8, 1.7 Hz, 2H), 7.11 - 7.06 (m, 1H), 4.89 (ddd, J = 10.6, 8.2, 4.3 Hz, 1H), 3.89 (dt, J = 11.5, 2.6 Hz, 2H), 3.33 (td, J = 11.7, 3.2 Hz, 3H), 2.93 (dd, J = 13.9, 10.7 Hz, 1H), 2.56 (tt, J = 11.0, 4.4 Hz, 1H), 1.74 - 1.58 (m, 3H).

[0002175] UPLC-MS (basic 2 mm): Rt = 1.05 mm, m/z = 547.2 [M+H]

[0002176] Step 7: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-2V- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]benzamide

[0002177] To a magnetically stirred solution ofN-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]tetrahydropyran-4-carboxa mide (636 mg, 1.16 mmol, 1.0 eq.) in ethanol (10 mL) were added DIPEA (0.61 mL, 3.49 mmol, 3.0 eq.) and hydroxylamine hydrochloride (162 mg, 2.33 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 26 h, then concentrated to dryness to afford product (1.22 g, 2.10 mmol, assumed quantitative yield), as a yellow gum, which was used in the next step without further purification.

[0002178] UPLC-MS (basic 2 mm): Rt = 0.94 mm, m/z = 580.3 [M+H] ⁺

[0002179] Step 8: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(tetrahydropyran -4- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate

[0002180] To a magnetically stirred solution ofN-[3-[[ l -(1 ,3-benzothiazol-2-yl)-2-[3-[(E)-N- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]tetrahydr opyran-4-carboxamide (1.22 g, 2.10 mmol, 1.0 eq.) in acetic acid (10 mL) was added acetic anhydride (0.60 mL, 6.31 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 17 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography (40 g cartridge) eluting with 0-20% MeOH in DCM to afford product (215 mg, 0.346 mmol, 16% yield) as an off-white solid.

[0002181] UPLC-MS (basic 2 mm): Rt = 0.98 mm, m/z = 622.3 [M+H] ⁺

[0002182] 1H NMR (400 MHz, DMSO-d6) 5 9.88 (s, 1H), 8.85 (d, J = 8.1 Hz, 1H), 8.04 - 7.97 (m, 1H), 7.87 (dt, J = 8.2, 1.0 Hz, 1H), 7.83 (t, J = 2.0 Hz, 1H), 7.52 (d, J = 1.7 Hz, 1H), 7.51 - 7.47 (m, 1H), 7.47 - 7.42 (m, 1H), 7.40 - 7.35 (m, 2H), 7.18 - 7.15 (m, 1H), 7.12 (t, J = 7.9 Hz, 1H), 7.09 - 7.02 (m, 2H), 6.66 (s, 2H), 4.88 (td, J = 9.0, 5.3 Hz, 1H), 3.92 - 3.84 (m, 2H), 3.36 - 3.29 (m, 2H), 2.95 (dd, J = 13.8, 9.8 Hz, 1H), 2.57 - 2.49 (m, 1H), 2.11 (s, 3H), 1.70 - 1.54 (m, 4H), 1.20 (s, 1H).

[0002183] Step 9: A-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]tetrahydropyran-4 -carboxamide

[0002184] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- (tetrahydropyran-4-carbonylamino)phenyl]sulfonylamino]ethyl] phenyl]methylene]amino] acetate (215 mg, 0.346 mmol, 1.0 eq.) in acetic acid (3 mL) was added zinc (226 mg, 3.46 mmol, 10.0 eq.). The reaction mixture was stirred at RT for 19 h. The reaction mixture was filtered, washing with copious MeCN and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative HPLC on a Cl XBridge BEH C18 (19 mm x 150 mm, 5 um) eluting with 27-100% water (0.2% TFA) in acetonitrile (0.2% TFA) to afford the desired product as a TFA salt. The salt was dissolved in hydrogen chloride solution (4 N in dioxane, 2 mL, 8.00 mmol, 54.1 eq.) with a few drops of water and left to stir for 5 min. The solution was concentrated in vacuo and this procedure was carried out a further 5 times before concentrating in vacuo and drying in a vacuum oven to afford the product (60 mg, 0.094 mmol, 28% yield) as a white solid.

[0002185] UPLC-MS (basic 6 mm): Rt = 2.05 mm, m/z = 564.3 [M+H] ⁺

[0002186] 1H NMR (400 MHz, DMSO-d6) 5 10.11 (s, 1H), 9.21 (s, 2H), 9.06 (s, 2H), 8.92 (d, J = 8.0 Hz, 1H), 8.08 (ddd, J = 7.9, 1.3, 0.6 Hz, 1H), 7.96 - 7.88 (m, 2H), 7.72 (t, J = 1.9 Hz, 1H), 7.61 - 7.39 (m, 5H), 7.24 (t, J = 7.8 Hz, 1H), 7.19 - 7.05 (m, 2H), 5.00 (ddd, J = 10.1, 8.1, 4.7 Hz, 1H), 4.00 - 3.86 (m, 2H), 3.43 - 3.30 (m, 3H), 3.04 (dd, J = 13.8, 10.1 Hz, 1H), 2.68 - 2.55 (m, 1H), 1.77 - 1.60 (m, 4H).

Example 107: Exemplary synthesis of Compound 281

[0002187] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002188] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2-aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in toluene (245 mb) was added DIPEA (22.0 mL, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirred for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous Na ₂ SO ₄ , filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid.

[0002189] UPLC-MS (basic 2 mm): Rt = 1.23 mm; m/z = 380.3 for [M+H] ⁺

[0002190] 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H).

[0002191] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002192] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60.0 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid.

[0002193] 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). One CH not observed. 0.5 eq. of residual 1,4-dioxane

[0002194] UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺

[0002195] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002196] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid.

[0002197] UPLC-MS (basic 2 mm): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺

[0002198] 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0002199] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002200] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (4.45 g, 8.24 mmol, 1.0 eq.), iron (4.60 g, 82.4 mmol, 10.0 eq.) and ammonium chloride (2.20 g, 41.2 mmol, 5.0 eq.) in ethanol (45 mL) and water (22.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (250 mL), washed with saturated sodium hydrogen carbonate solution (2 x 250 mL), and brine (250 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford the product (3.00 g, 6.90 mmol, 84% yield) as a yellow solid.

[0002201] UPLC-MS (basic 2 mm): Rt = 1.05 mm; m/z = 435.2 for [M+H] ⁺

[0002202] 1H NMR (400 MHz, DMSO-d6) 5 8.73 (d, J = 8.1 Hz, 1H), 8.09 (ddt, J = 7.9, 1.4, 0.6 Hz, 1H), 7.95 (ddt, J = 8.1, 1.2, 0.6 Hz, 1H), 7.63 - 7.39 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.58 (dddd, J = 8.5, 3.0, 2.0, 0.9 Hz, 2H), 5.41 (s, 2H), 4.93 - 4.82 (m, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0002203] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]pyrimidine-4-carboxamide

[0002204] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) were added pyrimidine-4-carboxylic acid (171 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (0.656 g, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 18 h. The reaction was concentrated to dryness to give a residue, which was purified by column chromatography over silica (40 g cartridge) eluting with 0-20% MeOH in DCM to afford the product (439 mg, 0.812 mmol, 71% yield) as an orange solid.

[0002205] 1H NMR (400 MHz, DMSO-d6) 5 10.93 (s, 1H), 9.43 (d, J = 1.4 Hz, 1H), 9.13 (d, J = 5.1 Hz, 1H), 9.00 (d, J = 8.2 Hz, 1H), 8.16 (t, J = 1.9 Hz, 1H), 8.15 - 8.12 (m, 3H), 8.08 - 8.04 (m, 1H), 7.87 (ddd, J = 8.1, 2.1, 1.2 Hz, 1H), 7.55 (t, J = 1.6 Hz, 1H), 7.50 - 7.34 (m, 4H), 7.27 (t, J = 7.9 Hz, 1H), 7.20 (dt, J = 7.9, 1.5 Hz, 1H), 7.13 (t, J = 7.7 Hz, 1H), 4.96 (ddd, J = 10.7, 8.1, 4.2 Hz, 1H), 3.39 - 3.33 (m, 1H), 2.98 - 2.89 (m, 1H)

[0002206] UPLC-MS (basic 2 mm): Rt = 1.08 mm, m/z = 541.2 [M+H] ⁺

[0002207] Step 6: A-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]pyrimidin e-4-carboxamide

[0002208] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]pyrimidine-4-carboxamide (439 mg, 0.812 mmol, 1.0 eq.) in ethanol (5 mL) were added DIPEA (0.42 mL, 2.44 mmol, 3.0 eq.) and hydroxylamine hydrochloride (113 mg, 1.62 mmol, 2.0 eq.). The reaction mixture was stirred at reflux for 18 h, then concentrated to dryness to afford product (752 mg, 1.31 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification.

[0002209] UPLC-MS (basic 2 mm): Rt = 0.96 mm, m/z = 574.2 [M+H] ⁺

[0002210] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(pyrimidine-4- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate

[0002211] To a magnetically stirred solution of TV- [3 - [ [ 1 -( 1 ,3 -benzothiazol -2-y l)-2-[3 - [(E)- N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]pyrimidin e-4-carboxamide (752 mg,

1.31 mmol, 1.0 eq.) in acetic acid (8 mL) was added acetic anhydride (0.37 mL, 3.93 mmol, 3.0 eq.) and the resulting mixture was stirred at RT for 18 h. The reaction mixture was concentrated to dryness and the residue was purified by normal phase column chromatography over silica (40 g cartridge) eluting with 0-20% MeOH in DCM to afford product (82.0 mg, 0.133 mmol, 10% yield) as a yellow oil.

[0002212] UPLC-MS (basic 2 mm): Rt = 0.99 mm, m/z = 616.3 [M+H] ⁺

[0002213] 1H NMR (400 MHz, DMSO-d6) 5 10.79 (s, 1H), 9.40 (d, J = 1.4 Hz, 1H), 9.12 (d, J = 5.0 Hz, 1H), 8.94 - 8.89 (m, 1H), 8.17 (t, J = 1.9 Hz, 1H), 8.10 (dd, J = 5.0, 1.5 Hz, 1H), 8.03 - 7.99 (m, 1H), 7.89 - 7.85 (m, 1H), 7.81 (dt, J = 7.6, 1.9 Hz, 1H), 7.55 - 7.51 (m, 1H), 7.43 -

7.32 (m, 3H), 7.25 - 7.19 (m, 2H), 7.18 - 7.13 (m, 1H), 7.00 (t, J = 7.7 Hz, 1H), 6.59 (s, 2H), 4.98 - 4.89 (m, 1H), 3.27 - 3.24 (m, 1H), 3.01 - 2.91 (m, 1H), 2.05 (s, 3H).

[0002214] Step 8: A-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]pyrimidine-4-carb oxamide

[0002215] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- (pyrimidine-4-carbonylamino)phenyl]sulfonylamino]ethyl]pheny l]methylene]amino] acetate (82 mg, 0.133 mmol, 1.0 eq.) in acetic acid (2 mL) was added zinc (87 mg, 1.33 mmol, 10.0 eq.). The reaction mixture was stirred at RT for 25 h. The reaction mixture was filtered, washing with copious MeCN and DCM, and concentrated to dryness. The residue was purified by reverse phase preparative HPLC on a XBridge C18 OBD (19 mm x 150 mm, 10 um) eluting with 30- 100% MeCN (0.1% ammonia) in water (10 mM ammonium bicarbonate + 0.1% ammonia) to afford the product (4.0 mg, 0.703 pmol, 5% yield) as a white solid.

[0002216] UPLC-MS (basic 6 mm): Rt = 2.28 mm, m/z = 558.2 [M+H] ⁺ , 98% purity.

[0002217] 1H NMR (400 MHz, DMSO-d6) 5 9.41 (d, J = 1.4 Hz, 1H), 9.13 (d, J = 5.1 Hz, 1H), 8.32 (s, 2H), 8.17 - 8.08 (m, 2H), 8.04 (dd, J = 7.9, 1.4 Hz, 1H), 7.89 (dd, J = 8.1, 1.3 Hz, 1H), 7.80 (dt, J = 7.1, 2.2 Hz, 1H), 7.66 (s, 1H), 7.48 - 7.33 (m, 4H), 7.27 - 7.17 (m, 2H), 7.13 (t, J =

7.7 Hz, 1H), 5.01 (dd, J = 10.3, 4.5 Hz, 1H), 3.46 (dd, J = 7.2, 2.6 Hz, 1H), 2.98 (dd, J = 13.8, 10.3 Hz, 1H), 1.20 (s, 3H).

[0002218] 1H NMR-D20 (400 MHz, DMSO-d6) 5 9.39 (d, J = 1.4 Hz, 1H), 9.11 (d, J = 5.1 Hz, 1H), 8.10 (dd, J = 5.1, 1.4 Hz, 1H), 8.07 - 8.04 (m, 1H), 8.02 - 7.97 (m, 1H), 7.86 (d, J = 7.8 Hz, 1H), 7.77 - 7.73 (m, 1H), 7.62 (s, 1H), 7.45 - 7.33 (m, 4H), 7.24 - 7.19 (m, 2H), 7.14 (t, J =

7.8 Hz, 1H), 4.98 (dd, J = 10.3, 4.5 Hz, 1H), 3.34 (dd, J = 14.0, 4.6 Hz, 1H), 3.02 - 2.94 (m, 1H), 1.17 (s, 1H).

Example 108: Exemplary synthesis of Compound 282

[0002219] Step 1: tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-oxo-ethyl]carbamate

[0002220] To a stirred solution of 2-(tert-butoxycarbonylamino)-3-(3-cyanophenyl)propanoic acid (17.00 g, 58.6 mmol, 1.0 eq.) in DMF (140 mL) was added DIPEA (31.0 mL, 176 mmol,

3.0 eq.), ammonium chloride (7.83 g, 146 mmol, 2.5 eq.) and HATU (33.4 g, 87.8 mmol, 1.5 eq.) and the resultant solution was stirred at RT for 1.5 h. The reaction mixture was quenched with ice-cold water and the precipitated solid was filtered off. The residue was dried overnight in a vacuum oven to afford product (17.3 g, 59.7 mmol, assumed quantitative yield) as an off-white solid.

[0002221] 1H NMR (400 MHz, DMSO-d6) 5 7.70 - 7.65 (m, 2H), 7.63 - 7.59 (m, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.39 (s, 1H), 7.06 (s, 1H), 6.90 (d, J = 9.1 Hz, 1H), 4.11 (td, J = 10.4, 4.1 Hz, 1H), 3.03 (dd, J = 13.8, 4.1 Hz, 1H), 2.76 (dd, J = 13.5, 10.3 Hz, 1H), 1.28 (s, 9H).

[0002222] UPLC-MS (basic 2 mm): Rt = 0.90 mm; m/z = 288.1 for [M+H] ⁺

[0002223] Step 2: tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-thioxo-ethyl]carbamat e

[0002224] To a magnetically stirred solution of tert-butyl N-[2-amino-l-[(3- cyanophenyl)methyl]-2-oxo-ethyl] carbamate (17.3 g, 59.7 mmol, 1.0 eq.) in THF (200 mb) was added La wesson reagent (29.0 g, 71.7 mmol, 1.2 eq.) and the resultant mixture stirred at RT for 20 h. The reaction mixture was filtered and the filtrate was concentrated in vacuo. The residue was suspended in EtOAc (200 mL) and aq. saturated Na ₂ CO ₃ solution (400 mL). The organics were extracted with EtOAc (3 x 200 mL) and after separation of the phases, the organics were washed with brine (200 mL), dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo. The residue was purified by normal phase column chromatography (330 g cartridge) eluting with 0- 30% EtOAc in DCM to afford the product (7.96 g, 26.0 mmol, 44% yield) as a yellow solid.

[0002225] 1H NMR analysis (400 MHz, DMSO-d6) 5 9.64 (s, 1H), 9.28 - 9.23 (m, 1H), 7.74 (s, 1H), 7.68 (d, J = 7.7 Hz, 1H), 7.64 (d, J = 7.9 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 6.92 (d, J = 8.9 Hz, 1H), 4.43 (td, J = 9.5, 4.4 Hz, 1H), 3.04 (dd, J = 13.4, 4.8 Hz, 1H), 2.85 (dd, J = 13.5, 9.9 Hz, 1H), 1.29 (s, 9H).

[0002226] UPLC-MS (basic 4 mm): Rt = 1.59 mm; m/z = 306.2 for [M+H]

[0002227] Step 3: tert-butyl N-[2-(3-cyanophenyl)-l-(4-hydroxy-4,5-dihydrothiazol-2- y 1) ethyl] carbamate

[0002228] Bromoacetaldehyde diethylacetal (15.4 g, 78.1 mmol, 3.0 eq.) in water (40 mb) was hydrolyzed by stirring with concentrated hydrogen chloride solution (5.4 mL, 156 mmol, 6.0 eq.) at 60 °C for 30 min. The mixture was cooled to RT and added to a magnetically stirred suspension of sodium hydrogen carbonate (21.9 g, 260 mmol, 10.0 eq.) in THF (120 mL) and stirred for 15 min. Then tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-thioxo- ethyl] carbamate (7.96 g, 26.0 mmol, 1.0 eq.) was added and stirred for 18 h at RT. The reaction was diluted in EtOAc (200 mL) and water (200 mL). After separation of the phases, the organics were washed with saturated brine solution (200 mL), dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo. The residue was dried in the vacuum overnight to afford the product (8.45 g, 24.3 mmol, 93% yield) as a beige solid.

[0002229] 1H NMR (400 MHz, DMSO-d6) 5 7.69 (d, J = 6.0 Hz, 2H), 7.67 - 7.65 (m, 1H), 7.61 (d, J = 7.9 Hz, 1H), 7.50 (q, J = 7.8 Hz, 2H), 7.44 (d, J = 9.1 Hz, 1H), 6.41 (d, J = 6.0 Hz, 1H), 5.96 - 5.89 (m, 1H), 4.56 - 4.49 (m, 1H), 3.48 - 3.42 (m, 2H), 3.23 (dd, J = 13.7, 4.2 Hz, 1H), 2.98 - 2.93 (m, 1H), 2.89 (dd, J = 13.7, 11.1 Hz, 1H), 1.27 (s, 9H). - 3 extra protons seen in aromatic region

[0002230] UPLC-MS (basic 2 mm): Rt = 0.97 mm; m/z = 348.2 for [M+H] ⁺ ; Rt = 1.09 mm; m/z = 330.2 for [M+H] ⁺ (product obtained as a mixture of desired material and dehydrated material)

[0002231] Step 4: 3-(2-amino-2-thiazol-2-yl-ethyl)benzonitrile hydrochloride

[0002232] To a stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(4-hydroxy-4,5- dihydrothiazol-2-yl)ethyl]carbamate (8.45 g, 24.3 mmol, 1.0 eq.) in 1,4-dioxane (250 mL) was slowly added hydrogen chloride solution (250 mL, 720 mmol, 29.6 eq.) with the resulting mixture being stirred at RT for 3 h. The reaction mixture was concentrated, dissolved in 1 ,4- dioxane (150 mL), redosed with hydrogen chloride solution (250 mL, 720 mmol, 29.6 eq.) and stirred at RT for 96 h. The mixture was diluted with excess Et ₂ O, and the precipitate that formed was collected by filtration, washed with copious Et ₂ O and dried in vacuo to afford the product (6.27 g, 23.6 mmol, 97% yield) as a light brown solid.

[0002233] 1H NMR (400 MHz, DMSO-d6) 5 8.86 (s, 3H), 7.90 (d, J = 3.2 Hz, 1H), 7.79 (d, J = 3.3 Hz, 1H), 7.72 (ddd, J = 6.1, 2.7, 1.6 Hz, 1H), 7.69 (p, J = 1.6 Hz, 1H), 7.53 - 7.47 (m, 2H), 5.23 - 5.15 (m, 1H), 3.44 (dd, J = 13.8, 6.2 Hz, 1H), 3.29 (dd, J = 13.7, 8.7 Hz, 1H).

[0002234] UPLC-MS (basic 2 mm): Rt = 0.84 mm; m/z = 230.2 for [M+H] ⁺

[0002235] Step 5: N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]-3-nitro-benzenesu lfonamide

[0002236] To a solution of 3-(2-amino-2-thiazol-2-yl-ethyl)benzonitrile;hydrochloride (4.00 g,

15.1 mmol, 1.0 eq.) in DMF (16 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of TEA (6.3 mL, 45.2 mmol, 3.0 eq.). The resulting mixture was then stirred for 10 min before the portionwise addition of 3 -nitrophenylsulfonyl chloride (4.00 g, 18.1 mmol, 1.2 eq.) over a 10 min period. The reaction was allowed to stir at the same temperature for 1 h before being allowed to warm to RT and stirred for 16 h. The reaction was quenched via the addition of water (100 mL) and the organics were extracted with EtOAc (2 x 100 mL), washed with brine (100 mL), dried over anhydrous Na ₂ SO ₄ and concentrated in vacuo. The crude material was suspended in DCM and the product crashed out upon addition of iso-hexane to afford the product (3.40 g, 8.20 mmol, 55% yield) as a brown solid.

[0002237] ¹ H NMR (400 MHz, DMSO-d6). 5 9.21 (d, J = 8.7 Hz, 1H), 8.31 (ddd, J = 8.3, 2.3,

1.1 Hz, 1H), 8.08 (td, J = 2.0, 2.0 Hz, 1H), 7.87 (ddd, J = 7.8, 1.8, 1.0 Hz, 1H), 7.69 (d, J = 3.3 Hz, 1H), 7.66 (d, J = 7.9 Hz, 1H), 7.63 - 7.62 (m, 1H), 7.57 (t, J = 1.7 Hz, 1H), 7.49 (dt, J = 7.8, 1.6 Hz, 1H), 7.42 (dt, J = 7.7, 1.4 Hz, 1H), 7.23 (t, J = 7.8 Hz, 1H), 5.05 (ddd, J = 10.7, 8.7, 4.6 Hz, 1H), 3.30 (d, J = 4.9 Hz, 1H), 2.95 (dd, J = 13.9, 10.7 Hz, 1H).

[0002238] UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 413.1 for [M+H] ⁺

[0002239] Step 6: 3-amino-N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]benzenesul fonamide

[0002240] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]-3- nitro-benzenesulfonamide (3.40 g, 8.20 mmol, 1.0 eq.) in EtOH (20 mL) and water (10 mL) was added iron (4.58 g, 82.0 mmol, 10.0 eq.) and ammonium chloride (2.19 g, 41.0 mmol, 5.0 eq.) and the resultant mixture was heated to 85 °C, under a balloon of nitrogen, and stirred for 4 h. The reaction mixture was cooled to RT, filtered over Celite and rinsed with copious EtOH and DCM and concentrated in vacuo. The residue was re-suspended in EtOAc (100 mL) and aq. saturated Na ₂ CO ₃ (100 mL). After separation of the phases, the organics were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated in vacuo to afford the product (2.26 g, 5.88 mmol, 72% yield) as a tan-beige foam.

[0002241] ¹ H NMR (400 MHz, DMSO-d6) 5 8.55 (s, 1H), 7.70 (d, J = 3.2 Hz, 1H), 7.61 (dd, J = 3.2, 0.7 Hz, 1H), 7.57 - 7.48 (m, 2H), 7.44 (dt, J = 7.8, 1.4 Hz, 1H), 7.34 (t, J = 7.7 Hz, 1H), 6.96 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.60 (tdd, J = 8.8, 2.1, 1.0 Hz, 2H), 5.41 (s, 2H), 4.78 (s, 1H), 3.26 (dd, J = 13.7, 5.4 Hz, 1H), 2.90 (dd, J = 13.7, 9.3 Hz, 1H). - residual EtOAc (5.11% by weight)

[0002242] UPLC-MS (basic 2 mm): Rt = 0.93 mm; m/z = 385.2 for [M+H] ⁺

[0002243] Step 7: tert-butyl A-[2-[3-[[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate

[0002244] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl]benzenesulfonamide (0.500 g, 1.30 mmol, 1.0 eq.) in DMF (10 mL) was added added N- alpha-t-BOC-glycine (230 mg, 1.30 mmol, 1.2 eq.) and DIPEA (0.68 mL, 3.90 mmol, 3.0 eq.), shortly followed by HATU (740 mg, 1.95 mmol, 1.5 eq.) and left to stir at RT for 16 h. The reaction mixture was diluted with EtOAc (30 mL), washed with brine (30 mL), saturated Na ₂ CO ₃ solution (30 mL), and brine again (30 mL). The organics were dried over anhydrous Na ₂ SO ₄ , filtered and concentrated under reduced pressure to afford the product (477 mg, 0.881 mmol, 68%) as a beige foam.

[0002245] UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 542.2 for [M+H] ⁺

[0002246] 1H NMR (400 MHz, DMSO-d6) 5 10.09 (s, 1H), 8.83 (s, 1H), 7.79 (t, 1H), 7.71 (d, J = 3.2 Hz, 1H), 7.62 (d, J = 3.2 Hz, 1H), 7.59 (d, J = 9.1 Hz, 1H), 7.49 - 7.43 (m, 3H), 7.31 - 7.23 (m, 2H), 7.15 - 7.07 (m, 2H), 4.80 (s, 1H), 3.75 (d, J = 6.1 Hz, 2H), 3.25 (dd, J = 8.3, 5.1 Hz, 1H), 2.93 - 2.86 (m, 1H), 1.41 (s, 9H). - residual EtOAc (6 wt%), remaining starting material evident in aromatic region

[0002247] Step 8: tert-butyl A-[2-[3-[[2-[3-A-hydroxycarbamimidoyl]phenyl]-l-thiazol-2-yl - ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate

[0002248] To a magnetically stirred solution of tert-butylN-[2-[3-[[2-(3-cyanophenyl)-l- thiazol-2-yl-ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate (0.480 g, 0.881 mmol, 1.0 eq.) in ethanol (8 mL) was added hydroxylammonium chloride (122 mg, 1.76 mmol, 2.0 eq.) and DIPEA (0.46 mL, 2.64 mmol, 3.0 eq.) with the resultant mixture stirred at 85 °C for 16 h. The mixture was cooled to RT and concentrated to dryness under reduced pressure to afford the product (506 mg, 0.881 mmol, assumed quantitative yield) as a yellow foam.

[0002249] UPLC-MS (basic 2 mm): Rt = 0.96 mm; m/z = 575.3 for [M+H] ⁺

[0002250] Step 9: [[amino-[3-[2-[[3-[[2-(tert- butoxycarbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-thi azol-2-yl- ethyl]phenyl]methylene]amino] acetate

[0002251] To a magnetically stirred solution ofN-[2-[3-[[2-[3-[(E)-N- hydroxycarbamimidoyl]phenyl]-l-thiazol-2-yl-ethyl]sulfamoyl] anilino]-2-oxo-ethyl]carbamate (506 mg, 0.881 mmol, 1.0 eq.) in acetic acid (6 mL) was added acetic anhydride (0.25 mL, 2.64 mmol, 3.0 eq.). The reaction was left to stir at RT for 16 h. The reaction mixture was concentrated to dryness under reduced pressure and the residue was purified by normal-phase column chromatography over silica (24 g cartridge) eluting with 80-100% EtOAc in DCM to afford the product (236 mg, 0.383 mmol, 43% yield) as a white solid.

[0002252] UPLC-MS (basic 2 mm): Rt = 0.97 mm; m/z = 617.3 for [M+H] ⁺

[0002253] 1H NMR (400 MHz, DMSO-d6) 5 8.77 (d, J = 7.8 Hz, 1H), 7.87 (t, J = 2.0 Hz, 1H), 7.66 (d, J = 3.2 Hz, 1H), 7.56 (d, J = 3.3 Hz, 2H), 7.48 (s, 1H), 7.42 (dt, J = 7.1, 1.8 Hz, 1H), 7.23 (t, J = 8.0 Hz, 1H), 7.18 - 7.05 (m, 4H), 6.68 (s, 2H), 4.82 (s, 1H), 3.73 (d, J = 6.1 Hz, 2H), 3.21 (dd, J = 13.7, 5.5 Hz, 1H), 2.94 - 2.86 (m, 1H), 2.15 (s, 3H), 1.41 (s, 9H). - residual EtO Ac (1.75 wt%)

[0002254] Step 10: tert-butyl A-[2-[3-[[2-(3-carbamimidoylphenyl)-l-thiazol-2-yl- ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate

[0002255] A mixture of [[amino- [3 -[2- [[3 -[2-(tert- butoxy carbonylamino)acetyl]amino]phenyl]sulfonylamino]-2-thiazol-2 -yl- ethyl]phenyl]methylene]amino] acetate (236 mg, 0.383 mmol, 1.0 eq.) and zinc (250 mg, 3.83 mmol, 10.0 eq.) in acetic acid (8 mL) was stirred at RT for 72 h. The reaction mixture was filtered through Celite, washing with copious ethanol, acetonitrile and DCM before concentrating in vacuo. The residue was purified via reverse phase preparative HPLC (Cl XBridge BEH C18, 19 mm x 150 mm, 5 um) eluting with 25-100% MeCN (0.1% ammonium hydroxide): water (10 mM ammonium bicarbonate) to afford the product (6.0 mg, 0.0286 mmol, 7% yield) as an off-white solid.

[0002256] UPLC-MS (basic 6 mm): Rt = 2.69 mm; m/z = 559.1 for [M+H] ⁺

[0002257] Step 11: 2-amino-A-[3-[[2-(3-carbamimidoylphenyl)-l-thiazol-2-yl- ethyl]sulfamoyl]phenyl]acetamide

[0002258] T o tert-butyl N-[2- [3 - [ [2-(3 -carbamimidoylphenyl)-1-thiazol-2-yl- ethyl]sulfamoyl]anilino]-2-oxo-ethyl]carbamate (16 mg, 0.0286 mmol) was added 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 280 eq.) and the resultant suspension was stirred at RT for 17 h before being concentrated to dryness. The residue was suspended in MeCN/water and concentrated to dryness, then dried in a vacuum oven. The residue was purified via reverse phase preparative HPLC (C2 CBridge BEH C18, 19 mm x 150 mm, 5 um) eluting with 10 mM ammonium bicarbonate solution to afford the product (5.0 mg, 0.00941 mmol, 33% yield) as a white solid.

[0002259] UPLC-MS (basic 6 mm): rt = 1.27 mm; m/z = 459.2 for [M+H] ⁺ , 98% purity.

[0002260] 1H NMR (400 MHz, DMSO-d6) 5 8.34 (s, 3H), 7.85 (s, 1H), 7.68 (d, J = 3.3 Hz, 1H), 7. 7.61 - 7.55 (m, 3H), 7.44 (d, J = 7.9 Hz, 1H), 7.33 (d, J = 7.8 Hz, 1H), 7.17 (td, J = 7.8, 2.5 Hz, 2H), 7.11 - 7.04 (m, 1H), 4.87 (dd, J = 9.9, 4.9 Hz, 1H), 2.87 (dd, J = 13.7, 9.9 Hz, 1H), 2.50 (s, 2H), 1.20 (s, 1H). Aromatic impurity observed for 7% and grease observed, amine and amide peaks absent.

[0002261] 1H NMR-D20 (400 MHz, DMSO-d6) 5 8.31 (s, 3H), 7.84 - 7.77 (m, 1H), 7.68 - 7.60 (m, 1H), 7.56 - 7.51 (m, 2H), 7.47 (dd, J = 15.0, 7.9 Hz, 2H), 7.35 (d, J = 7.7 Hz, 1H), 7.25 - 7.15 (m, 2H), 7.08 (d, J = 7.9 Hz, 1H), 4.84 (dd, J = 10.0, 4.8 Hz, 1H), 3.25 (dd, J = 13.8, 4.8 Hz, 1H), 2.88 (dd, J = 13.8, 10.1 Hz, 1H), 2.50 (s, 2H), 1.17 (s, 1H). Grease observed, amine and amide peaks absent.

Example 109: Exemplary synthesis of Compound 283

[0002262] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002263] To a suspension of 2-(tert- butoxy carbonylamino)-3 -(3 -cyanophenyl)propanoic acid (13.6 g, 46.8 mmol, 1.0 eq.) in toluene (276 mL) was added 2-aminothiophenol (5.87 g, 46.8 mmol, 1.0 eq.), DIPEA (24.0 mL, 141 mmol, 3.0 eq.) and T3P (33.0 mL, 56.2 mmol, 1.2 eq.). The resulting mixture was then stirred at 115 °C for 4 h. After cooling, saturated sodium hydrogen carbonate solution (250 mL) was added and the biphasic mixture was vigorously stirred for 30 min. The mixture was then diluted with ethyl acetate (500 mL) and water (250 mL). After separation of the phases, the organics were washed with further water (500 mL) followed by brine (500 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified via normal phase column chromatography (220 g cartridge) eluting with 0-50% ethyl acetate in DCM to afford the product (8.70 g, 22.9 mmol, 49% yield) as a yellow solid.

[0002264] UPLC-MS (basic 2 mm): Rt = 1.22 mm, m/z = 380.3 [M+H] ⁺

[0002265] 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 8.2 Hz, 1H), 7.98 (ddd, J = 8.1, 1.2, 0.6 Hz, 1H), 7.92 (d, J = 8.9 Hz, 1H), 7.81 (s, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.52 (ddt, J = 7.9, 7.2, 2.0 Hz, 2H), 7.44 (ddd, J = 8.4, 7.4, 1.2 Hz, 1H), 5.22 - 5.11 (m, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002266] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002267] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (27.0 g, 71.1 mmol, 1.0 eq.) in 4 N HC1 in 1,4-dioxane (267 mL, 1067 mmol, 15.0 eq.) was stirred at RT for 3 h. The resulting mixture was concentrated in vacuo and the residue was triturated with diethyl ether (20 mL) to afford the product (25.6 g, 81.1 mmol, assumed quantitative yield) as an off-white solid.

[0002268] UPLC-MS (basic 2 mm): Rt = 1.02 mm, m/z = 280.1 [M+H] ⁺

[0002269] 1H NMR (400 MHz, DMSO-d6) 5 9.20 (d, J = 4.6 Hz, 3H), 8.14 (ddd, J = 8.0, 1.3, 0.7 Hz, 1H), 8.04 (ddt, J = 8.2, 1.2, 0.6 Hz, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.34 - 5.27 (m, 1H), 3.58 (dd, J = 13.9, 6.0 Hz, 1H), 3.56 (s, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H). Contains 6 wt% 1,4-dioxane

[0002270] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002271] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (6.00 g, 19.0 mmol, 1.0 eq.) in DMF (60 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (5.3 mL, 38.0 mmol, 2.0 eq.). The resulting mixture was stirred for 10 min. Then, 3 -nitrophenylsulfonyl chloride (5.05 g, 22.8 mmol, 1.2 eq.) was dissolved in 5 mL anhydrous DMF and added over a period of 10 min. The reaction was allowed to stir at the same temperature for 30 min before being allowed to warm to RT and stirred for 2 h. The reaction was slowly added to 100 mL ice water mixture which formed a gummy solid.

The mixture was extracted with ethyl acetate and washed with water, brine, dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was triturated with DCM/hexane and filtered off to obtain the product (9.10 g, 19.6 mmol, assumed quantitative yield) as a yellow solid.

[0002272] UPLC-MS (basic 2 mm): Rt = 1.10 mm, m/z = 465.1 [M+H] ⁺

[0002273] 1H NMR (400 MHz, DMSO-d6) 5 9.33 (s, 1H), 8.15 (ddt, J = 8.3, 2.3, 1.1 Hz, 1H), 8.08 - 8.00 (m, 2H), 7.87 - 7.80 (m, 2H), 7.62 - 7.33 (m, 6H), 7.20 (dd, J = 8.2, 7.2 Hz, 1H), 5.12 (dd, J = 10.7, 4.3 Hz, 1H), 3.37 (dd, J = 13.9, 4.5 Hz, 1H), 3.00 (dd, J = 13.7, 10.7 Hz, 1H). Contains 20 wt% DMF.

[0002274] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002275] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (9.10 g, 15.7 mmol, 1.0 eq.), iron (8.75 g, 157 mmol, 10.0 eq.) and ammonium chloride (4.19 g, 78.4 mmol, 5.0 eq.) in ethanol (90 mL) and water (20 mL) was stirred at reflux, under a balloon of nitrogen, for 4.5 h. The reaction mixture was filtered through Celite, washing with ethanol and DCM and concentrated in vacuo. The residue was redissolved in ethyl acetate (250 mL) and diluted with sat. sodium hydrogen carbonate solution (250 mL). After separation of the phases, the organics were washed with further sat. sodium hydrogen carbonate (250 mL) and water (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was triturated with DCM to afford the product (4.06 g, 9.34 mmol, 60% yield) as a yellow solid.

[0002276] UPLC-MS (basic 2 min): Rt = 1.06 min; m/z = 435.1 for [M+H] ⁺

[0002277] 1H NMR (400 MHz, DMSO-d6) 5 8.68 (d, J = 7.1 Hz, 1H), 8.08 - 8.01 (m, 1H),

7.94 - 7.87 (m, 1H), 7.54 - 7.37 (m, 5H), 7.29 (t, J = 7.7 Hz, 1H), 6.88 (t, J = 7.9 Hz, 1H), 6.69 (t, J = 2.1 Hz, 1H), 6.54 (dt, J = 7.7, 2.2 Hz, 2H), 5.36 (s, 2H), 4.85 (s, 1H), 3.37 - 3.29 (m, 1H),

2.94 (dd, J = 13.8, 9.9 Hz, 1H).

[0002278] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl]phenyl]- 4-ethy 1- 1 ,2, 5-oxadiazole-3 -carboxamide

[0002279] A mixture of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.), 4-ethyl- 1,2,5 -oxadiazole- 3-carboxylic acid (196 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) in DMF (10 mL) was stirred at RT, under a balloon of nitrogen, for 20 h. The reaction was quenched via the addition of brine (100 mL) and diluted with ethyl acetate (100 mL). After separation of the phases, the organics were washed with saturated sodium hydrogen carbonate solution (100 mL) and brine again (100 ml), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to afford the product (1049 mg, 1.88 mmol, assumed quantitative yield) as an orange oil.

[0002280] 1H NMR (400 MHz, DMSO-d6) 5 10.32 (s, 1H), 8.97 (d, J = 8.2 Hz, 1H), 8.08 - 8.01 (m, 2H), 7.97 - 7.89 (m, 3H), 7.78 (ddd, J = 8.1, 2.1, 1.1 Hz, 1H), 7.61 - 7.50 (m, 4H), 7.49 - 7.43 (m, 2H), 7.43 - 7.37 (m, 2H), 7.27 - 7.11 (m, 3H), 4.94 (ddd, J = 10.6, 8.2, 4.3 Hz, 1H), 3.36 (dd, J = 13.9, 4.4 Hz, 1H), 2.95 (dd, J = 13.9, 10.7 Hz, 1H).

[0002281] UPLC-MS (basic 2 mm): Rt = 1.21 mm, m/z = 559.2 [M+H] ⁺

[0002282] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-4-ethyl- l,2,5-oxadiazole-3-carboxamide

[0002283] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]-4-ethyl-l,2,5-oxadiazole -3-carboxamide (1049 mg, 1.88 mmol, 1.0 eq.), hydroxylammonium chloride (261 mg, 3.76 mmol, 2.0 eq.) and DIPEA (0.98 mL, 5.63 mmol, 3.0 eq.) in ethanol (18.8 mL) was stirred at reflux for 18 h. The reaction mixture was concentrated in vacuo to afford the product (1111 mg, 1.88 mmol, assumed quantitative yield) as an orange oil.

[0002284] UPLC-MS (basic 2 mm): Rt = 1.09 mm, m/z = 592.2 [M+H] ⁺

[0002285] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[(4-ethyl-l, 2,5-oxadiazole-3- carbonyl)amino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate

[0002286] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-4-ethyl- l,2,5-oxadiazole-3-carboxamide (1111 mg, 1.88 mmol, 1.0 eq.) and acetic anhydride (0.53 mL, 5.63 mmol, 3.0 eq.) in acetic acid (9.4 mL) was stirred at RT for 20 h. The resulting mixture was concentrated in vacuo and the residue was purified via normal phase column chromatography (24 g cartridge) eluting with 0- 100% ethyl acetate in isohexane to afford the product (507 mg, 0.800 mmol, 43% yield) as a yellow oil.

[0002287] UPLC-MS (basic 2 mm): Rt = 1.14 mm, m/z = 634.2 [M+H] ⁺

[0002288] 1H NMR (400 MHz, DMSO-d6) 5 11.07 (s, 1H), 8.99 (d, J = 8.1 Hz, 1H), 8.11 - 8.03 (m, 2H), 7.91 (ddd, J = 8.1, 1.4, 0.7 Hz, 1H), 7.71 - 7.63 (m, 1H), 7.60 - 7.55 (m, 1H), 7.50 - 7.37 (m, 3H), 7.29 - 7.18 (m, 3H), 7.08 (t, J = 7.7 Hz, 1H), 6.66 (s, 2H), 4.99 - 4.90 (m, 1H), 3.33 - 3.28 (m, 1H), 3.08 - 2.93 (m, 3H), 2.11 (s, 3H), 1.32 (t, J = 7.5 Hz, 3H).

[0002289] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-4-ethyl-l,2,5-ox adiazole-3-carboxamide

[0002290] A mixture of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[(4-ethyl-l, 2,5- oxadiazole-3-carbonyl)amino]phenyl]sulfonylamino]ethyl]pheny l]methylene]amino] acetate (507 mg, 0.800 mmol, 1.0 eq.) and zinc (1046 mg, 16.0 mmol, 20 .0 eq.) in acetic acid (8 mL) was stirred at RT for 20 h. The reaction mixture was then filtered through Celite, washing with copious acetonitrile, ethanol and DCM and the filtrate concentrated in vacuo. The residue was submitted for purification via reverse phase preparative HPLC on a C2 XBridge BEH C18 (19 mm x 150 mm, 5 um) eluting with 35-100% MeCN:water (10 mM ammonium carbonate) to afford the product (250 mg, 0.434 mmol, 54% yield) as an off white solid

[0002291] UPLC-MS (basic 6 min): Rt = 3.14 min, m/z = 576.2 [M+H] ⁺ , 99% purity

[0002292] 1H NMR (400 MHz, DMSO-d6) 5 8.00 (ddd, J = 7.9, 1.3, 0.6 Hz, 1H), 7.93 - 7.90 (m, 1H), 7.88 (ddd, J = 8.0, 1.2, 0.6 Hz, 1H), 7.68 (d, J = 1.8 Hz, 1H), 7.61 (td, J = 4.5, 2.1 Hz, 1H), 7.50 - 7.41 (m, 2H), 7.36 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 7.30 (dt, J = 7.8, 1.4 Hz, 1H), 7.21 - 7.18 (m, 2H), 7.16 (t, J = 7.7 Hz, 1H), 4.84 (dd, J = 9.1, 4.7 Hz, 1H), 3.28 (dd, J = 13.4, 4.7 Hz, 1H), 3.00 (q, J = 7.5 Hz, 3H), 1.30 (t, J = 7.5 Hz, 3H). 0.14 wt% MeCN.

Example 110: Exemplary synthesis of Compound 284

[0002293] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002294] To a suspension of 2-(tert- butoxy carbonylamino)-3 -(3 -cyanophenyl)propanoic acid (13.6 g, 46.8 mmol, 1.0 eq.) in toluene (276 mL) was added 2-aminothiophenol (5.87 g, 46.8 mmol, 1.0 eq.), DIPEA (24.0 mL, 141 mmol, 3.0 eq.) and T3P (33.0 mL, 56.2 mmol, 1.2 eq.). The resulting mixture was then stirred at 115 °C for 4 h. After cooling, saturated sodium hydrogen carbonate solution (250 mL) was added and the biphasic mixture was vigorously stirred for 30 min. The mixture was then diluted with ethyl acetate (500 mL) and water (250 mL). After separation of the phases, the organics were washed with further water (500 mL) followed by brine (500 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified via normal phase column chromatography (220 g cartridge) eluting with 0-50% ethyl acetate in DCM to afford the product (8.70 g, 22.9 mmol, 49% yield) as a yellow solid.

[0002295] UPLC-MS (basic 2 mm): Rt = 1.22 mm, m/z = 380.3 [M+H] ⁺

[0002296] 1H NMR (400 MHz, DMSO-d6) 5 8.10 (d, J = 8.2 Hz, 1H), 7.98 (ddd, J = 8.1, 1.2, 0.6 Hz, 1H), 7.92 (d, J = 8.9 Hz, 1H), 7.81 (s, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.52 (ddt, J = 7.9, 7.2, 2.0 Hz, 2H), 7.44 (ddd, J = 8.4, 7.4, 1.2 Hz, 1H), 5.22 - 5.11 (m, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002297] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002298] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (8.70 g, 22.9 mmol, 1.0 eq.) in 4 N HC1 in 1,4-dioxane (86.0 mL, 344 mmol, 15.0 eq.) was stirred at RT for 3 h. The resulting mixture was concentrated in vacuo to afford the product (7.70 g, 24.4 mmol, assumed quantitative yield) as a brown solid.

[0002299] UPLC-MS (basic 2 mm): Rt = 1.03 mm, m/z = 280.1 [M+H] ⁺

[0002300] 1H NMR (400 MHz, DMSO-d6) 5 9.03 (s, 3H), 8.15 (ddt, J = 8.0, 1.3, 0.6 Hz, 1H), 8.06 (ddt, J = 8.2, 1.2, 0.6 Hz, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.74 (dt, J = 7.6, 1.4 Hz, 1H), 7.61 - 7.54 (m, 2H), 7.54 - 7.46 (m, 2H), 5.33 (s, 1H), 3.54 - 3.47 (m, 1H), 3.38 (dd, J = 13.9, 8.4 Hz, 1H). 0.75 eq. of dioxane present

[0002301] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]benzenes ulfonamide

[0002302] A suspension of 3-[2-amino-2-(l,3-benzothiazol-2- yl)ethyl]benzonitrile;hydrochloride (1.50 g, 4.75 mmol, 1.0 eq.) in DMF (15.8 mb) was cooled to 0 °C, under a balloon of nitrogen, before the addition of tri ethylamine (2.0 mL, 14.2 mmol, 3.0 eq.). The resulting mixture was stirred at the same temperature for 5 min before the dropwise addition of benzenesulphonyl chloride (1007 mg, 5.70 mmol, 1.2 eq.). The resulting mixture was stirred at the same temperature for 5 min before allowing to warm to RT and stirring for a further 2 h. The reaction was quenched via the addition of water (50 mL). The resulting precipitate was collected by filtration before being triturated with DCM. The precipitate was then allowed to air dry to afford the product (546 mg, 1.30 mmol, 27% yield) as a white solid.

[0002303] UPLC-MS (basic 2 mm): Rt = 1.12 mm, m/z = 420.3 [M+H] ⁺

[0002304] 1H NMR (400 MHz, DMSO-d6) 5 8.96 (d, J = 8.4 Hz, 1H), 8.08 (ddd, J = 7.9, 1.4, 0.6 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.60 (t, J = 1.8 Hz, 1H), 7.51 (ddd, J = 8.1, 7.2, 1.4 Hz, 3H), 7.47 - 7.38 (m, 4H), 7.33 - 7.24 (m, 3H), 5.02 (ddd, J = 10.5, 8.3, 4.6 Hz, 1H), 3.39 (dd, J = 13.9, 4.6 Hz, 1H), 3.00 (dd, J = 13.9, 10.5 Hz, 1H)

[0002305] Step 4: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-N-methy l- benzenesulfonamide

[0002306] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (250 mg, 0.597 mmol), potassium carbonate 325 mesh (330 mg, 2.38 mmol) and methyl iodide (0.075 mL, 1.19 mmol) in DMF (5 mL) was stirred at 40 °C for 3 h. The reaction was diluted with ethyl acetate (100 mL), washed with water (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to afford the product (293 mg, 0.676 mmol, assumed quantitative yield) as an orange oily-solid.

[0002307] UPLC-MS (basic 2 mm): Rt = 1.25 mm; m/z = 434.2 for [M+H] ⁺

[0002308] 1H NMR (400 MHz, DMSO-d6) 5 8.10 (ddd, J = 7.9, 1.4, 0.6 Hz, 1H), 7.99 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.74 (t, J = 1.7 Hz, 1H), 7.69 (dt, J = 8.0, 1.5 Hz, 1H), 7.63 (dt, J = 7.7, 1.4 Hz, 1H), 7.59 - 7.38 (m, 8H), 5.85 (dd, J = 10.5, 5.0 Hz, 1H), 3.61 (dd, J = 14.3, 4.9 Hz, 1H), 3.31 - 3.25 (m, 1H), 2.82 (s, 3H). Aromatic region over-integrating by 1H

[0002309] Step 5: 3-[2-[benzenesulfonyl(methyl)amino]-2-(l,3-benzothiazol-2-yl )ethyl]-N'- hydroxy-benzamidine

[0002310] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-N-methy l- benzenesulfonamide (293 mg, 0.676 mmol, 1.0 eq.), hydroxylammonium chloride (94 mg, 1.35 mmol, 2.0 eq.) and DIPEA (0.35 mL, 2.03 mmol, 3.0 eq.) and ethanol (6.8 mL) were stirred at 85 °C to 18 h. The reaction was concentrated in vacuo to afford the product (315 mg, 0.675 mmol, assumed quantitative yield) as an orange oil.

[0002311] UPLC-MS (basic 2 mm): Rt = 1.10 mm, m/z = 467.1 [M+H] ⁺

[0002312] Step 6: [(E)-[amino-[3-[2-[benzenesulfonyl(methyl)amino]-2-(l,3-benz othiazol-2- yl)ethyl]phenyl]methylene]amino] acetate

[0002313] A mixture of 3-[2-[benzenesulfonyl(methyl)amino]-2-(l,3-benzothiazol-2-yl )ethyl]- N'-hydroxy-benzamidine (315 mg, 0.675 mmol, 1.0 eq.) and acetic anhydride (0.19 mL, 2.03 mmol, 3.0 eq.) in acetic acid (6.8 mL) was stirred at RT for 18 h. The reaction was concentrated in vacuo and purification was performed via normal phase column chromatography (24 g cartridge) eluting with 0-100% EtOAc in isohexane to afford the product (189 mg, 0.372 mmol, 55% yield) as a colourless oil.

[0002314] UPLC-MS (basic 2 mm): Rt = 1.13 mm, m/z = 509.1 [M+H] ⁺

[0002315] 1H NMR (400 MHz, DMSO-d6) 5 8.09 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.99 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.68 (t, J = 1.8 Hz, 1H), 7.58 - 7.39 (m, 8H), 7.36 (dt, J = 7.7, 1.4 Hz, 1H), 7.23 (t, J = 7.7 Hz, 1H), 6.78 (s, 2H), 5.81 (dd, J = 9.2, 6.1 Hz, 1H), 3.61 (dd, J = 14.2, 6.1 Hz, 1H), 3.13 (dd, J = 14.3, 9.2 Hz, 1H), 2.84 (s, 3H).

[0002316] Step 7: 3-[2-[benzenesulfonyl(methyl)amino]-2-(l,3-benzothiazol-2- yl)ethyl]benzamidine

[0002317] A mixture of [(E)-[amino-[3-[2-[benzenesulfonyl(methyl)amino]-2-(l,3- benzothiazol-2-yl)ethyl]phenyl]methylene]amino] acetate (189 mg, 0.372 mmol, 1.0 eq.) and zinc (486 mg, 7.43 mmol, 20.0 eq.) in Acetic acid (3.716 mb) was stirred at RT for 18 h. The reaction was filtered through Celite, washing with copious ethanol, acetonitrile and DCM. The filtrate was concentrated in vacuo. The residue was submitted for purification via reverse phase preparative HPLC (C2 XBridge BEH C18, 19 mm x 150 mm, 5 um) eluting with 40-100% MeCN in water (10 mM ammonium bicarbonate) to afford the product (82 mg, 0.182 mmol, 49% yield) as a yellow solid

[0002318] UPLC-MS (basic 6 mm): Rt = 3.31 mm, m/z = 451.2 [M+H] ⁺ , 96% purity

[0002319] 1H NMR (400 MHz, DMSO-d6) 5 8.12 - 8.06 (m, 1H), 8.02 - 7.96 (m, 1H), 7.73 (d, J = 2.2 Hz, 1H), 7.59 (dt, J = 7.8, 1.4 Hz, 1H), 7.57 - 7.49 (m, 2H), 7.49 - 7.43 (m, 3H), 7.43 - 7.31 (m, 3H), 7.23 (t, J = 7.7 Hz, 1H), 6.96 (s, 3H), 5.83 (dd, J = 9.4, 5.9 Hz, 1H), 3.61 (dd, J = 14.2, 5.9 Hz, 1H), 3.16 (dd, J = 14.2, 9.4 Hz, 1H), 2.83 (s, 3H), 2.07 (d, J = 0.4 Hz, OH). 0.87 wt% MeCN, unidentified singlet integrating to 0.1 at 4.4 ppm

Example 111: Exemplary synthesis of Compound 285

[0002320] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002321] To a magnetically stirred suspension of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (13.6 g, 46.7 mmol, 1.0 eq.) and 2-aminothiophenol (5.0 mL, 46.7 mmol, 1.0 eq.) in toluene (150 mL) was added DIPEA (24.4 mL, 140 mmol, 3.0 eq.) and T3P (33.4 mL, 56.1 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 4 h before being cooled to RT. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and stirred for 30 min. The reaction was then diluted with ethyl acetate (600 mL) and water (300 mL). After separation of the phases, the organics were washed with water (250 mL) and brine (250 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-60% EtOAc in Ao-hexane to afford the product (13.5 g, 35.6 mmol, 76% yield) as a white solid.

[0002322] UPLC-MS (basic 2 mm): Rt = 1.21 mm; m/z = 380.1 for [M+H] ⁺

[0002323] 1H NMR (400 MHz, DMSO-d6) 5 8.13 - 8.06 (m, 1H), 7.98 (dt, J = 8.2, 0.9 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.87 - 7.78 (m, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.47 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.16 (ddd, J = 10.9, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002324] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002325] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (13.5 g, 35.6 mmol, 1.0 eq.) and 4 N HC1 in 1,4-di oxane (133 mL, 534 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated to dryness to afford the product (12.5 g, 39.6 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification.

[0002326] 1H NMR (400 MHz, DMSO-d6) 5 9.18 (d, J = 5.5 Hz, 3H), 8.14 (ddd, J = 8.1, 1.4, 0.7 Hz, 1H), 8.04 (ddd, J = 8.2, 1.3, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.30 (dd, J = 8.7, 5.4 Hz, 1H), 3.62 - 3.52 (m, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H)

[0002327] UPLC-MS (basic 2 mm): Rt = 1.05 mm; m/z = 280.1 for [M+H] ⁺

[0002328] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002329] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (10.0 g, 31.7 mmol, 1.0 eq.) in DMF (100 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (8.8 mL, 63.3 mmol, 2.0 eq.). The resulting mixture was stirred for 10 min before the portionwise addition of 3 -nitrophenylsulfonyl chloride (8.42 g, 38.0 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 30 min before being allowed to warm to RT and stirred for 2 h. The reaction mixture was re-dosed with 3- nitrophenylsulfonyl chloride (8.42 g, 38.0 mmol, 1.2 eq.) and (8.8 mL, 63.3 mmol, 2.0 eq.) and was stirred at RT for 1 h. The reaction mixture was then added slowly to ice water (100 mL) and the resulting solid was filtered. The solid was purified by normal phase column chromatography (80 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (6.40 g, 13.8 mmol, 44% yield) as a yellow solid.

[0002330] UPLC-MS (basic 2 mm): Rt = 1.10 mm; m/z = 465.1 for [M+H] ⁺

[0002331] 1H NMR (400 MHz, DMSO-d6) 5 9.36 (s, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.03 (m, 2H), 7.91 - 7.85 (m, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.60 (d, J = 8.1 Hz, 1H), 7.58 - 7.47 (m, 2H), 7.46 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.18 (dd, J = 10.9, 4.4 Hz, 1H), 3.42 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0002332] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002333] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (6.50 g, 13.8 mmol, 1.0 eq.), iron (7.70 g, 138 mmol, 10.0 eq.) and ammonium chloride (3.68 g, 68.9 mmol, 5.0 eq.) in ethanol (60 mL) and water (30 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated to dryness before being re-suspended in ethyl acetate (300 mL), washed with aq. saturated Na ₂ CO ₃ solution (250 mL), and water (250 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (5.04 g, 11.6 mmol, 84% yield) as an orange solid, which was used in the next step without further purification.

[0002334] UPLC-MS (basic 2 min): Rt = 1.08 min; m/z = 435.2 for [M+H] ⁺

[0002335] 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.12 - 8.06 (m, 1H), 7.95 (dt, J = 8.3, 0.9 Hz, 1H), 7.57 (s, 1H), 7.53 (dt, J = 7.7, 1.4 Hz, 1H), 7.52 - 7.47 (m, 2H), 7.46 - 7.40 (m, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.58 (dt, J = 7.7, 2.2 Hz, 2H), 5.40 (s, 2H), 4.94 - 4.84 (m, 1H), 3.36 (dd, J = 13.8, 5.0 Hz, 1H), 2.98 (dd, J = 13.8, 9.9 Hz, 1H).

[0002336] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl]phenyl]- 4-oxo- lH-pyridine-3 -carboxamide

[0002337] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added 4-hydroxynicotinic acid (192 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.6 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT. After 2 h, the reaction mixture was diluted with EtOAc (25 mL) and washed with water (25 mL), aq. saturated Na ₂ CO ₃ solution (25 mL) and water (25 mL). The organics were dried over anhydrous sodium sulfate, filtered, and concentrated to dryness to afford the product (610 mg, 1.10 mmol, 95% yield) as a brown solid, which was used in the next step without further purification.

[0002338] UPLC-MS (basic 2 mm): Rt = 0.97 mm; m/z = 556.2 [M+H] ⁺

[0002339] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]-4-oxo-lH -pyridine-3-carboxamide

[0002340] To a magnetically stirred suspension of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]-4-oxo-lH-pyridine-3-carb oxamide (610 mg, 1.10 mmol, 1.0 eq.) in ethanol (6 mL) was added hydroxylamine hydrochloride (153 mg, 2.20 mmol, 2.0 eq.) and DIPEA (0.6 mL, 3.29 mmol, 3.0 eq.) and the reaction mixture was heated to 85 °C and stirred. After 17 h, the reaction mixture was cooled to RT and concentrated to dryness to afford the product (646 mg, 1.10 mmol, assumed quantitative yield) as a yellow gum, which was used in the next step without further purification.

[0002341] UPLC-MS (basic 2 min): Rt = 0.86 min; m/z = 589.2 [M+H] ⁺

[0002342] Step 7: [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[(4-oxo-lH-pyrid ine-3- carbonyl)amino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate

[0002343] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]phenyl]-4-oxo-lH -pyridine-3-carboxamide (646 mg, 1.10 mmol, 1.0 eq.) in acetic acid (6 mb) was added acetic anhydride (0.30 mL, 3.29 mmol, 3.0 eq.) and the reaction mixture was stirred at RT. After 3 h, the reaction mixture was concentrated to dryness. The crude material was purified by normal phase column chromatography (24 g cartridge) eluting with 0-100% EtOAc in iso-hexane, followed by a gradient of 0-20% 8:2 DCM/MeOH in EtOAc to the product (380 mg, 0.603 mmol, 55% yield) as an off-white solid.

[0002344] UPLC-MS (basic 2 mm): Rt = 0.90 mm; m/z = 631.3 for [M+H] ⁺

[0002345] 1H NMR (400 MHz, DMSO-d6) 5 12.89 (s, 1H), 12.34 (s, 1H), 8.94 (s, 1H), 8.57 (d, J = 1.7 Hz, 1H), 8.05 - 7.98 (m, 1H), 7.94 - 7.85 (m, 3H), 7.58 (t, J = 1.8 Hz, 1H), 7.54 (ddd, J = 7.9, 2.1, 1.3 Hz, 1H), 7.47 - 7.33 (m, 3H), 7.23 (dt, J = 7.7, 1.5 Hz, 1H), 7.18 (t, J = 7.8 Hz, 1H), 7.15 - 7.06 (m, 2H), 6.66 (s, 2H), 6.54 (d, J = 7.2 Hz, 1H), 4.99 (s, 1H), 3.29 (s, 1H), 3.02 (dd, J = 13.9, 9.7 Hz, 1H), 2.11 (s, 3H). aliphatic proton overlap with water

[0002346] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-4-oxo-lH-pyridin e-3-carboxamide

[0002347] To a magnetically stirred solution of [[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3- [(4-oxo-lH-pyridine-3-carbonyl)amino]phenyl]sulfonylamino]et hyl]phenyl]methylene]amino] acetate (380 mg, 0.603 mmol, 1.0 eq.) in acetic acid (5 mL) was added zinc (394 mg, 6.03 mmol, 10.0 eq.) and the resultant suspension was stirred at RT. After 22 h, the reaction mixture was filtered, rinsed with copious EtOH/MeCN/DCM and concentrated to dryness. The residue was purified via preparative-HPLC on a Cl XBridge BEH C18 (19 mm x 150 mm, 5 um) eluting with 27-100% MeCN in 10 mM ammonium bicarbonate (+0.1% NH ₄ OH) to afford the product (75 mg, 0.131 mmol, 22% yield) as an off-white solid.

[0002348] UPLC-MS (acidic 6 mm): Rt = 2.01 mm; m/z = 573.3 for [M+H] ⁺ , 97% purity

[0002349] 1H NMR (400 MHz, DMSO-d6) 5 8.63 (d, J = 0.8 Hz, 1H), 8.10 (ddd, J = 7.9, 1.4, 0.6 Hz, 1H), 7.94 (dt, J = 8.2, 0.9 Hz, 1H), 7.87 (dd, J = 6.3, 0.8 Hz, 1H), 7.77 (ddd, J = 8.1, 2.1, 1.2 Hz, 1H), 7.72 (t, J = 1.8 Hz, 1H), 7.52 - 7.44 (m, 2H), 7.44 - 7.36 (m, 3H), 7.23 (t, J = 7.9 Hz, 1H), 7.20 - 7.11 (m, 2H), 6.37 (d, J = 6.3 Hz, 1H), 4.97 (dd, J = 10.3, 4.6 Hz, 1H), 2.99 (dd, J = 13.8, 10.3 Hz, 1H). - 0.31 wt.% MeCN, CH overlap with water, impurity integrating to 0.18 at 8.46 ppm, exchangeables not observed

[0002350] 1H NMR (400 MHz, DMSO-d6, D ₂ O) 5 8.61 (s, 1H), 8.10 - 8.04 (m, 1H), 7.92 (dt, J = 8.2, 1.6 Hz, 1H), 7.85 (d, J = 6.4 Hz, 1H), 7.68 (s, 1H), 7.66 - 7.59 (m, 2H), 7.53 - 7.45 (m, 1H), 7.42 (td, J = 7.9, 1.3 Hz, 3H), 7.25 - 7.11 (m, 3H), 6.41 (ddd, J = 5.7, 3.8, 1.8 Hz, 1H), 4.97 (dd, J = 10.3, 4.7 Hz, 1H), 3.36 (dd, J = 13.9, 4.7 Hz, 1H), 3.00 (dd, J = 13.9, 10.3 Hz, 1H).

Example 112: Exemplary synthesis of Compound 269

[0002351] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002352] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (15.0 g, 51.7 mmol, 1.0 eq.) and 2-aminothiophenol (6.47 g, 51.7 mmol, 1.0 eq.) in toluene (304 mb) was added DIPEA (27.0 mL, 155 mmol, 3.0 eq.) and stirred for 5 min before the addition of T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 5 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and diluted with EtOAc (300 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-40% EtOAc in DCM to afford the product (10.1 g, 26.6 mmol, 52% yield) as a yellow solid.

[0002353] ¹ H NMR (400 MHz, DMSO-d6) 5 8.12 - 8.07 (m, 1H), 7.98 (dt, J = 8.1, 1.1 Hz, 1H), 7.92 (d, J = 8.8 Hz, 1H), 7.81 (d, J = 1.8 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.48 (m, 3H), 7.44 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.16 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002354] UPLC-MS (basic 2 mm): Rt = 1.22 mm; m/z = 380.2 for [M+H] ⁺

[0002355] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002356] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (10.1 g, 26.6 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (100 mL, 399 mmol, 15.0 eq.) was stirred at RT for 2 h before being concentrated in vacuo to afford the product (9.92 g, 31.4 mmol, assume quantitative yield) as a pink solid.

[0002357] ¹ H NMR (400 MHz, DMSO-d6) 5 9.02 (s, 3H), 8.15 (ddd, J = 8.0, 1.3, 0.6 Hz, 1H), 8.11 - 8.02 (m, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.74 (dt, J = 7.7, 1.4 Hz, 1H), 7.61 - 7.55 (m, 2H), 7.50 (td, J = 7.8, 1.7 Hz, 2H), 5.34 (s, 1H), 3.53 - 3.45 (m, 1H), 3.38 (dd, J = 13.9, 8.4 Hz, 1H).

[0002358] UPLC-MS (basic 2 mm): Rt = 1.02 mm; m/z = 280.1 for [M+H] ⁺

[0002359] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002360] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (3.90 g, 12.3 mmol, 1.0 eq.) in DMF (40.0 mL) was cooled to 0 °C, under a balloon of nitrogen, and triethylamine (5.2 mL, 37.0 mmol, 3.0 eq.) was added. The resulting mixture was stirred for

10 min before the portionwise addition of 3 -nitrophenylsulfonyl chloride (3.28 g, 14.8 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (200 mL) and diluted with EtOAc (250 mL) and brine (100 mL). After separation of the phases, the organics were washed with water (2 x 200 mL, 100 mL of brine was added to each wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then triturated with DCM and air dried to afford the product (2.60 g, 5.60 mmol, 45% yield) as an off- white solid.

[0002361] ¹ H NMR (400 MHz, DMSO-d6). 5 9.36 (s, 1H), 8.19 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.06 (m, 2H), 7.92 - 7.86 (m, 2H), 7.64 (d, J = 1.7 Hz, 1H), 7.60 (d, J = 8.0 Hz, 1H), 7.58 - 7.48 (m, 2H), 7.47 - 7.41 (m, 2H), 7.24 (t, J = 7.7 Hz, 1H), 5.22 - 5.13 (m, 1H), 3.41 (dd, J = 14.0, 4.4 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0002362] UPLC-MS (basic 2 mm): Rt = 1.11 mm; m/z = 465.1 for [M+H] ⁺

[0002363] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002364] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (7.80 g, 13.4 mmol, 1.0 eq.), iron (7.50 g, 134 mmol, 10.0 eq.) and ammonium chloride (3.59 g, 67.2 mmol, 5.0 eq.) in EtOH (30.0 mL) and water (15.0 mL) was stirred, under nitrogen, at 85 °C for 4.5 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious EtOH and DCM. The filtrate was concentrated in vacuo before being re-suspended in EtOAc (250 mL) and aq. saturated Na ₂ CO ₃ (250 mL). After separation of the phases, the organics were washed with further aq. saturated Na ₂ CO ₃ (250 mL) and water (250 mL), before being dried over anhydrous sodium sulfate, filtered and concentrated. The residue was triturated with DCM to afford the product (4.30 g, 9.90 mmol, 74% yield) as a yellow solid.

[0002365] ¹ H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.12 - 8.05 (m, 1H), 7.98 - 7.91 (m, 1H), 7.60 - 7.39 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.62 - 6.54 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.9, 8.1, 4.9 Hz, 1H), 3.36 (dd, J = 13.8, 4.9 Hz, 1H), 2.98 (dd, J = 13.8, 9.9 Hz, 1H.

[0002366] UPLC-MS (basic 2 min): Rt = 1.06 min; m/z = 435.1 for [M+H] ⁺

[0002367] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carboxamide

[0002368] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5.0 mL) was added nicotinic acid (170 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 4 h. The reaction mixture was poured in ice- water (100 mL) and precipitated solid was filtered off and dried under vacuum to afford the product (612 mg, 1.13 mmol, 99% yield) as a brown solid.

[0002369] ¹ H NMR (400 MHz, DMSO-d6) 5 10.54 (s, 1H), 9.14 (d, J = 2.3 Hz, 1H), 9.03 (d, J = 8.2 Hz, 1H), 8.82 - 8.75 (m, 1H), 8.32 (dt, J = 8.0, 2.0 Hz, 1H), 8.10 (dd, J = 8.0, 1.3 Hz, 1H), 8.03 (t, J = 2.0 Hz, 1H), 7.95 (dd, J = 8.0, 1.3 Hz, 1H), 7.79 (ddd, J = 8.2, 2.2, 1.1 Hz, 1H), 7.64 - 7.50 (m, 2H), 7.55 - 7.39 (m, 4H), 7.37 - 7.25 (m, 1H), 7.25 - 7.17 (m, 2H), 4.98 (ddd, J = 10.6, 8.2, 4.3 Hz, 1H), 3.40 (dd, J = 13.9, 4.3 Hz, 1H), 3.05 - 2.93 (m, 1H).

[0002370] UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 540.2 [M+H] ⁺

[0002371] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]pyridine- 3-carboxamide

[0002372] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carboxamide (612 mg, 1.13 mmol, 1.0 eq.) in EtOH (12.0 mL) was added hydroxylamine hydrochloride (158 mg, 2.27 mmol, 2.0 eq.) and DIPEA (0.59 mL, 3.40 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 4 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (620 mg, 1.08 mmol, assumed quantitative yield), as a light brown solid, which was used in the next step without further purification.

[0002373] UPLC-MS (basic 2 mm): Rt = 0.94 mm; m/z = 573.1 for [M+H] ⁺

[0002374] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(pyridine-3- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate

[0002375] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]pyridine- 3-carboxamide (620 mg, 1.08 mmol, 1.0 eq.) in acetic acid (11.0 mL) was added acetic anhydride (0.31 mL, 3.25 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 5 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (40 g cartridge) eluting with 0-100% EtOAc in iso-hexane to afford the product (390 mg, 0.634 mmol, 59% yield) as a white solid.

[0002376] ¹ H NMR (400 MHz, DMSO-d6) 5 10.42 (s, 1H), 9.09 - 9.03 (m, 1H), 8.91 (d, J = 8.0 Hz, 1H), 8.75 (ddd, J = 4.8, 1.7, 0.7 Hz, 1H), 8.30 - 8.22 (m, 1H), 8.05 - 7.97 (m, 2H), 7.91 - 7.84 (m, 1H), 7.69 (dt, J = 7.6, 1.8 Hz, 1H), 7.59 - 7.54 (m, 2H), 7.46 - 7.32 (m, 3H), 7.19 (dq, J = 9.6, 7.8 Hz, 3H), 7.06 (t, J = 7.7 Hz, 1H), 6.64 (s, 2H), 4.91 (td, J = 9.1, 5.3 Hz, 1H), 3.26 (s, 1H), 3.13 (dd, J = 5.2, 0.7 Hz, 1H), 2.97 (dd, J = 13.8, 9.9 Hz, 1H), 2.07 (d, J = 0.8 Hz, 3H).

[0002377] UPLC-MS (basic 2 mm): Rt = 0.98 mm; m/z = 615.2 for [M+H] ⁺

[0002378] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carbox amide

[0002379] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [ [3 -(pyridine-3 -carbonylamino)phenyl] sulfonylamino] ethyl] phenyl] methylene]amino] acetate (390 mg, 0.634 mmol, 1.0 eq.) in acetic acid (2.0 mL) was added zinc (830 mg, 12.7 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 20 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was submitted for purification via reverse phase preparative HPLC on a Waters XBridge C18 (19 mm x 150 mm, 5 pm) eluting with 5-100% MeCN in water (0.1% NH ₄ OH) to afford the product (145 mg, 0.247 mmol, 39% yield) as a white solid.

[0002380] ¹ H NMR (400 MHz, DMSO-d6) 5 9.06 (d, J = 2.7 Hz, 1H), 8.73 (dd, J = 4.8, 1.7 Hz, 1H), 8.26 (dt, J = 8.0, 2.0 Hz, 1H), 8.01 - 7.91 (m, 2H), 7.82 (d, J = 8.0 Hz, 1H), 7.69 (dt, J = 7.2, 2.2 Hz, 1H), 7.63 (s, 1H), 7.54 (dd, J = 8.0, 4.7 Hz, 1H), 7.44 (d, J = 7.8 Hz, 1H), 7.38 (td, J = 7.6, 1.3 Hz, 1H), 7.30 (td, J = 7.6, 1.3 Hz, 1H), 7.24 (d, J = 7.7 Hz, 1H), 7.22 - 7.08 (m, 3H),

4.81 (dd, J = 8.8, 4.8 Hz, 1H), 3.22 (dd, J = 13.5, 4.8 Hz, 1H), 2.99 (dd, J = 13.4, 8.9 Hz, 1H). - residual MeCN (0.22 wt%)

[0002381] UPLC-MS (basic 6 mm): Rt = 2.23 mm; m/z = 552.3 for [M+H] ⁺

[0002382] Step 9: N-[3-[[(lR)-l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carbox amide

[0002383] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carbox amide (145 mg, 0.247 mmol, 1.0 eq.) was submitted to Reach for chiral purification via SFC on a Lux iC5 (20mm x 250mm, 5um), eluting with 50:50 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the product (51.0 mg, 0.0916 mmol, 37% yield) as an off-white solid.

[0002384] ¹ H NMR (400 MHz, DMSO-d6) 59.11 (d, J = 3.0 Hz, 1H), 8.77 (dd, J = 4.8, 1.7 Hz, 1H), 8.31 (dt, J = 7.9, 1.8 Hz, 1H), 8.01 - 7.98 (m, 2H), 7.89 - 7.85 (m, 1H), 7.74 (dt, J = 7.3, 2.0 Hz, 1H), 7.66 (d, J = 1.7 Hz, 1H), 7.60 - 7.56 (m, 1H), 7.49 - 7.46 (m, 1H), 7.43 (ddd, J = 8.2, 7.1, 1.3 Hz, 1H), 7.35 (ddd, J = 8.4, 7.2, 1.3 Hz, 1H), 7.29 (d, J = 7.7 Hz, 1H), 7.23 - 7.13 (m, 3H), 4.86 (dd, J = 9.1, 4.9 Hz, 1H), 3.02 (dd, J = 13.6, 9.0 Hz, 1H).

[0002385] IHNMR-D2O (400 MHz, DMSO-d6) 5 9.00 (dq, J = 2.9, 1.6 Hz, 1H), 8.73 (dd, J = 4.8, 1.6 Hz, 1H), 8.25 (ddd, J = 8.0, 3.7, 1.5 Hz, 1H), 7.93 (dd, J = 8.0, 1.5 Hz, 1H), 7.85 (s, 1H),

7.82 (dd, J = 8.7, 1.2 Hz, 1H), 7.61 - 7.56 (m, 3H), 7.41 (ddt, J = 7.1, 4.9, 2.1 Hz, 2H), 7.34 (td, J

= 7.8, 1.4 Hz, 1H), 7.30 (d, J = 6.5 Hz, 1H), 7.22 - 7.12 (m, 3H), 4.81 - 4.75 (m, 1H), 3.20 (dd, J = 13.4, 4.3 Hz, 1H), 2.98 (dd, J = 13.5, 9.0 Hz, 1H).

[0002386] UPLC-MS (basic 6 min): Rt = 2.33 min; m/z = 557.1 for [M+H] ⁺

Example 111: Exemplary synthesis of Compound 269

[0002387] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002388] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (15.0 g, 51.7 mmol, 1.0 eq.) and 2-aminothiophenol (6.47 g, 51.7 mmol, 1.0 eq.) in toluene (304 mb) was added DIPEA (27.0 mL, 155 mmol, 3.0 eq.) and stirred for 5 min before the addition of T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 5 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and diluted with EtOAc (300 ml) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-40% EtOAc in DCM to afford the product (10.1 g, 26.6 mmol, 51.5% yield) as a yellow solid.

[0002389] ¹ H NMR (400 MHz, DMSO-d6) 5 8.12 - 8.07 (m, 1H), 7.98 (dt, J = 8.1, 1.1 Hz, 1H), 7.92 (d, J = 8.8 Hz, 1H), 7.81 (d, J = 1.8 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.48 (m, 3H), 7.44 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.16 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002390] UPLC-MS (basic 2 mm): Rt = 1.22 mm; m/z = 380.2 for [M+H] ⁺

[0002391] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002392] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (10.1 g, 26.6 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (100 mL, 399 mmol, 15.0 eq.) was stirred at RT for 2 h before being concentrated in vacuo to afford the product (9.92 g, 31.4 mmol, assumed quantitative yield) as a pink solid.

[0002393] ¹ H NMR (400 MHz, DMSO-d6) 5 9.02 (s, 3H), 8.15 (ddd, J = 8.0, 1.3, 0.6 Hz, 1H), 8.11 - 8.02 (m, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.74 (dt, J = 7.7, 1.4 Hz, 1H), 7.61 - 7.55 (m, 2H), 7.50 (td, J = 7.8, 1.7 Hz, 2H), 5.34 (s, 1H), 3.53 - 3.45 (m, 1H), 3.38 (dd, J = 13.9, 8.4 Hz, 1H).

[0002394] UPLC-MS (basic 2 mm): Rt = 1.02 mm; m/z = 280.1 for [M+H] ⁺

[0002395] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002396] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (3.90 g, 12.3 mmol, 1.0 eq.) in DMF (40.0 mL) was cooled to 0 °C, under a balloon of nitrogen, and triethylamine (5.2 mL, 37.0 mmol, 3.0 eq.) was added. The resulting mixture was stirred for 10 min before the portionwise addition of 3 -nitrophenylsulfonyl chloride (3.28 mg, 14.8 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (200 mL) and diluted with EtOAc (250 mL) and brine (100 mL). After separation of the phases, the organics were washed with water (2 x 200 mL, 100 mL of brine was added to each wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then triturated with DCM and air dried to afford the product (2.60 g, 5.60 mmol, 45% yield) as an off- white solid.

[0002397] ¹ H NMR (400 MHz, DMSO-d6). 5 9.36 (s, 1H), 8.19 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.06 (m, 2H), 7.92 - 7.86 (m, 2H), 7.64 (d, J = 1.7 Hz, 1H), 7.60 (d, J = 8.0 Hz, 1H), 7.58 - 7.48 (m, 2H), 7.47 - 7.41 (m, 2H), 7.24 (t, J = 7.7 Hz, 1H), 5.22 - 5.13 (m, 1H), 3.41 (dd, J = 14.0, 4.4 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0002398] UPLC-MS (basic 2 mm): Rt = 1.11 mm; m/z = 465.1 for [M+H] ⁺

[0002399] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002400] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (7.80 g, 13.4 mmol, 1.0 eq.), iron (7.50 g, 134 mmol, 10.0 eq.) and ammonium chloride (3.59 g, 67.2 mmol, 5.0 eq.) in EtOH (30.0 mL) and water (15.0 mL) was stirred, under nitrogen, at 85 °C for 4.5 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious EtOH and DCM. The filtrate was concentrated in vacuo before being re-suspended in EtOAc (250 mL) and aq. saturated Na ₂ CO ₃ (250 mL). After separation of the phases, the organics were washed with further aq. saturated Na ₂ CO ₃ (250 mL) and water (250 mL), before being dried over anhydrous sodium sulfate, filtered and concentrated. The residue was triturated with DCM to afford the product (4.30 g, 9.90 mmol, 74% yield) as a yellow solid.

[0002401] ¹ H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.12 - 8.05 (m, 1H), 7.98 - 7.91 (m, 1H), 7.60 - 7.39 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.62 - 6.54 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.9, 8.1, 4.9 Hz, 1H), 3.36 (dd, J = 13.8, 4.9 Hz, 1H), 2.98 (dd, J = 13.8, 9.9 Hz, 1H.

[0002402] UPLC-MS (basic 2 mm): Rt = 1.06 mm; m/z = 435.1 for [M+H] ⁺

[0002403] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carboxamide

[0002404] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5.0 mL) was added nicotinic acid (170 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 4 h. The reaction mixture was poured in ice- water (100 mL) and precipitated solid was filtered off and dried under vacuum to the product (612 mg, 1.13 mmol, 99% yield) as a brown solid.

[0002405] ¹ H NMR (400 MHz, DMSO-d6) 5 10.54 (s, 1H), 9.14 (d, J = 2.3 Hz, 1H), 9.03 (d, J = 8.2 Hz, 1H), 8.82 - 8.75 (m, 1H), 8.32 (dt, J = 8.0, 2.0 Hz, 1H), 8.10 (dd, J = 8.0, 1.3 Hz, 1H), 8.03 (t, J = 2.0 Hz, 1H), 7.95 (dd, J = 8.0, 1.3 Hz, 1H), 7.79 (ddd, J = 8.2, 2.2, 1.1 Hz, 1H), 7.64 - 7.50 (m, 2H), 7.55 - 7.39 (m, 4H), 7.37 - 7.25 (m, 1H), 7.25 - 7.17 (m, 2H), 4.98 (ddd, J = 10.6, 8.2, 4.3 Hz, 1H), 3.40 (dd, J = 13.9, 4.3 Hz, 1H), 3.05 - 2.93 (m, 1H).

[0002406] UPLC-MS (basic 2 mm): Rt = 1.07 mm; m/z = 540.2 [M+H] ⁺

[0002407] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]pyridine- 3-carboxamide

[0002408] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carboxamide (612 mg, 1.13 mmol, 1.0 eq.) in EtOH (12.0 mL) was added hydroxylamine hydrochloride (158 mg, 2.27 mmol, 2.0 eq.) and DIPEA (0.59 mL, 3.40 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 4 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (620 mg, 1.08 mmol, assumed quantitative yield), as a light brown solid, which was used in the next step without further purification.

[0002409] UPLC-MS (basic 2 mm): Rt = 0.94 mm; m/z = 573.1 for [M+H] ⁺

[0002410] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(pyridine-3- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate

[0002411] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]pyridine- 3-carboxamide (620 mg, 1.08 mmol, 1.0 eq.) in acetic acid (11.0 mL) was added acetic anhydride (0.31 mL, 3.25 mmol, 3.0 eq.) and the reaction mixture was stirred at RT for 5 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (40 g cartridge) eluting with 0-100% EtOAc in iso-hexane to afford the product (390 mg, 0.634 mmol, 59% yield) as a white solid.

[0002412] ¹ H NMR (400 MHz, DMSO-d6) 5 10.42 (s, 1H), 9.09 - 9.03 (m, 1H), 8.91 (d, J = 8.0 Hz, 1H), 8.75 (ddd, J = 4.8, 1.7, 0.7 Hz, 1H), 8.30 - 8.22 (m, 1H), 8.05 - 7.97 (m, 2H), 7.91 - 7.84 (m, 1H), 7.69 (dt, J = 7.6, 1.8 Hz, 1H), 7.59 - 7.54 (m, 2H), 7.46 - 7.32 (m, 3H), 7.19 (dq, J = 9.6, 7.8 Hz, 3H), 7.06 (t, J = 7.7 Hz, 1H), 6.64 (s, 2H), 4.91 (td, J = 9.1, 5.3 Hz, 1H), 3.26 (s, 1H), 3.13 (dd, J = 5.2, 0.7 Hz, 1H), 2.97 (dd, J = 13.8, 9.9 Hz, 1H), 2.07 (d, J = 0.8 Hz, 3H).

[0002413] UPLC-MS (basic 2 mm): Rt = 0.98 mm; m/z = 615.2 for [M+H] ⁺

[0002414] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carbox amide

[0002415] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [ [3 -(pyridine-3 -carbonylamino)phenyl] sulfonylamino] ethyl] phenyl] methylene]amino] acetate (390 mg, 0.634 mmol, 1.0 eq.) in acetic acid (2.0 mL) was added zinc (830 mg, 12.7 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 20 h. The reaction mixture was filtered, washing with copious MeCN and EtOH and concentrated to dryness. The residue was submitted for purification via reverse phase preparative HPLC on a Waters XBridge C18 (19 mm x 150 mm, 5 pm) eluting with 5-100% MeCN in water (0.1% NH ₄ OH) to afford the product (145 mg, 0.247 mmol, 39% yield) as a white solid.

[0002416] ¹ H NMR (400 MHz, DMSO-d6) 5 9.06 (d, J = 2.7 Hz, 1H), 8.73 (dd, J = 4.8, 1.7 Hz, 1H), 8.26 (dt, J = 8.0, 2.0 Hz, 1H), 8.01 - 7.91 (m, 2H), 7.82 (d, J = 8.0 Hz, 1H), 7.69 (dt, J = 7.2, 2.2 Hz, 1H), 7.63 (s, 1H), 7.54 (dd, J = 8.0, 4.7 Hz, 1H), 7.44 (d, J = 7.8 Hz, 1H), 7.38 (td, J = 7.6, 1.3 Hz, 1H), 7.30 (td, J = 7.6, 1.3 Hz, 1H), 7.24 (d, J = 7.7 Hz, 1H), 7.22 - 7.08 (m, 3H), 4.81 (dd, J = 8.8, 4.8 Hz, 1H), 3.22 (dd, J = 13.5, 4.8 Hz, 1H), 2.99 (dd, J = 13.4, 8.9 Hz, 1H).

[0002417] UPLC-MS (basic 6 mm): Rt = 2.23 mm; m/z = 552.3 for [M+H] ⁺

[0002418] Step 9: N-[3-[[(lS)-l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carbox amide

[0002419] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]pyridine-3-carbox amide (145 mg, 0.247 mmol, 1.0 eq.) was submitted to Reach for chiral purification via SFC on a Lux iC5 (20mm x 250mm, 5um), eluting with 50:50 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the product (49.0 mg, 0.0871 mmol, 35% yield) as an off-white solid.

[0002420] ¹ H NMR (400 MHz, DMSO-d6) 5 9.11 (s, 1H), 8.77 (d, J = 3.8 Hz, 1H), 8.31 (d, J = 7.8 Hz, 1H), 8.00 (t, J = 3.2 Hz, 2H), 7.87 (d, J = 7.8 Hz, 1H), 7.73 (d, J = 6.7 Hz, 1H), 7.65 (s, 1H), 7.58 (dd, J = 7.7, 4.8 Hz, 1H), 7.47 (d, J = 7.9 Hz, 1H), 7.43 (ddd, J = 8.2, 7.2, 1.3 Hz, 1H), 7.36 (td, J = 7.7, 1.3 Hz, 1H), 7.29 (d, J = 7.6 Hz, 1H), 7.24 - 7.12 (m, 3H), 4.87 (dd, J = 8.9, 4.8

Hz, 1H), 3.02 (dd, J = 13.5, 9.0 Hz, 1H). - residual EtOH (2.87 wt%); CH not observed; exchangeables not seen

[0002421] ¹ H NMR-D2O (400 MHz, DMSO-d6) 5 8.98 (d, J = 2.4 Hz, 1H), 8.73 - 8.70 (m, 1H), 8.24 (dd, J = 8.0, 2.5 Hz, 1H), 7.94 - 7.90 (m, 1H), 7.81 (dd, J = 5.7, 2.3 Hz, 2H), 7.59 (d, J = 4.9 Hz, 1H), 7.57 (dd, J = 3.4, 1.5 Hz, 2H), 7.42 (dd, J = 7.1, 1.3 Hz, 1H), 7.39 (d, J = 1.5 Hz, 1H), 7.35 (dd, J = 7.9, 1.1 Hz, 1H), 7.33 - 7.30 (m, 1H), 7.19 - 7.16 (m, 3H), 4.81 - 4.75 (m, 1H), 3.20 (dd, J = 13.7, 4.1 Hz, 1H), 2.98 (dd, J = 13.5, 9.3 Hz, 1H).

[0002422] UPLC-MS (basic 6 min): Rt = 2.35 min; m/z = 557.1 for [M+H] ⁺

Example 114: Exemplary synthesis of Compound 102

[0002423] Step 1: tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-oxo-ethyl]carbamate

[0002424] To a stirred solution of 2-(tert-butoxycarbonylamino)-3-(3-cyanophenyl)propanoic acid (17.0 g, 58.6 mmol, 1.0 eq.) in DMF (140 mL) was added DIPEA (31.0 mL, 176 mmol, 3.0 eq.), ammonium chloride (7.83 g, 146 mmol, 2.5 eq.) and HATU (33.4 g, 87.8 mmol, 1.5 eq.) and the resultant solution was stirred at RT for 1.5 h. The reaction mixture was quenched with ice-cold water and the precipitated solid was filtered off. The residue was dried overnight in a vacuum oven to afford product (17.3 g, 59.7 mmol, assumed quantitative yield) as an off-white solid.

[0002425] 1H NMR (400 MHz, DMSO-d6) 5 7.70 - 7.65 (m, 2H), 7.63 - 7.59 (m, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.39 (s, 1H), 7.06 (s, 1H), 6.90 (d, J = 9.1 Hz, 1H), 4.11 (td, J = 10.4, 4.1 Hz, 1H), 3.03 (dd, J = 13.8, 4.1 Hz, 1H), 2.76 (dd, J = 13.5, 10.3 Hz, 1H), 1.28 (s, 9H).

[0002426] UPLC-MS (basic 2 mm): Rt = 0.90 mm; m/z = 288.1 for [M+H] ⁺

[0002427] Step 2: tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-thioxo-ethyl]carbamat e

[0002428] To a magnetically stirred solution of tert-butyl N-[2-amino-l-[(3- cyanophenyl)methyl]-2-oxo-ethyl] carbamate (17.3 g, 59.7 mmol, 1.0 eq.) in THF (200 mL) was added La wesson reagent (29.0 g, 71.7 mmol, 1.2 eq.) and the resultant mixture stirred at RT for 20 h. The reaction mixture was filtered and the filtrate was concentrated in vacuo. The residue was suspended in EtOAc (200 mL) and aq. saturated Na ₂ CO ₃ solution (400 mL). The organics were extracted with EtOAc (3 x 200 mL) and after separation of the phases, the organics were washed with brine (200 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by normal phase column chromatography (330 g cartridge) eluting with 0-30% EtOAc in DCM to afford the product (7.96 g, 26.0 mmol, 44% yield) as a yellow solid.

[0002429] ¹ H NMR analysis (400 MHz, DMSO-d6) 5 9.64 (s, 1H), 9.28 - 9.23 (m, 1H), 7.74 (s, 1H), 7.68 (d, J = 7.7 Hz, 1H), 7.64 (d, J = 7.9 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 6.92 (d, J = 8.9 Hz, 1H), 4.43 (td, J = 9.5, 4.4 Hz, 1H), 3.04 (dd, J = 13.4, 4.8 Hz, 1H), 2.85 (dd, J = 13.5, 9.9 Hz, 1H), 1.29 (s, 9H).

[0002430] UPLC-MS (basic 4 mm): Rt = 1.59 mm; m/z = 306.2 for [M+H]

[0002431] Step 3: tert-butyl N-[2-(3-cyanophenyl)-l-(4-hydroxy-4,5-dihydrothiazol-2- y 1) ethyl] carbamate

[0002432] Bromoacetaldehyde diethylacetal (15.4 g, 78.1 mmol, 3.0 eq.) in water (40.0 mL) was hydrolyzed by stirring with concentrated hydrogen chloride solution (5.4 mL, 156 mmol, 6.0 eq.) at 60 °C for 30 min. The mixture was cooled to RT and added to a magnetically stirred suspension of sodium hydrogen carbonate (21.9 g, 260 mmol, 10.0 eq.) in THF (120 mL) and stirred for 15 min. Then tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-thioxo- ethyl] carbamate (7.96 g, 26.0 mmol, 1.0 eq.) was added and stirred for 18 h at RT. The reaction was diluted in EtOAc (200 mL) and water (200 mL). After separation of the phases, the organics were washed with brine (200 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was dried in the vacuum overnight to afford the product (8.45 g, 24.3 mmol, 93% yield) as a beige solid.

[0002433] ¹ H NMR (400 MHz, DMSO-d6) 5 7.69 (d, J = 6.0 Hz, 2H), 7.67 - 7.65 (m, 1H), 7.61 (d, J = 7.9 Hz, 1H), 7.50 (q, J = 7.8 Hz, 2H), 7.44 (d, J = 9.1 Hz, 1H), 6.41 (d, J = 6.0 Hz, 1H), 5.96 - 5.89 (m, 1H), 4.56 - 4.49 (m, 1H), 3.48 - 3.42 (m, 2H), 3.23 (dd, J = 13.7, 4.2 Hz, 1H), 2.98 - 2.93 (m, 1H), 2.89 (dd, J = 13.7, 11.1 Hz, 1H), 1.27 (s, 9H).

[0002434] UPLC-MS (basic 2 mm): Rt = 0.97 mm; m/z = 348.2 for [M+H] ⁺ ; Rt = 1.09 mm; m/z = 330.2 for [M+H] ⁺ (product obtained as a mixture of desired material and dehydrated material)

[0002435] Step 4: 3-(2-amino-2-thiazol-2-yl-ethyl)benzonitrile hydrochloride

[0002436] To a stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(4-hydroxy-4,5- dihydrothiazol-2-yl)ethyl]carbamate (8.45 g, 24.3 mmol, 1.0 eq.) in 1,4-dioxane (250 mL) was slowly added hydrogen chloride solution (250 mL, 720 mmol, 29.6 eq.) with the resulting mixture being stirred at RT for 3 h. The reaction mixture was concentrated, dissolved in 1 ,4- dioxane (150.0 mL), redosed with hydrogen chloride solution (250 mL, 720 mmol, 29.6 eq.) and stirred at RT for 96 h. The mixture was diluted with excess Et ₂ O, and the precipitate that formed was collected by filtration, washed with copious Et ₂ O and dried in vacuo to afford the product (6.27 g, 23.6 mmol, 97% yield) as a light brown solid.

[0002437] ¹ H NMR (400 MHz, DMSO-d6) 5 8.86 (s, 3H), 7.90 (d, J = 3.2 Hz, 1H), 7.79 (d, J = 3.3 Hz, 1H), 7.72 (ddd, J = 6.1, 2.7, 1.6 Hz, 1H), 7.69 (p, J = 1.6 Hz, 1H), 7.53 - 7.47 (m, 2H), 5.23 - 5.15 (m, 1H), 3.44 (dd, J = 13.8, 6.2 Hz, 1H), 3.29 (dd, J = 13.7, 8.7 Hz, 1H).

[0002438] UPLC-MS (basic 2 mm): Rt = 0.84 mm; m/z = 230.2 for [M+H] ⁺

[0002439] Step 5: N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]-3-nitro-benzenesu lfonamide

[0002440] To a solution of 3-(2-amino-2-thiazol-2-yl-ethyl)benzonitrile;hydrochloride (4.00 g,

15.1 mmol, 1.0 eq.) in DMF (16.0 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of TEA (6.3 mL, 45.2 mmol, 3.0 eq.). The resulting mixture was then stirred for 10 min before the portionwise addition of 3 -nitrophenylsulfonyl chloride (4.00 g, 18.1 mmol, 1.2 eq.) over a 10 min period. The reaction was allowed to stir at the same temperature for 1 h before being allowed to warm to RT and stirred for 16 h. The reaction was quenched via the addition of water (100 mL) and the organics were extracted with EtOAc (2 x 100 mL), washed with brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The crude material was suspended in DCM and the product crashed out upon addition of iso-hexane to afford the product (3.40 g, 8.20 mmol, 55% yield) as a brown solid.

[0002441] ¹ H NMR (400 MHz, DMSO-d6). 5 9.21 (d, J = 8.7 Hz, 1H), 8.31 (ddd, J = 8.3, 2.3,

1.1 Hz, 1H), 8.08 (td, J = 2.0, 2.0 Hz, 1H), 7.87 (ddd, J = 7.8, 1.8, 1.0 Hz, 1H), 7.69 (d, J = 3.3 Hz, 1H), 7.66 (d, J = 7.9 Hz, 1H), 7.63 - 7.62 (m, 1H), 7.57 (t, J = 1.7 Hz, 1H), 7.49 (dt, J = 7.8, 1.6 Hz, 1H), 7.42 (dt, J = 7.7, 1.4 Hz, 1H), 7.23 (t, J = 7.8 Hz, 1H), 5.05 (ddd, J = 10.7, 8.7, 4.6 Hz, 1H), 3.30 (d, J = 4.9 Hz, 1H), 2.95 (dd, J = 13.9, 10.7 Hz, 1H).

[0002442] UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 413.1 for [M+H] ⁺

[0002443] Step 6: 3-amino-N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]benzenesul fonamide

[0002444] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]-3- nitro-benzenesulfonamide (3.40 g, 8.20 mmol, 1.0 eq.) in EtOH (20.0 mL) and water (10.0 mL) was added iron (4.58 g, 82.0 mmol, 10.0 eq.) and ammonium chloride (2.19 g, 41.0 mmol, 5.0 eq.) and the resultant mixture was heated to 85 °C, under a balloon of nitrogen, and stirred for 4 h. The reaction mixture was cooled to RT, filtered over Celite and rinsed with copious EtOH and DCM and concentrated in vacuo. The residue was re-suspended in EtOAc (100 mL) and aq. saturated Na ₂ CO ₃ (100 mL). After separation of the phases, the organics were dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to afford the product (2.26 g, 5.88 mmol, 72% yield) as a tan-beige foam.

[0002445] ¹ H NMR (400 MHz, DMSO-d6) 5 8.55 (s, 1H), 7.70 (d, J = 3.2 Hz, 1H), 7.61 (dd, J = 3.2, 0.7 Hz, 1H), 7.57 - 7.48 (m, 2H), 7.44 (dt, J = 7.8, 1.4 Hz, 1H), 7.34 (t, J = 7.7 Hz, 1H), 6.96 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.60 (tdd, J = 8.8, 2.1, 1.0 Hz, 2H), 5.41 (s, 2H), 4.78 (s, 1H), 3.26 (dd, J = 13.7, 5.4 Hz, 1H), 2.90 (dd, J = 13.7, 9.3 Hz, 1H).

[0002446] UPLC-MS (basic 2 mm): Rt = 0.93 mm; m/z = 385.2 for [M+H] ⁺

[0002447] Step 7: tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[0002448] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl]benzenesulfonamide (1.00 g, 2.60 mmol, 1.0 eq.) in anhydrous DMF (15.0 mL) was added N-boc-beta-alanine (0.59 g, 3.12 mmol, 1.2 eq.) and DIPEA (1.4 mL, 7.80 mmol, 3.0 eq.), shortly followed by HATU (1.48 g, 3.90 mmol, 1.5 eq.) and left to stir at RT for 1.5 h. The reaction was redosed with N-boc-beta-alanine (0.590 g, 3.12 mmol, 1.2 eq.), DIPEA (1.4 mL, 7.80 mmol, 3.0 eq.) and HATU (1.48 g, 3.90 mmol, 1.5 eq.) and stirred at RT for 5 h. The reaction mixture was diluted with EtOAc (50.0 mL) and washed with brine (50.0 mL), aq. saturated Na ₂ CO ₃ (50.0 mL), and brine again (50.0 mL). The organics were dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by column chromatography over silica (40 g cartridge) eluting with 40-100% EtOAc in iso-hexane to afford the product (2.03 g, 3.65 mmol, assume quantitative yield) as an orange oil.

[0002449] ¹ H NMR (400 MHz, DMSO-d6) 5 10.09 (s, 1H), 8.82 (d, J = 8.4 Hz, 1H), 7.83 (t, J = 1.9 Hz, 1H), 7.72 (d, J = 3.3 Hz, 1H), 7.63 (d, J = 3.2 Hz, 1H), 7.59 - 7.54 (m, 1H), 7.49 (t, J = 1.6 Hz, 1H), 7.43 (dd, J = 7.6, 1.8 Hz, 2H), 7.28 - 7.19 (m, 2H), 7.11 (ddd, J = 7.8, 1.8, 1.1 Hz, 1H), 6.89 (t, J = 5.5 Hz, 1H), 4.81 (ddd, J = 10.4, 8.4, 4.7 Hz, 1H), 3.31 - 3.21 (m, 3H), 2.89 (dd, J = 13.8, 10.2 Hz, 1H), 2.53 - 2.51 (m, 2H), 1.38 (s, 9H).

[0002450] UPLC-MS (basic 2 min): Rt = 1.04 min; m/z = 556.3 [M+H] ⁺

[0002451] Step 8: tert-butyl N-[3-[3-[[2-[3-[(E)-N'-hydroxycarbamimidoyl]phenyl]-l-thiazo l-2- yl-ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[0002452] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l- thiazol-2-yl-ethyl]sulfamoyl]anilino]-3-oxo-propyl]carbamate (1.45 g, 2.60 mmol, 1.0 eq.) in EtOH (20.0 mL) was added hydroxylamine hydrochloride (361 mg, 5.20 mmol, 2.0 eq.) and DIPEA (1.4 mL, 7.80 mmol, 3.0 eq.) with the resultant mixture heated to 85 °C for 16 h. The mixture was cooled to RT and concentrated to dryness under reduced pressure to afford the product (1.53 g, 2.60 mmol, assume quantitative yield) as a yellow oil, which was used in the next step without further purification.

[0002453] UPLC-MS (basic 2 mm): Rt = 0.94 mm; m/z = 589.3 for [M+H] ⁺

[0002454] Step 9: [(E)- [amino- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-thiazol -2-yl- ethyl]phenyl]methylene]amino] acetate

[0002455] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]-l-thiazol-2-yl-ethyl]sulfamoyl] anilino]-3-oxo-propyl]carbamate (1.53 g, 2.60 mmol, 1.0 eq.) in acetic acid (20.0 mL) was added acetic anhydride (0.750 mL, 7.93 mmol, 3.0 eq.). The reaction was left to stir at RT for 4.5 h. The reaction mixture was concentrated to dryness under reduced pressure with the crude material being purified by normal-phase column chromatography over silica (40 g cartridge) eluting with a gradient of 40- 100% EtOAc in Ao-hexane to afford the (1.59 g, 2.52 mmol, 97% yield) as a yellow oil.

[0002456] ¹ H NMR (400 MHz, DMSO-d6) 5 10.06 (s, 1H), 8.77 (d, J = 8.3 Hz, 1H), 7.89 (t, J = 2.0 Hz, 1H), 7.65 (d, J = 3.3 Hz, 1H), 7.56 (d, J = 3.3 Hz, 2H), 7.49 (t, J = 1.8 Hz, 1H), 7.43 (dt, J = 7.3, 1.7 Hz, 1H), 7.22 (t, J = 8.0 Hz, 1H), 7.16 (dt, J = 7.7, 1.6 Hz, 1H), 7.13 (d, J = 7.6 Hz, 1H), 7.11 - 7.08 (m, 1H), 6.87 (t, 1H), 6.69 (s, 2H), 4.82 (td, 1H), 3.26 - 3.18 (m, 3H), 2.95 - 2.88 (m, 1H), 2.15 (s, 3H), 1.38 (s, 9H), 1.27 - 1.23 (m, 2H). - residual EtOAc (25.6 wt%), DCM (0.38 wt%) and TMU (2.61 wt%)

[0002457] UPLC-MS (basic 2 min): Rt = 0.98 min; m/z = 631.4 for [M+H] ⁺

[0002458] Step 10: tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[0002459] To a magnetically stirred solution of [(E)-[amino-[3-[2-[[3-[3-(tert- butoxycarbonylamino)propanoylamino]phenyl]sulfonylamino]-2-t hiazol-2-yl- ethyl]phenyl]methylene]amino] acetate (1.59 g, 2.52 mmol, 1.0 eq.) in acetic acid (25.0 mL) was added zinc (3.30 g, 50.4 mmol, 20.0 eq.) and the resultant suspension was stirred at RT for 16 h. The reaction mixture was filtered through Celite, washing with copious MeCN, EtOH and DCM and the filtrate was concentrated in vacuo.

[0002460] The residue was submitted to Reach for chiral purification via SFC on a Lux iC5 (30mm x 250mm, 5um) with 45:55 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the product (279 mg, 0.487 mmol, 19% yield) as an off-white solid.

[0002461] UPLC-MS (basic 4 mm): Rt = 1.52 mm; m/z = 573.2 for [M+H] ⁺

[0002462] Step 11: 3-amino-N-[3-[[rac-(lR)-2-(3-carbamimidoylphenyl)-l-thiazol- 2-yl- ethyl]sulfamoyl]phenyl]propenamide

[0002463] To a stirred solution of tert-butyl N-[3-oxo-3-[3-[[rac-(lR)-2-(3- carbamimidoylphenyl)-l-thiazol-2-yl-ethyl]sulfamoyl]anilino] propyl]carbamate (279 mg, 0.487 mmol, 1.0 eq.) in 1,4-dioxane (4.0 mL) was added hydrogen chloride solution (2.0 mL, 8.00 mmol, 16.4 mL) and the resultant suspension was stirred at RT for 6 h. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in water before being concentrated under reduced pressure and dried in the vacuum oven overnight to obtain the product (253 mg, 0.464 mmol, assume quantitative) as beige flakes.

[0002464] ¹ H NMR (400 MHz, DMSO-d6) 5 10.52 (s, 1H), 9.27 (s, 2H), 9.19 - 9.15 (m, 2H),

8.82 (d, J = 8.2 Hz, 1H), 8.03 (s, 3H), 7.91 (t, J = 2.0 Hz, 1H), 7.73 - 7.71 (m, 1H), 7.66 (t, J = 1.9 Hz, 1H), 7.63 (d, J = 3.2 Hz, 1H), 7.59 - 7.53 (m, 2H), 7.40 (dt, J = 7.7, 1.3 Hz, 1H), 7.22 (td, J = 7.9, 6.4 Hz, 2H), 7.12 (ddd, J = 7.8, 1.9, 1.1 Hz, 1H), 4.89 (ddd, J = 10.0, 8.2, 5.0 Hz, 1H), 3.30 (dd, J = 13.8, 4.9 Hz, 1H), 3.10 (q, J = 6.6 Hz, 2H), 2.93 (dd, J = 13.7, 10.1 Hz, 1H),

2.82 (t, J = 7.0 Hz, 2H).

[0002465] UPLC-MS (basic 6 mm): Rt = 1.52 mm; m/z = 473.1 for [M+H] ⁺ , 100% purity

Example 115: Exemplary synthesis of Compound 102

[0002466] Step 1: tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-oxo-ethyl]carbamate

[0002467] To a stirred solution of 2-(tert-butoxycarbonylamino)-3-(3-cyanophenyl)propanoic acid (17.0 g, 58.6 mmol, 1.0 eq.) in DMF (140 mL) was added DIPEA (31.0 mL, 176 mmol, 3.0 eq.), ammonium chloride (7.83 g, 146 mmol, 2.5 eq.) and HATU (33.4 g, 87.8 mmol, 1.5 eq.) and the resultant solution was stirred at RT for 1.5 h. The reaction mixture was quenched with ice-cold water and the precipitated solid was filtered off. The residue was dried overnight in a vacuum oven to afford product (17.3 g, 59.7 mmol, assumed quantitative yield) as an off-white solid.

[0002468] 1H NMR (400 MHz, DMSO-d6) 5 7.70 - 7.65 (m, 2H), 7.63 - 7.59 (m, 1H), 7.49 (t, J = 7.7 Hz, 1H), 7.39 (s, 1H), 7.06 (s, 1H), 6.90 (d, J = 9.1 Hz, 1H), 4.11 (td, J = 10.4, 4.1 Hz, 1H), 3.03 (dd, J = 13.8, 4.1 Hz, 1H), 2.76 (dd, J = 13.5, 10.3 Hz, 1H), 1.28 (s, 9H).

[0002469] UPLC-MS (basic 2 mm): Rt = 0.90 mm; m/z = 288.1 for [M+H] ⁺

[0002470] Step 2: tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-thioxo-ethyl]carbamat e

[0002471] To a magnetically stirred solution of tert-butyl N-[2-amino-l-[(3- cyanophenyl)methyl]-2-oxo-ethyl] carbamate (17.3 g, 59.7 mmol, 1.0 eq.) in THF (200 mL) was added La wesson reagent (29.0 g, 71.7 mmol, 1.2 eq.) and the resultant mixture stirred at RT for 20 h. The reaction mixture was filtered and the filtrate was concentrated in vacuo. The residue was suspended in EtOAc (200 mL) and aq. saturated Na ₂ CO ₃ solution (400 mL). The organics were extracted with EtOAc (3 x 200 mL) and after separation of the phases, the organics were washed with brine (200 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was purified by normal phase column chromatography (330 g cartridge) eluting with 0-30% EtOAc in DCM to afford the product (7.96 g, 26.0 mmol, 44% yield) as a yellow solid.

[0002472] ¹ H NMR analysis (400 MHz, DMSO-d6) 5 9.64 (s, 1H), 9.28 - 9.23 (m, 1H), 7.74 (s, 1H), 7.68 (d, J = 7.7 Hz, 1H), 7.64 (d, J = 7.9 Hz, 1H), 7.50 (t, J = 7.7 Hz, 1H), 6.92 (d, J = 8.9 Hz, 1H), 4.43 (td, J = 9.5, 4.4 Hz, 1H), 3.04 (dd, J = 13.4, 4.8 Hz, 1H), 2.85 (dd, J = 13.5, 9.9 Hz, 1H), 1.29 (s, 9H).

[0002473] UPLC-MS (basic 4 mm): Rt = 1.59 mm; m/z = 306.2 for [M+H]

[0002474] Step 3: tert-butyl N-[2-(3-cyanophenyl)-l-(4-hydroxy-4,5-dihydrothiazol-2- y 1) ethyl] carbamate

[0002475] Bromoacetaldehyde diethylacetal (15.4 g, 78.1 mmol, 3.0 eq.) in water (40.0 mL) was hydrolyzed by stirring with concentrated hydrogen chloride solution (5.4 mL, 156 mmol, 6.0 eq.) at 60 °C for 30 min. The mixture was cooled to RT and added to a magnetically stirred suspension of sodium hydrogen carbonate (21.9 g, 260 mmol, 10.0 eq.) in THF (120 mL) and stirred for 15 min. Then tert-butyl N-[2-amino-l-[(3-cyanophenyl)methyl]-2-thioxo- ethyl] carbamate (7.96 g, 26.0 mmol, 1.0 eq.) was added and stirred for 18 h at RT. The reaction was diluted in EtOAc (200 mL) and water (200.0 mL). After separation of the phases, the organics were washed with brine (200 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The residue was dried in the vacuum overnight to afford the product (8.45 g, 24.3 mmol, 93% yield) as a beige solid.

[0002476] ¹ H NMR (400 MHz, DMSO-d6) 5 7.69 (d, J = 6.0 Hz, 2H), 7.67 - 7.65 (m, 1H), 7.61 (d, J = 7.9 Hz, 1H), 7.50 (q, J = 7.8 Hz, 2H), 7.44 (d, J = 9.1 Hz, 1H), 6.41 (d, J = 6.0 Hz, 1H), 5.96 - 5.89 (m, 1H), 4.56 - 4.49 (m, 1H), 3.48 - 3.42 (m, 2H), 3.23 (dd, J = 13.7, 4.2 Hz, 1H), 2.98 - 2.93 (m, 1H), 2.89 (dd, J = 13.7, 11.1 Hz, 1H), 1.27 (s, 9H).

[0002477] UPLC-MS (basic 2 mm): Rt = 0.97 mm; m/z = 348.2 for [M+H] ⁺ ; Rt = 1.09 mm; m/z = 330.2 for [M+H] ⁺ (product obtained as a mixture of desired material and dehydrated material)

[0002478] Step 4: 3-(2-amino-2-thiazol-2-yl-ethyl)benzonitrile hydrochloride

[0002479] To a stirred solution of tert-butyl N-[2-(3-cyanophenyl)-l-(4-hydroxy-4,5- dihydrothiazol-2-yl)ethyl]carbamate (8.45 g, 24.3 mmol, 1.0 eq.) in 1,4-dioxane (250 mL) was slowly added hydrogen chloride solution (25.0 mL, 720 mmol, 29.6 eq.) with the resulting mixture being stirred at RT for 3 h. The reaction mixture was concentrated, dissolved in 1 ,4- dioxane (150 mL), redosed with hydrogen chloride solution (25.0 mL, 720 mmol, 29.6 eq.) and stirred at RT for 96 h. The mixture was diluted with excess Et ₂ O, and the precipitate that formed was collected by filtration, washed with copious Et ₂ O and dried in vacuo to afford the product (6.27 g, 23.6 mmol, 97% yield) as a light brown solid.

[0002480] ¹ H NMR (400 MHz, DMSO-d6) 5 8.86 (s, 3H), 7.90 (d, J = 3.2 Hz, 1H), 7.79 (d, J = 3.3 Hz, 1H), 7.72 (ddd, J = 6.1, 2.7, 1.6 Hz, 1H), 7.69 (p, J = 1.6 Hz, 1H), 7.53 - 7.47 (m, 2H), 5.23 - 5.15 (m, 1H), 3.44 (dd, J = 13.8, 6.2 Hz, 1H), 3.29 (dd, J = 13.7, 8.7 Hz, 1H).

[0002481] UPLC-MS (basic 2 mm): Rt = 0.84 mm; m/z = 230.2 for [M+H] ⁺

[0002482] Step 5: N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]-3-nitro-benzenesu lfonamide

[0002483] To a solution of 3-(2-amino-2-thiazol-2-yl-ethyl)benzonitrile;hydrochloride (4.00 g,

15.1 mmol, 1.0 eq.) in DMF (16.0 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of TEA (6.3 mL, 45.2 mmol, 3.0 eq.). The resulting mixture was then stirred for 10 min before the portionwise addition of 3 -nitrophenylsulfonyl chloride (4.00 g, 18.1 mmol, 1.2 eq.) over a 10 min period. The reaction was allowed to stir at the same temperature for 1 h before being allowed to warm to RT and stirred for 16 h. The reaction was quenched via the addition of water (100 mL) and the organics were extracted with EtOAc (2 x 100 mL), washed with brine (100 mL), dried over anhydrous sodium sulfate and concentrated in vacuo. The crude material was suspended in DCM and the product crashed out upon addition of iso-hexane to afford the product (3.40 g, 8.20 mmol, 55% yield) as a brown solid.

[0002484] ¹ H NMR (400 MHz, DMSO-d6). 5 9.21 (d, J = 8.7 Hz, 1H), 8.31 (ddd, J = 8.3, 2.3,

1.1 Hz, 1H), 8.08 (td, J = 2.0, 2.0 Hz, 1H), 7.87 (ddd, J = 7.8, 1.8, 1.0 Hz, 1H), 7.69 (d, J = 3.3 Hz, 1H), 7.66 (d, J = 7.9 Hz, 1H), 7.63 - 7.62 (m, 1H), 7.57 (t, J = 1.7 Hz, 1H), 7.49 (dt, J = 7.8, 1.6 Hz, 1H), 7.42 (dt, J = 7.7, 1.4 Hz, 1H), 7.23 (t, J = 7.8 Hz, 1H), 5.05 (ddd, J = 10.7, 8.7, 4.6 Hz, 1H), 3.30 (d, J = 4.9 Hz, 1H), 2.95 (dd, J = 13.9, 10.7 Hz, 1H).

[0002485] UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 413.1 for [M+H] ⁺

[0002486] Step 6: 3-amino-N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]benzenesul fonamide

[0002487] To a magnetically stirred solution of N-[2-(3-cyanophenyl)-l-thiazol-2-yl-ethyl]-3- nitro-benzenesulfonamide (3.40 g, 8.20 mmol, 1.0 eq.) in EtOH (20.0 mL) and water (10.0 mL) was added iron (4.58 g, 82.0 mmol, 10.0 eq.) and ammonium chloride (2.19 g, 41.0 mmol, 5.0 eq.) and the resultant mixture was heated to 85 °C, under a balloon of nitrogen, and stirred for 4 h. The reaction mixture was cooled to RT, filtered over Celite and rinsed with copious EtOH and DCM and concentrated in vacuo. The residue was re-suspended in EtOAc (100 mL) and aq. saturated Na ₂ CO ₃ (100 mL). After separation of the phases, the organics were dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to afford the product (2.26 g, 5.88 mmol, 72% yield) as a tan-beige foam.

[0002488] ¹ H NMR (400 MHz, DMSO-d6) 5 8.55 (s, 1H), 7.70 (d, J = 3.2 Hz, 1H), 7.61 (dd, J = 3.2, 0.7 Hz, 1H), 7.57 - 7.48 (m, 2H), 7.44 (dt, J = 7.8, 1.4 Hz, 1H), 7.34 (t, J = 7.7 Hz, 1H), 6.96 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.60 (tdd, J = 8.8, 2.1, 1.0 Hz, 2H), 5.41 (s, 2H), 4.78 (s, 1H), 3.26 (dd, J = 13.7, 5.4 Hz, 1H), 2.90 (dd, J = 13.7, 9.3 Hz, 1H).

[0002489] UPLC-MS (basic 2 mm): Rt = 0.93 mm; m/z = 385.2 for [M+H] ⁺

[0002490] Step 7:tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[0002491] To a magnetically stirred solution of 3-amino-N-[2-(3-cyanophenyl)-l-thiazol-2-yl- ethyl]benzenesulfonamide (1.00 g, 2.60 mmol, 1.0 eq.) in anhydrous DMF (15.0 mL) was added N-boc-beta-alanine (0.59 g, 3.12 mmol, 1.2 eq.) and DIPEA (1.4 mL, 7.80 mmol, 3.0 eq.), shortly followed by HATU (1.48 g, 3.90 mmol, 1.5 eq.) and left to stir at RT for 1.5 h. The reaction was redosed with N-boc-beta-alanine (0.590 g, 3.12 mmol, 1.2 eq.), DIPEA (1.4 mL, 7.80 mmol, 3.0 eq.) and HATU (1.48 g, 3.90 mmol, 1.5 eq.) and stirred at RT for 5 h. The reaction mixture was diluted with EtOAc (50.0 mL) and washed with brine (50.0 mL), aq. saturated Na ₂ CO ₃ (50.0 mL), and brine again (50.0 mL). The organics were dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was purified by column chromatography over silica (40 g cartridge) eluting with a gradient of 40-

100% EtOAc in iso-hexane to afford the product (2.03 g, 3.65 mmol, assume quantitative yield) as an orange oil.

[0002492] ¹ H NMR (400 MHz, DMSO-d6) 5 10.09 (s, 1H), 8.82 (d, J = 8.4 Hz, 1H), 7.83 (t, J = 1.9 Hz, 1H), 7.72 (d, J = 3.3 Hz, 1H), 7.63 (d, J = 3.2 Hz, 1H), 7.59 - 7.54 (m, 1H), 7.49 (t, J = 1.6 Hz, 1H), 7.43 (dd, J = 7.6, 1.8 Hz, 2H), 7.28 - 7.19 (m, 2H), 7.11 (ddd, J = 7.8, 1.8, 1.1 Hz, 1H), 6.89 (t, J = 5.5 Hz, 1H), 4.81 (ddd, J = 10.4, 8.4, 4.7 Hz, 1H), 3.31 - 3.21 (m, 3H), 2.89 (dd, J = 13.8, 10.2 Hz, 1H), 2.53 - 2.51 (m, 2H), 1.38 (s, 9H). - residual EtOAc (21.2 wt%) and TMU (3.45 wt%); overlap of CH ₂ and CH at 3.27-3.22 ppm and overlap of DMSO peak and CH ₂ peak but all protons accounted for; small aliphatic impurities apparent throughout

[0002493] UPLC-MS (basic 2 mm): Rt = 1.04 mm; m/z = 556.3 [M+H] ⁺

[0002494] Step 8: tert-butyl N-[3-[3-[[2-[3-[(E)-N'-hydroxycarbamimidoyl]phenyl]-l-thiazo l-2- yl-ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[0002495] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-(3-cyanophenyl)-l- thiazol-2-yl-ethyl]sulfamoyl]anilino]-3-oxo-propyl]carbamate (1.45 g, 2.60 mmol, 1.0 eq.) in EtOH (20.0 mL) was added hydroxylamine hydrochloride (361 mg, 5.20 mmol, 2.0 eq.) and DIPEA (1.4 mL, 7.80 mmol, 3.0 eq.) with the resultant mixture heated to 85 °C for 16 h. The mixture was cooled to RT and concentrated to dryness under reduced pressure to afford the product (1.53 g, 2.60 mmol, assume quantitative yield) as a yellow oil, which was used in the next step without further purification.

[0002496] UPLC-MS (basic 2 mm): Rt = 0.94 mm; m/z = 589.3 for [M+H] ⁺

[0002497] Step 9: [(E)- [ammo- [3 -[2- [[3 -[3 -(tert- butoxy carbonylamino)propanoylamino]phenyl]sulfonylamino]-2-thiazol -2-yl- ethyl]phenyl]methylene]amino] acetate

[0002498] To a magnetically stirred solution of tert-butyl N-[3-[3-[[2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]-l-thiazol-2-yl-ethyl]sulfamoyl] anilino]-3-oxo-propyl]carbamate

(1.53 g, 2.60 mmol, 1.0 eq.) in acetic acid (20.0 mL) was added acetic anhydride (0.75 mL, 7.93 mmol, 3.0 eq.). The reaction was left to stir at RT for 4.5 h. The reaction mixture was concentrated to dryness under reduced pressure with the crude material being purified by normal-phase column chromatography over silica (40 g cartridge) eluting with a gradient of 40- 100% EtOAc in z.w-hexane to afford the (1.59 g, 2.52 mmol, 97% yield) as a yellow oil.

[0002499] ¹ H NMR (400 MHz, DMSO-d6) 5 10.06 (s, 1H), 8.77 (d, J = 8.3 Hz, 1H), 7.89 (t, J = 2.0 Hz, 1H), 7.65 (d, J = 3.3 Hz, 1H), 7.56 (d, J = 3.3 Hz, 2H), 7.49 (t, J = 1.8 Hz, 1H), 7.43 (dt, J = 7.3, 1.7 Hz, 1H), 7.22 (t, J = 8.0 Hz, 1H), 7.16 (dt, J = 7.7, 1.6 Hz, 1H), 7.13 (d, J = 7.6 Hz, 1H), 7.11 - 7.08 (m, 1H), 6.87 (t, 1H), 6.69 (s, 2H), 4.82 (td, 1H), 3.26 - 3.18 (m, 3H), 2.95 - 2.88 (m, 1H), 2.15 (s, 3H), 1.38 (s, 9H), 1.27 - 1.23 (m, 2H).

[0002500] UPLC-MS (basic 2 mm): Rt = 0.98 mm; m/z = 631.4 for [M+H] ⁺

[0002501] Step 10: tert-butyl N-[3-[3-[[2-(3-carbamimidoylphenyl)-l-thiazol-2-yl- ethyl] sulfamoyl] anilino] -3 -oxo-propyl] carbamate

[0002502] To a magnetically stirred solution of [(E)-[amino-[3-[2-[[3-[3-(tert- butoxycarbonylamino)propanoylamino]phenyl]sulfonylamino]-2-t hiazol-2-yl- ethyl]phenyl]methylene]amino] acetate (1.59 g, 2.52 mmol, 1.0 eq.) in acetic acid (25.0 mL) was added zinc (3.30 g, 50.4 mmol, 20.0 eq.) and the resultant suspension was stirred at RT for 16 h. The reaction mixture was filtered through Celite, washing with copious MeCN, EtOH and DCM and the filtrate was concentrated in vacuo. The residue was submitted to Reach for chiral purification via SFC on a Lux iC5 (30mm x 250mm, 5um) with a 45:55 EtOH:CO ₂ (0.2% v/v NH ₃ ) to afford the product (326 mg, 0.569 mmol, 23% yield) as an off-white solid.

[0002503] UPLC-MS (basic 4 mm): Rt = 1.51 mm; m/z = 573.2 for [M+H] ⁺

[0002504] Step 11: 3-amino-N-[3-[[rac-(lS)-2-(3-carbamimidoylphenyl)-l-thiazol- 2-yl- ethyl]sulfamoyl]phenyl]propenamide

[0002505] To a stirred solution tert-butyl N-[3-oxo-3-[3-[[rac-(lS)-2-(3-carbamimidoylphenyl)- l-thiazol-2-yl-ethyl]sulfamoyl]anilino]propyl]carbamate (326 mg, 0.569 mmol, 1.0 eq.) in 1,4- dioxane (4.0 mL) was added hydrogen chloride solution (2.0 mL, 8.00 mmol, 14.1 eq.) and the resultant suspension was stirred at RT for 6 h. The reaction mixture was concentrated under reduced pressure. The residue was dissolved in water before being concentrated under reduced pressure and dried in the vacuum oven overnight to obtain the product (259 mg, 0.475 mmol, assume quantitative yield) as yellow flakes.

[0002506] ¹ H NMR (400 MHz, DMSO-d6) 5 10.48 (s, 1H), 9.25 (s, 2H), 9.12 (s, 2H), 8.81 (d, J = 8.3 Hz, 1H), 7.98 (s, 3H), 7.93 - 7.89 (m, 1H), 7.71 (dd, J = 3.2, 1.4 Hz, 1H), 7.65 (s, 1H), 7.62 (dd, J = 3.3, 1.5 Hz, 1H), 7.56 (d, J = 8.2 Hz, 2H), 7.40 (d, J = 7.9 Hz, 1H), 7.28 - 7.17 (m, 2H), 7.11 (dt, J = 7.9, 1.5 Hz, 1H), 4.89 (td, J = 9.0, 5.1 Hz, 1H), 3.30 (dd, J = 13.9, 5.5 Hz, 1H), 3.10 (t, J = 6.3 Hz, 2H), 2.93 (dd, J = 13.8, 10.0 Hz, 1H), 2.80 (t, J = 6.7 Hz, 2H). - bis-HCl salt

[0002507] UPLC-MS (basic 6 mm): Rt = 1.61 mm; m/z = 473.1 for [M+H] ⁺ , 100% purity

Example 116: Exemplary synthesis of Compound 290

[0002508] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002509] To a magnetically stirred suspension of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (13.6 g, 46.7 mmol, 1.0 eq.) and 2-aminothiophenol (5.0 mL, 46.7 mmol, 1.0 eq.) in toluene (150 mL) was added DIPEA (24.4 mL, 140 mmol, 3.0 eq.) and T3P (33.4 mL, 56.1 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 4 h before being cooled to RT. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and stirred for 30 min. The reaction was then diluted with EtOAc (600 mL) and water (300 mL).

After separation of the phases, the organics were washed with water (250 mL) and brine (250 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-60% EtOAc in iso-hexane to afford the product (13.5 g, 35.6 mmol, 76% yield) as a white solid.

[0002510] ¹ H NMR (400 MHz, DMSO-d6) 5 8.13 - 8.06 (m, 1H), 7.98 (dt, J = 8.2, 0.9 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.87 - 7.78 (m, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.47 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.16 (ddd, J = 10.9, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002511] UPLC-MS (basic 2 mm): Rt = 1.21 mm; m/z = 380.1 for [M+H] ⁺

[0002512] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002513] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (13.5 g, 35.6 mmol, 1.0 eq.) and 4 N HC1 in 1,4-di oxane (133 mL, 534 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated to dryness to afford the product (12.5 g, 39.6 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification.

[0002514] ¹ H NMR (400 MHz, DMSO-d6) 5 9.18 (d, J = 5.5 Hz, 3H), 8.14 (ddd, J = 8.1, 1.4, 0.7 Hz, 1H), 8.04 (ddd, J = 8.2, 1.3, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.30 (dd, J = 8.7, 5.4 Hz, 1H), 3.62 - 3.52 (m, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H)

[0002515] UPLC-MS (basic 2 mm): Rt = 1.05 mm; m/z = 280.1 for [M+H] ⁺

[0002516] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002517] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (10.0 g, 31.7 mmol, 1.0 eq.) in DMF (100.0 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of TEA (8.8 mL, 63.3 mmol, 2.0 eq.). The resulting mixture was stirred for 10 min before the portionwise addition of 3 -nitrophenylsulfonyl chloride (8.42 g, 38.0 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 30 min before being allowed to warm to RT and stirred for 2 h. The reaction mixture was re-dosed with 3- nitrophenylsulfonyl chloride (8.42 g, 38.0 mmol, 1.2 eq.) and TEA (8.8 mL, 63.3 mmol, 2.0 eq.) and was stirred at RT for 1 h. The reaction mixture was then added slowly to ice water (100 mL) and the resulting solid was filtered. The solid was purified by normal phase column chromatography (80 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (6.40 g, 13.8 mmol, 44% yield) as a yellow solid.

[0002518] ¹ H NMR (400 MHz, DMSO-d6) 5 9.36 (s, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.03 (m, 2H), 7.91 - 7.85 (m, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.60 (d, J = 8.1 Hz, 1H), 7.58 - 7.47 (m, 2H), 7.46 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.18 (dd, J = 10.9, 4.4 Hz, 1H), 3.42 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0002519] UPLC-MS (basic 2 mm): Rt = 1.10 mm; m/z = 465.1 for [M+H] ⁺

[0002520] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002521] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (6.50 g, 13.8 mmol, 1.0 eq.), iron (7.70 g, 138 mmol, 10.0 eq.) and ammonium chloride (3.68 g, 68.9 mmol, 5.0 eq.) in EtOH (60 mL) and water (30 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness before being re-suspended in EtOAc (300 mL), washed with aq. saturated Na ₂ CO ₃ solution (250 mL), and water (250 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (5.04 g, 11.6 mmol, 84% yield) as an orange solid, which was used in the next step without further purification.

[0002522] ¹ H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.12 - 8.06 (m, 1H), 7.95 (dt, J = 8.3, 0.9 Hz, 1H), 7.57 (s, 1H), 7.53 (dt, J = 7.7, 1.4 Hz, 1H), 7.52 - 7.47 (m, 2H), 7.46 - 7.40 (m, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.58 (dt, J = 7.7, 2.2 Hz, 2H), 5.40 (s, 2H), 4.94 - 4.84 (m, 1H), 3.36 (dd, J = 13.8, 5.0 Hz, 1H), 2.98 (dd, J = 13.8, 9.9 Hz, 1H).

[0002523] UPLC-MS (basic 2 min): Rt = 1.08 min; m/z = 435.2 for [M+H] ⁺

[0002524] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl]phenyl]- 5-isopropyl-lH-pyrazole-3-carboxamide

[0002525] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in anhydrous DMF (10.0 mb) was added 3-isopropylpyrazole-5-carboxylic acid (213 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 16 h. The reaction mixture was diluted with EtOAc (30.0 mL) and washed with brine (30.0 mL), saturated Na ₂ CO ₃ solution (30.0 mL), and brine again (30.0 mL). The organics were dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure. The residue was initially purified by column chromatography over silica (40 g cartridge) eluting with a gradient of 40-100% EtOAc in DCM then repurified by reverse phase column chromatography (23 g cartridge) eluting with a gradient of 25-70% MeCN in water (0.1% formic acid) to afford the (415 mg, 0.727 mmol, 63% yield) as an off-white solid.

[0002526] ¹ H NMR (400 MHz, DMSO-d6) 5 13.14 (s, 1H), 10.12 (s, 1H), 8.98 (d, J = 8.2 Hz, 1H), 8.13 (d, J = 4.5 Hz, 1H), 8.10 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.95 (ddd, J = 8.2, 1.3, 0.7 Hz, 1H), 7.82 (ddd, J = 8.2, 2.2, 1.2 Hz, 1H), 7.58 (t, J = 1.8 Hz, 1H), 7.50 (ddd, J = 8.0, 7.2, 1.3 Hz, 2H), 7.43 (dddd, J = 8.4, 4.4, 3.0, 1.3 Hz, 2H), 7.22 (dt, J = 9.4, 7.9 Hz, 2H), 7.13 (d, J = 8.0 Hz, 1H), 6.57 (s, 1H), 4.98 (ddd, J = 10.5, 8.2, 4.4 Hz, 1H), 3.39 (dd, J = 13.8, 4.3 Hz, 1H), 2.98 (dd, J = 13.8, 10.5 Hz, 2H), 1.28 (s, 3H), 1.26 (s, 3H).

[0002527] UPLC-MS (basic 6 mm): Rt = 3.33 mm; m/z = 571.2 [M+H]

[0002528] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-5-isopro pyl-lH-pyrazole-3- carboxamide

[0002529] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]-5-isopropyl-lH-pyrazole- 3-carboxamide (415 mg, 0.727 mmol, 1.0 eq.) in EtOH (10.0 mL) was added hydroxylamine hydrochloride (101 mg, 1.45 mmol, 2.0 eq.) and DIPEA (0.38 mL, 2.18 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 18 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (439 mg, 0.727 mmol, assumed quantitative yield), as a yellow oil, which was used in the next step without further purification.

[0002530] UPLC-MS (basic 2 mm): Rt = 1.01 mm; m/z = 604.3 for [M+H] ⁺

[0002531] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[(5-isopropy l-lH-pyrazole- 3-carbonyl)amino]phenyl]sulfonylamino]ethyl]phenyl]methylene ]amino] acetate

[0002532] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-5-isopro pyl-lH-pyrazole-3- carboxamide (439 mg, 0.727 mmol, 1.0 eq.) in acetic acid (10.0 mL) was added acetic anhydride (0.21 mL, 2.22 mmol 3.0 eq.) and the reaction mixture was stirred at RT for 18 h. The reaction mixture was then concentrated to dryness. The residue was purified by normal phase column chromatography (24 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (220 mg, 0.341 mmol, 47% yield) as a yellow oil.

[0002533] ¹ H NMR (400 MHz, DMSO-d6) 5 13.14 (s, 1H), 10.07 (s, 1H), 8.94 (s, 1H), 8.21 (s, 1H), 8.07 - 8.02 (m, 1H), 7.93 - 7.89 (m, 1H), 7.75 (ddd, J = 8.0, 2.1, 1.2 Hz, 1H), 7.56 (s, 1H), 7.48 - 7.37 (m, 3H), 7.23 (d, J = 7.7 Hz, 1H), 7.19 - 7.08 (m, 3H), 6.68 (s, 2H), 6.56 (s, 1H), 4.96 (s, 1H), 3.32 - 3.28 (m, 1H), 3.07 - 2.97 (m, 2H), 2.12 (s, 3H), 1.28 (s, 3H), 1.26 (s, 3H). - residual DCM (0.45 wt%) and EtOAc (13.9 wt%).

[0002534] UPLC-MS (basic 2 mm): Rt = 1.08 mm; m/z = 646.3 for [M+H] ⁺

[0002535] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-5-isopropyl-lH-p yrazole-3-carboxamide

[0002536] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [ [3 - [(5-isopropyl- 1 H-pyrazole-3 - carbonyl)amino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate (220 mg, 0.341 mmol, 1.0 eq.) in acetic acid (8.0 mL) was added zinc (445 mg, 6.81 mm, 20.0 eq.). The reaction mixture was stirred at RT for 16 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was submitted for purification via reverse phase preparative HPLC on a Waters XBridge C18 (19 mm x 150 mm, 10 pm) eluting with 30-46% MeCN in water (+0.2% TFA) to afford the product (120 mg, 0.204 mmol, 60% yield) as an off-white solid.

[0002537] UPLC-MS (basic 6 mm): Rt = 3.01 mm; m/z = 588.2 for [M+H] ⁺

[0002538] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-5-isopropyl-lH-p yrazole-3-carboxamide

[0002539] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl] sulfamoyl] phenyl] - 5-isopropyl- 1 H-pyrazole-3 -carboxamide (120 mg, 0.204 mmol, 1.0 eq.) in 1,4-dioxane (2.0 mL) was added 4 N HC1 in 1,4-dioxane (1.0 mL, 4.00 mmol, 19.6 eq.) and the resultant suspension was stirred at RT. After 1 h, the reaction mixture was concentrated to dryness. This process was repeated six more times. The residue was dissolved in a small volume of water/MeCN and concentrated to dryness, followed by drying in a vacuum oven overnight to afford the product (67.0 mg, 0.107 mmol, 52% yield) as a yellow solid.

[0002540] ¹ H NMR (400 MHz, DMSO-d6) 5 13.14 (s, 1H), 10.08 (s, 1H), 9.12 (s, 2H), 8.92 (d, J = 8.2 Hz, 1H), 8.86 (s, 2H), 8.12 (s, 1H), 8.04 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.90 - 7.87 (m, 1H), 7.72 - 7.69 (m, 1H), 7.66 (s, 1H), 7.50 - 7.43 (m, 3H), 7.39 (ddd, J = 8.5, 7.2, 1.3 Hz, 1H), 7.21 (t, J = 7.8 Hz, 1H), 7.14 - 7.06 (m, 2H), 6.53 (s, 1H), 5.04 - 4.94 (m, 1H), 3.37 (d, J = 4.9

Hz, 1H), 3.01 (dd, J = 14.0, 9.8 Hz, 2H), 1.24 (d, J = 7.0 Hz, 6H). Aliphatic impurities seen with largest at 1.71 ppm (integrates to 0.66); mono-HCl salt

[0002541] UPLC-MS (basic 6 min): Rt = 2.89 min; m/z = 588.2 for [M+H] ⁺ , 93% purity

Example 117: Exemplary synthesis of Compound 291

[0002542] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002543] To a magnetically stirred suspension of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (13.6 g, 46.7 mmol, 1.0 eq.) and 2-aminothiophenol (5.0 mL, 46.7 mmol, 1.0 eq.) in toluene (150 mL) was added DIPEA (24.4 mL, 140 mmol, 3.0 eq.) and T3P (33.4 mL, 56.1 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 4 h before being cooled to RT. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and stirred for 30 min. The reaction was then diluted with EtOAc (600 mL) and water (300 mL). After separation of the phases, the organics were washed with water (250 mL) and brine (250 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-60% EtOAc in iso-hexane to afford the product (13.5 g, 35.6 mmol, 76% yield) as a white solid.

[0002544] ¹ H NMR (400 MHz, DMSO-d6) 5 8.13 - 8.06 (m, 1H), 7.98 (dt, J = 8.2, 0.9 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.87 - 7.78 (m, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.47 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.16 (ddd, J = 10.9, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002545] UPLC-MS (basic 2 mm): Rt = 1.21 mm; m/z = 380.1 for [M+H] ⁺

[0002546] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002547] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (13.5 g, 35.6 mmol, 1.0 eq.) and 4 N HC1 in 1,4-di oxane (133 mL, 534 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated to dryness to afford the product (12.5 g, 39.6 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification.

[0002548] ¹ H NMR (400 MHz, DMSO-d6) 5 9.18 (d, J = 5.5 Hz, 3H), 8.14 (ddd, J = 8.1, 1.4, 0.7 Hz, 1H), 8.04 (ddd, J = 8.2, 1.3, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.30 (dd, J = 8.7, 5.4 Hz, 1H), 3.62 - 3.52 (m, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H)

[0002549] UPLC-MS (basic 2 mm): Rt = 1.05 mm; m/z = 280.1 for [M+H] ⁺

[0002550] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002551] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (10.0 g, 31.7 mmol, 1.0 eq.) in DMF (100 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of TEA (8.8 mL, 63.3 mmol, 2.0 eq.). The resulting mixture was stirred for 10 min before the portionwise addition of 3 -nitrophenylsulfonyl chloride (8.42 g, 38.0 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 30 min before being allowed to warm to RT and stirred for 2 h. The reaction mixture was re-dosed with 3- nitrophenylsulfonyl chloride (8.42 g, 38.0 mmol, 1.2 eq.) and TEA (8.8 mL, 63.3 mmol, 2.0 eq.) and was stirred at RT for 1 h. The reaction mixture was then added slowly to ice water (100 mL) and the resulting solid was filtered. The solid was purified by normal phase column chromatography (80 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (6.40 g, 13.8 mmol, 44% yield) as a yellow solid.

[0002552] ¹ H NMR (400 MHz, DMSO-d6) 5 9.36 (s, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.03 (m, 2H), 7.91 - 7.85 (m, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.60 (d, J = 8.1 Hz, 1H), 7.58 - 7.47 (m, 2H), 7.46 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.18 (dd, J = 10.9, 4.4 Hz, 1H), 3.42 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0002553] UPLC-MS (basic 2 mm): Rt = 1.10 mm; m/z = 465.1 for [M+H] ⁺

[0002554] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002555] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (6.50 g, 13.8 mmol, 1.0 eq.), iron (7.70 g, 138 mmol, 10.0 eq.) and ammonium chloride (3.68 g, 68.9 mmol, 5.0 eq.) in EtOH (60.0 mL) and water (30.0 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness before being re-suspended in EtOAc (300 mL), washed with aq. saturated Na ₂ CO ₃ solution (250 mL), and water (250 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (5.04 g, 11.6 mmol, 84% yield) as an orange solid, which was used in the next step without further purification.

[0002556] ¹ H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.12 - 8.06 (m, 1H), 7.95 (dt, J = 8.3, 0.9 Hz, 1H), 7.57 (s, 1H), 7.53 (dt, J = 7.7, 1.4 Hz, 1H), 7.52 - 7.47 (m, 2H), 7.46 - 7.40 (m, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.58 (dt, J = 7.7, 2.2 Hz, 2H), 5.40 (s, 2H), 4.94 - 4.84 (m, 1H), 3.36 (dd, J = 13.8, 5.0 Hz, 1H), 2.98 (dd, J = 13.8, 9.9 Hz, 1H).

[0002557] UPLC-MS (basic 2 mm): Rt = 1.08 mm; m/z = 435.2 for [M+H] ⁺

[0002558] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]thieno[2,3-b]pyrazine-6-c arboxamide

[0002559] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in anhydrous DMF (10.0 mL) was added thieno[2,3-B]pyrazine-6-carboxylic acid (249 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 2 h. The reaction mixture was diluted with EtOAc (30.0 mL) and washed with brine (30.0 mL), saturated Na ₂ CO ₃ solution (30.0 mL), and brine again (30.0 mL). The organics were dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to afford the product (1.05 g, 1.76 mmol, assumed quantitative yield) as an orange oil.

[0002560] ¹ H NMR (400 MHz, DMSO-d6) 5 10.78 (s, 1H), 9.07 (d, J = 8.3 Hz, 1H), 8.91 (d, J = 2.3 Hz, 1H), 8.78 (d, J = 2.3 Hz, 1H), 8.61 (s, 1H), 8.10 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.97 - 7.94 (m, 3H), 7.85 (ddd, J = 8.2, 2.1, 1.0 Hz, 1H), 7.61 (t, J = 1.5 Hz, 1H), 7.52 - 7.40 (m, 5H), 7.34 (t, J = 7.9 Hz, 1H), 7.27 - 7.19 (m, 2H), 4.99 (ddd, J = 10.9, 8.3, 4.4 Hz, 1H), 3.40 (dd, J = 13.8, 4.1 Hz, 1H), 3.00 (dd, J = 13.8, 10.9 Hz, 1H). - residual EtOAc (33.7 wt%) and DML (5.73 wt%); 2 extra protons seen in aromatic region

[0002561] UPLC-MS (basic 2 mm): Rt = 1.14 mm; m/z = 597.3 [M+H]

[0002562] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]thieno[2, 3-b]pyrazine-6-carboxamide

[0002563] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]thieno[2,3-b]pyrazine-6-c arboxamide (687 mg, 1.15 mmol, 1.0 eq.) in EtOH (12.0 mL) was added hydroxylamine hydrochloride (160 mg, 2.30 mmol, 2.0 eq.) and DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 16 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (725 mg, 1.15 mmol, assumed quantitative yield), as an orange oil, which was used in the next step without further purification.

[0002564] UPLC-MS (basic 2 mm): Rt = 1.01 mm; m/z = 630.2 for [M+H] ⁺

[0002565] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(thieno[2,3- b]pyrazine-6- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate

[0002566] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]thieno[2, 3-b]pyrazine-6-carboxamide (725 mg, 1.15 mmol, 1.0 eq.) in acetic acid (14.0 mL) was added acetic anhydride (0.33 mL, 3.49 mmol, 1.0 eq.) and the reaction mixture was stirred at RT for 2 h. The reaction mixture was then concentrated to dryness and the residue was initially purified by normal phase column chromatography (24 g cartridge) eluting with 0-100% EtOAc in DCM, then purified by reverse phase column chromatography (24 g cartridge) eluting with 30-55% MeCN (0.1% NH ₃ ) in water (0.1% NH ₃ ) to afford the product (220 mg, 0.327 mmol, 28% yield) as an orange oil.

[0002567] ¹ H NMR (400 MHz, DMSO-d6) 5 10.69 (s, 1H), 8.90 (d, J = 2.3 Hz, 1H), 8.77 (d, J = 2.3 Hz, 1H), 8.56 (s, 1H), 8.05 (d, J = 7.6 Hz, 1H), 7.95 (t, J = 2.0 Hz, 1H), 7.91 (d, J = 7.7 Hz, 1H), 7.79 - 7.75 (m, 1H), 7.57 (s, 1H), 7.43 (dd, J = 7.9, 1.6 Hz, 4H), 7.28 (t, J = 7.8 Hz, 1H), 7.24 - 7.21 (m, 2H), 7.08 (t, J = 7.7 Hz, 1H), 6.68 (s, 2H), 4.94 (s, 1H), 3.30 (d, J = 7.2 Hz, 1H), 3.01 (dd, J = 13.7, 9.9 Hz, 1H), 2.04 (s, 3H). - residual EtOAc (6.33 wt%) and MeCN (4.30 wt%)

[0002568] UPLC-MS (basic 6 mm): Rt = 2.92 mm; m/z = 672.2 for [M+H] ⁺

[0002569] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]thieno[2,3-b]pyra zine-6-carboxamide

[0002570] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [[3-(thieno[2,3-b]pyrazine-6- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate (220 mg, 0.327 mmol, 1.0 eq.) in acetic acid (8.0 mL) was added zinc (428 mg, 6.55 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 24 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was submitted for purification via reverse phase preparative HPLC on a Waters XBridge C18 (19 mm x 150 mm, 10 pm) eluting with 15-50% MeCN in water (0.2% TFA) to afford the product (22.0 mg, 0.0358 mmol, 11% yield) as a brown solid.

[0002571] UPLC-MS (basic 2 mm): Rt = 1.13 mm; m/z = 614.1.4 for [M+H] ⁺ , 96% purity

[0002572] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]thieno[2,3-b]pyra zine-6-carboxamide

[0002573] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]thieno[2,3-b]pyra zine-6-carboxamide (22.0 mg, 0.0358 mmol, 1.0 eq.) in 1,4-dioxane (2.0 mL) was added 4 N HC1 in 1,4-dioxane (1.0 mL, 4.0 mmol, 112 eq.) and the resultant suspension stirred at RT for 1 h before being concentrated under reduced pressure. This was repeated three more times before being concentrated under reduced pressure a final time. The wet product was dissolved in water/MeCN (40:60) and concentrated under reduced pressure, before being dried in the vacuum oven overnight to obtain the product (12.0 mg, 0.0175 mmol, 49% yield) as a yellow solid.

[0002574] ¹ H NMR (400 MHz, DMSO-d6) 5 10.85 (s, 1H), 9.19 (s, 2H), 9.01 (d, J = 8.0 Hz, 1H), 8.91 (d, J = 2.3 Hz, 1H), 8.88 (s, 2H), 8.79 (d, J = 2.3 Hz, 1H), 8.68 (s, 1H), 8.10 - 8.07 (m, 1H), 8.00 (t, J = 2.0 Hz, 1H), 7.93 (ddd, J = 8.0, 1.5, 0.7 Hz, 1H), 7.83 - 7.80 (m, 1H), 7.75 (t, J = 1.8 Hz, 1H), 7.56 (d, J = 7.8 Hz, 1H), 7.50 - 7.47 (m, 2H), 7.46 - 7.39 (m, 2H), 7.28 - 7.22 (m,

3H), 5.05 (ddd, J = 10.2, 8.1, 4.8 Hz, 1H), 3.06 (dd, J = 14.0, 10.2 Hz, 1H). - CH not observed; residual EtOAc (1.88 wt%); minor aliphatic impurities at 4.31 ppm (integrates to 0.17) and grease-based impurity at 1.23 ppm (integrates to 0.79); bis-HCl salt

[0002575] ¹ H NMR-D20 (400 MHz, DMSO-d6) 5 8.85 (dd, J = 2.3, 1.0 Hz, 1H), 8.73 (dd, J = 2.3, 0.9 Hz, 1H), 8.47 (s, 1H), 8.02 - 7.98 (m, 1H), 7.90 (s, 1H), 7.89 - 7.85 (m, 1H), 7.66 (d, J = 12.9 Hz, 2H), 7.49 (d, J = 7.9 Hz, 1H), 7.46 - 7.36 (m, 3H), 7.32 - 7.25 (m, 2H), 7.22 (t, J = 7.8 Hz, 1H), 5.00 (dd, J = 10.4, 4.8 Hz, 1H), 3.39 - 3.33 (m, 1H), 3.04 (dd, J = 14.0, 10.6 Hz, 1H).

[0002576] UPLC-MS (basic 6 mm): Rt = 2.73 mm; m/z = 614.1 for [M+H] ⁺ , 97% purity

Example 118: Exemplary synthesis of Compound 292

[0002577] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002578] To a magnetically stirred suspension of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (13.6 g, 46.7 mmol, 1.0 eq.) and 2-aminothiophenol (5.0 mL, 46.7 mmol, 1.0 eq.) in toluene (150 mL) was added DIPEA (24.4 mL, 140 mmol, 3.0 eq.) and T3P (33.4 mL, 56.1 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 4 h before being cooled to RT. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (250 mL) and stirred for 30 min. The reaction was then diluted with EtOAc (600 mL) and water (300 mL).

After separation of the phases, the organics were washed with water (250 mL) and brine (250 mL), dried over anhydrous sodium sulfate, filtered, and concentrated to dryness. The residue was then purified by normal phase column chromatography (330 g cartridge) eluting with 0-60% EtOAc in iso-hexane to afford the product (13.5 g, 35.6 mmol, 76% yield) as a white solid.

[0002579] ¹ H NMR (400 MHz, DMSO-d6) 5 8.13 - 8.06 (m, 1H), 7.98 (dt, J = 8.2, 0.9 Hz, 1H), 7.91 (d, J = 8.8 Hz, 1H), 7.87 - 7.78 (m, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.47 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.3 Hz, 1H), 5.16 (ddd, J = 10.9, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002580] UPLC-MS (basic 2 mm): Rt = 1.21 mm; m/z = 380.1 for [M+H] ⁺

[0002581] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002582] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (13.5 g, 35.6 mmol, 1.0 eq.) and 4 N HC1 in 1,4-di oxane (133 mL, 534 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated to dryness to afford the product (12.5 g, 39.6 mmol, assumed quantitative yield) as a brown solid, which was used in the next step without further purification.

[0002583] ¹ H NMR (400 MHz, DMSO-d6) 5 9.18 (d, J = 5.5 Hz, 3H), 8.14 (ddd, J = 8.1, 1.4, 0.7 Hz, 1H), 8.04 (ddd, J = 8.2, 1.3, 0.6 Hz, 1H), 7.81 (d, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.30 (dd, J = 8.7, 5.4 Hz, 1H), 3.62 - 3.52 (m, 1H), 3.39 (dd, J = 13.8, 8.6 Hz, 1H)

[0002584] UPLC-MS (basic 2 mm): Rt = 1.05 mm; m/z = 280.1 for [M+H] ⁺

[0002585] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002586] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (10.0 g, 31.7 mmol, 1.0 eq.) in DMF (100 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of TEA (8.8 mL, 63.3 mmol, 2.0 eq.). The resulting mixture was stirred for 10 min before the portionwise addition of 3 -nitrophenylsulfonyl chloride (8.42 g, 38.0 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 30 min before being allowed to warm to RT and stirred for 2 h. The reaction mixture was re-dosed with 3- nitrophenylsulfonyl chloride (8.42 g, 38.0 mmol, 1.2 eq.) and TEA (8.8 mL, 63.3 mmol, 2.0 eq.) and was stirred at RT for 1 h. The reaction mixture was then added slowly to ice water (100 mL) and the resulting solid was filtered. The solid was purified by normal phase column chromatography (80 g cartridge) eluting with 0-100% EtOAc in DCM to afford the product (6.40 g, 13.8 mmol, 44% yield) as a yellow solid.

[0002587] ¹ H NMR (400 MHz, DMSO-d6) 5 9.36 (s, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.03 (m, 2H), 7.91 - 7.85 (m, 2H), 7.64 (t, J = 1.7 Hz, 1H), 7.60 (d, J = 8.1 Hz, 1H), 7.58 - 7.47 (m, 2H), 7.46 - 7.40 (m, 2H), 7.24 (t, J = 7.8 Hz, 1H), 5.18 (dd, J = 10.9, 4.4 Hz, 1H), 3.42 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0002588] UPLC-MS (basic 2 mm): Rt = 1.10 mm; m/z = 465.1 for [M+H] ⁺

[0002589] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002590] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (6.50 g, 13.8 mmol, 1.0 eq.), iron (7.70 g, 138 mmol, 10.0 eq.) and ammonium chloride (3.68 g, 68.9 mmol, 5.0 eq.) in EtOH (60.0 mL) and water (30.0 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious EtOH and DCM. The filtrate was concentrated to dryness before being re-suspended in EtOAc (300 mL), washed with aq. saturated Na ₂ CO ₃ solution (250 mL), and water (250 mL), dried over anhydrous sodium sulfate and concentrated to dryness to afford the product (5.04 g, 11.6 mmol, 84% yield) as an orange solid, which was used in the next step without further purification.

[0002591] ¹ H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.12 - 8.06 (m, 1H), 7.95 (dt, J = 8.3, 0.9 Hz, 1H), 7.57 (s, 1H), 7.53 (dt, J = 7.7, 1.4 Hz, 1H), 7.52 - 7.47 (m, 2H), 7.46 - 7.40 (m, 1H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.58 (dt, J = 7.7, 2.2 Hz, 2H), 5.40 (s, 2H), 4.94 - 4.84 (m, 1H), 3.36 (dd, J = 13.8, 5.0 Hz, 1H), 2.98 (dd, J = 13.8, 9.9 Hz, 1H).

[0002592] UPLC-MS (basic 2 min): Rt = 1.08 min; m/z = 435.2 for [M+H] ⁺

[0002593] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]thieno[2,3-b]pyrazine-6-c arboxamide

[0002594] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in anhydrous DMF (10.0 mb) was added thieno[2,3-B]pyrazine-6-carboxylic acid (249 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 2 h. The reaction mixture was diluted with EtOAc (30.0 mL) and washed with brine (30.0 mL), saturated Na ₂ CO ₃ solution (30.0 mL), and brine again (30.0 mL). The organics were dried over anhydrous sodium sulfate, filtered and concentrated under reduced pressure to afford the product (1.05 g, 1.76 mmol, assumed quantitative yield) as an orange oil.

[0002595] ¹ H NMR (400 MHz, DMSO-d6) 5 10.78 (s, 1H), 9.07 (d, J = 8.3 Hz, 1H), 8.91 (d, J = 2.3 Hz, 1H), 8.78 (d, J = 2.3 Hz, 1H), 8.61 (s, 1H), 8.10 (ddd, J = 7.9, 1.4, 0.7 Hz, 1H), 7.97 - 7.94 (m, 3H), 7.85 (ddd, J = 8.2, 2.1, 1.0 Hz, 1H), 7.61 (t, J = 1.5 Hz, 1H), 7.52 - 7.40 (m, 5H), 7.34 (t, J = 7.9 Hz, 1H), 7.27 - 7.19 (m, 2H), 4.99 (ddd, J = 10.9, 8.3, 4.4 Hz, 1H), 3.40 (dd, J = 13.8, 4.1 Hz, 1H), 3.00 (dd, J = 13.8, 10.9 Hz, 1H). - residual EtOAc (33.7 wt%) and DML (5.73 wt%); 2 extra protons seen in aromatic region

[0002596] UPLC-MS (basic 2 mm): Rt = 1.14 mm; m/z = 597.3 [M+H] ⁺

[0002597] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]thieno[2, 3-b]pyrazine-6-carboxamide

[0002598] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]thieno[2,3-b]pyrazine-6-c arboxamide (687 mg, 1.15 mmol, 1.0 eq.) in EtOH (12.0 mL) was added hydroxylamine hydrochloride (160 mg, 2.30 mmol, 2.0 eq.) and DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.). The reaction mixture was stirred under reflux for 16 h. The reaction mixture was then cooled to RT and concentrated to dryness to afford the product (725 mg, 1.15 mmol, assumed quantitative yield), as an orange oil, which was used in the next step without further purification.

[0002599] UPLC-MS (basic 2 mm): Rt = 1.01 mm; m/z = 630.2 for [M+H] ⁺

[0002600] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-(thieno[2,3- b]pyrazine-6- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate

[0002601] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]thieno[2, 3-b]pyrazine-6-carboxamide (725 mg, 1.15 mmol, 1.0 eq.) in acetic acid (14.0 mL) was added acetic anhydride (0.33 mL, 3.49 mmol, 1.0 eq.) and the reaction mixture was stirred at RT for 2 h. The reaction mixture was then concentrated to dryness and the residue was initially purified by normal phase column chromatography (24 g cartridge) eluting with 0-100% EtOAc in DCM, then purified by reverse phase column chromatography (24 g cartridge) eluting with 30-55% MeCN (0.1% NH ₃ ) in water (0.1% NH ₃ ) to afford the product (220 mg, 0.327 mmol, 28% yield) as an orange oil.

[0002602] ¹ H NMR (400 MHz, DMSO-d6) 5 10.69 (s, 1H), 8.90 (d, J = 2.3 Hz, 1H), 8.77 (d, J = 2.3 Hz, 1H), 8.56 (s, 1H), 8.05 (d, J = 7.6 Hz, 1H), 7.95 (t, J = 2.0 Hz, 1H), 7.91 (d, J = 7.7 Hz, 1H), 7.79 - 7.75 (m, 1H), 7.57 (s, 1H), 7.43 (dd, J = 7.9, 1.6 Hz, 4H), 7.28 (t, J = 7.8 Hz, 1H), 7.24 - 7.21 (m, 2H), 7.08 (t, J = 7.7 Hz, 1H), 6.68 (s, 2H), 4.94 (s, 1H), 3.30 (d, J = 7.2 Hz, 1H), 3.01 (dd, J = 13.7, 9.9 Hz, 1H), 2.04 (s, 3H). - residual EtOAc (6.33 wt%) and MeCN (4.30 wt%)

[0002603] UPLC-MS (basic 6 mm): Rt = 2.92 mm; m/z = 672.2 for [M+H] ⁺

[0002604] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]thieno[2,3-b]pyra zine-6-carboxamide

[0002605] To a magnetically stirred solution of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2- [[3-(thieno[2,3-b]pyrazine-6- carbonylamino)phenyl]sulfonylamino]ethyl]phenyl]methylene]am ino] acetate (220 mg, 0.327 mmol, 1.0 eq.) in acetic acid (8.0 mL) was added zinc (428 mg, 6.55 mmol, 20.0 eq.). The reaction mixture was stirred at RT for 24 h. The reaction mixture was filtered, washed with copious MeCN and EtOH and concentrated to dryness. The residue was submitted for purification via reverse phase preparative HPLC on a Waters XBridge C18 (19 mm x 150 mm, 10 pm) eluting with 15-50% MeCN in water (0.2% TFA) to afford the product (19 mg, 0.0309 mmol, 9% yield) as a yellow solid.

[0002606] UPLC-MS (basic 2 mm): Rt = 1.04 mm; m/z = 616.1.4 for [M+H] ⁺

[0002607] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]thieno[2,3-b]pyra zine-6-carboxamide

[0002608] To a magnetically stirred solution of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-6,7-dihydrothien o[2,3-b]pyrazine-6-carboxamide (19.0 mg, 0.0309 mmol, 1.0 eq.) in 1,4-dioxane (2.0 mL) was added 4 N HC1 in 1,4-dioxane (1.0 mL, 4.0 mmol, 130 eq.) and the resultant suspension stirred at RT for 1 h before being concentrated under reduced pressure. This was repeated three more times before being concentrated under reduced pressure a final time. The wet product was dissolved in water/MeCN (40:60) and concentrated under reduced pressure, before being dried in the vacuum oven overnight to obtain the product (12.0 mg, 0.0184 mmol, 60% yield) as a yellow solid.

[0002609] ¹ H NMR (400 MHz, DMSO-d6) 5 10.55 (s, 1H), 9.20 (s, 2H), 8.94 (d, J = 4.4 Hz, 3H), 8.21 (s, 2H), 8.07 (dt, 1H), 7.91 (dt, 1H), 7.85 (dt, J = 6.6 Hz, 1H), 7.72 (t, 1H), 7.56 (t, J = 7.7 Hz, 1H), 7.53 - 7.40 (m, 5H), 7.27 (td, J = 7.7, 2.1 Hz, 1H), 7.19 - 7.11 (m, 2H), 5.00 (td, J = 9.1, 4.6 Hz, 1H), 4.70 (t, J = 6.4 Hz, 1H), 3.67 (dd, J = 6.6, 2.0 Hz, 2H), 3.09 - 2.98 (m, 1H).

[0002610] ¹ H NMR-D20 (400 MHz, DMSO-d6) 5 8.16 (d, J = 0.7 Hz, 1H), 7.97 (d, J = 7.9 Hz, 1H), 7.85 (d, J = 8.0 Hz, 1H), 7.76 (d, J = 1.1 Hz, 1H), 7.59 (s, 1H), 7.50 - 7.44 (m, 3H), 7.44 -

7.38 (m, 2H), 7.36 - 7.30 (m, 1H), 7.26 (td, J = 7.6, 3.7 Hz, 1H), 7.19 - 7.15 (m, 2H), 4.94 (dd, J = 10.2, 4.9 Hz, 1H), 4.59 - 4.54 (m, 1H), 3.61 (d, J = 3.4 Hz, 2H), 3.33 (dd, J = 14.1, 4.8 Hz, 1H), 3.06 - 2.98 (m, 1H).

[0002611] UPLC-MS (basic 6 min): Rt = 2.46 min; m/z = 616.1 for [M+H] ⁺ , 93% purity

Example 119: Exemplary synthesis of Compound 273

[0002612] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002613] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (37.0 g, 105 mmol, 1.0 eq.) and 2-aminothiophenol (13.2 g, 105 mmol, 1.0 eq.) in toluene (500 mb) was added DIPEA (54.9 mL, 315 mmol, 3.0 eq.) and T3P (75.1 mL, 126 mmol, 1.2 eq.). The reaction was stirred at 115 °C for 4 h. After cooling, the reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (500 mL) and stirring for 30 min. The reaction was then diluted with ethyl acetate (600 mL) and water (300 mL). After separation of the phases, the organics were washed with water (500 mL) and brine (500 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (330 g cartridge), in 2 batches, eluting with 0- 50% EtOAc in DCM to afford impure product. This was triturated with isohexane (100ml), filtered, washing with further isohexane, and air dried to afford the product (27.0 g, 71.1 mmol, 68% yield) as a white solid.

[0002614] UPLC-MS (basic 2 mm): Rt = 1.22 mm; m/z = 380.3 for [M+H] ⁺

[0002615] 1H NMR (400 MHz, DMSO-d6) 5 8.09 (dd, J = 8.0, 1.3 Hz, 1H), 8.02 - 7.88 (m, 2H), 7.81 (t, J = 1.7 Hz, 1H), 7.71 (dd, J = 7.8, 1.7 Hz, 2H), 7.57 - 7.48 (m, 2H), 7.44 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 5.16 (ddd, J = 11.0, 8.8, 4.3 Hz, 1H), 3.56 (dd, J = 13.8, 4.3 Hz, 1H), 3.13 (dd, J = 13.8, 11.1 Hz, 1H), 1.31 (s, 9H).

[0002616] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002617] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (27.0 g, 71.2 mmol, 1.0 eq.) and 4 N HC1 in 1,4-di oxane (267 mL, 1067 mmol, 15.0 eq.) was stirred at RT for 3 h. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was air-dried to afford the product (25.6 g, 81.1 mmol, assumed quantitative yield) as a white solid.

[0002618] UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H]

[0002619] 1H NMR (400 MHz, DMSO-d6) 5 9.20 (d, J = 4.6 Hz, 3H), 8.14 (ddd, J = 8.0, 1.3, 0.7 Hz, 1H), 8.04 (ddt, J = 8.2, 1.2, 0.6 Hz, 1H), 7.82 (t, J = 1.7 Hz, 1H), 7.72 (dt, J = 7.7, 1.4 Hz, 1H), 7.62 - 7.53 (m, 2H), 7.53 - 7.44 (m, 2H), 5.34 - 5.27 (m, 1H), 3.58 (dd, J = 13.9, 6.0 Hz, 1H), 3.56 (s, 1H), 3.39 (dd, J = 13.9, 8.6 Hz, 1H). Contains 6 wt% 1,4-dioxane

[0002620] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002621] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile (7.70 g, 16.5 mmol, 1.0 eq.) in DMF (45 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (4.6 mL, 33.1 mmol, 2.0 eq.). The resulting mixture was stirred for 10 min. Then, 3 -nitrophenylsulfonyl chloride (4.40 g, 19.8 mmol, 1.2 eq.) was dissolved in 5 mL anhydrous DMF and added over a period of 10 min. The reaction was allowed to stir at the same temperature for 30 min before being allowed to warm to RT and stirred for 2 h. The reaction was slowly added to 100 mL ice water mixture and precipitated solid was filtered off and washed with hexane (100 mL) to obtain the product (7.80 g,16.8 mmol, assumed quantitative yield) as a yellow solid.

[0002622] UPLC-MS (basic 2 mm): Rt = 1.11 mm; m/z = 465.1 for [M+H] ⁺

[0002623] 1H NMR (400 MHz, DMSO-d6) 5 9.36 (s, 1H), 8.19 (ddd, J = 8.3, 2.3, 1.0 Hz, 1H), 8.12 - 8.04 (m, 2H), 7.92 - 7.84 (m, 2H), 7.67 - 7.39 (m, 6H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (dd, J = 10.9, 4.3 Hz, 1H), 3.42 (dd, J = 13.9, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H). Contain 6 wt% DMF

[0002624] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002625] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (7.80 g, 13.4 mmol, 1.0 eq.), iron (7.50 g, 134 mmol, 10.0 eq.) and ammonium chloride (3.59 g, 67.2 mmol, 5.0 eq.) in ethanol (30 mL) and water (15 mL) was stirred at reflux, under a balloon of nitrogen, for 4.5 h. The reaction mixture was filtered through

Celite, washing with ethanol and DCM and concentrated in vacuo. The residue was redissolved in ethyl acetate (250 mL) and diluted with sat. sodium hydrogen carbonate solution (250 mL). After separation of the phases, the organics were washed with further sat. sodium hydrogen carbonate (250 mL) and water (250 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was triturated with DCM to afford 3-amino-N-[l-(l,3- benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]benzenesulfonamide (4.30 g, 9.90 mmol, 74% yield) as a yellow solid.

[0002626] UPLC-MS (basic 2 mm): Rt = 1.06 mm; m/z = 435.1 for [M+H] ⁺

[0002627] 1H NMR (400 MHz, DMSO-d6) 5 8.72 (d, J = 8.1 Hz, 1H), 8.13 - 8.03 (m, 1H), 7.99 - 7.90 (m, 1H), 7.60 - 7.41 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.1 Hz, 1H), 6.61 - 6.55 (m, 2H), 5.41 (s, 2H), 4.89 (ddd, J = 9.8, 8.0, 4.9 Hz, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0002628] Step 5: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]sulf amoyl]phenyl]- 1 -methyl-triazole-4-carboxamide

[0002629] A mixture of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.), 1 -methyl- 1H- 1,2,3 - triazole-4-carboxylic acid (175 mg, 1.38 mmol, 1.2 eq.), DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) in DMF (5 mL), under a balloon of nitrogen, was stirred at RT for 20 h. The reaction was diluted with ethyl acetate (100 mL), washed with brine (100 mL), aq. saturated sodium hydrogen carbonate (100 mL) and brine (100 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo to afford product (948 mg, 1.74 mmol, assumed quantitative yield) as a brown oil.

[0002630] UPLC-MS (basic 2 mm): Rt = 1.04 mm; m/z = 544.1 [M+H] ⁺

[0002631] 1H NMR (400 MHz, DMSO-d6) 5 10.57 (s, 1H), 8.99 (d, J = 8.2 Hz, 1H), 8.70 (s, 1H), 8.14 (t, J = 2.0 Hz, 1H), 8.09 (ddt, J = 7.9, 1.4, 0.6 Hz, 1H), 7.98 - 7.92 (m, 1H), 7.84 (dt, J = 8.4, 1.3 Hz, 1H), 7.58 (d, J = 1.7 Hz, 1H), 7.53 - 7.47 (m, 2H), 7.46 - 7.40 (m, 2H), 7.26 (t, J =

7.9 Hz, 1H), 7.22 - 7.15 (m, 2H), 4.98 (ddd, J = 10.7, 8.2, 4.3 Hz, 1H), 4.16 (s, 3H), 3.39 (dd, J = 13.9, 4.4 Hz, 1H), 2.98 (dd, J = 13.9, 10.6 Hz, 1H).

[0002632] Step 6: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-l-methyl -triazole-4-carboxamide

[0002633] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]phenyl]-l-methyl-triazole-4-carb oxamide (948 mg, 1.74 mmol, 1.0 eq.), DIPEA (0.91 mL, 5.23 mmol, 3.0 eq.) and hydroxylammonium chloride (242 mg, 3.49 mmol, 2.0 eq.) in ethanol (17.4 mL) was stirred at reflux for 20 h. The resulting mixture was concentrated in vacuo to afford the product (1005 mg, 1.74 mmol, assumed quantitative yield) as a yellow solid.

[0002634] UPLC-MS (basic 2 mm): Rt = 0.93 mm; m/z = 577.1 [M+H] ⁺

[0002635] Step 7: [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[(l-methyltr iazole-4- carbonyl)amino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate

[0002636] A mixture of N-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-[(E)-N'- hydroxycarbamimidoyl]phenyl]ethyl]sulfamoyl]phenyl]-l-methyl -triazole-4-carboxamide (905 mg, 1.57 mmol, 1.0 eq.) and acetic anhydride (0.45 mL, 4.71 mmol, 3.0 eq.) in acetic acid (10 mL) was stirred at RT for 20 h. The reaction mixture was concentrated in vacuo and the residue was purified via normal phase column chromatography (24 g cartridge) eluting with 5-100% EtOAc in isohexane to afford the product (381 mg, 0.616 mmol, 39% yield) as a white solid.

[0002637] UPLC-MS (basic 2 mm): Rt = 1.00 mm; m/z = 619.2 for [M+H] ⁺

[0002638] 1H NMR (400 MHz, DMSO-d6) 5 10.49 (s, 1H), 8.93 (d, J = 8.0 Hz, 1H), 8.68 (s, 1H), 8.20 (t, J = 1.9 Hz, 1H), 8.08 - 8.00 (m, 1H), 7.94 - 7.87 (m, 1H), 7.76 (dt, J = 7.9, 1.7 Hz, 1H), 7.56 (d, J = 1.8 Hz, 1H), 7.48 - 7.35 (m, 3H), 7.24 - 7.13 (m, 3H), 7.08 (t, J = 7.7 Hz, 1H), 6.65 (s, 2H), 4.96 (td, J = 9.1, 5.3 Hz, 1H), 4.15 (s, 3H), 3.31 - 3.26 (m, 1H), 3.01 (dd, J = 13.9, 9.7 Hz, 1H), 2.12 (s, 3H).

[0002639] Step 8: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-l-methyl-triazol e-4-carboxamide

[0002640] A mixture of [(E)-[amino-[3-[2-(l,3-benzothiazol-2-yl)-2-[[3-[(l-methyltr iazole-4- carbonyl)amino]phenyl]sulfonylamino]ethyl]phenyl]methylene]a mino] acetate (381 mg, 0.616 mmol, 1.0 eq.) and zinc (805 mg, 12.3 mmol, 20.0 eq.) in acetic acid (6.2 mL) was stirred at RT for 20 h. The reaction mixture was filtered through Celite, washing with copious ethanol, acetonitrile and DCM before concentrated in vacuo. The residue was purified via reverse phase preparative HPLC (Cl XBridge BEH C18, 19 mm x 150 mm, 5 um) eluting with 15-100% MeCN: water (10 mM ammonium bicarbonate) to afford the product (47 mg, 0.0838 mmol, 14% yield) as a white solid.

[0002641] UPLC-MS (basic 6 mm): Rt = 2.18 mm; m/z = 561.1 for [M+H] ⁺ , 98% purity

[0002642] 1H NMR (400 MHz, DMSO-d6) 5 8.69 (s, 1H), 8.15 (q, J = 1.3 Hz, 1H), 8.02 - 7.96 (m, 1H), 7.87 (dt, J = 8.2, 1.0 Hz, 1H), 7.70 (td, J = 4.3, 2.1 Hz, 1H), 7.64 (t, J = 1.8 Hz, 1H), 7.47 - 7.39 (m, 2H), 7.35 (ddd, J = 8.3, 7.2, 1.2 Hz, 1H), 7.26 (d, J = 7.6 Hz, 1H), 7.18 - 7.09 (m, 3H), 4.86 (dd, J = 8.8, 4.9 Hz, 1H), 4.15 (s, 3H), 3.25 (dd, J = 13.5, 4.9 Hz, 1H), 3.01 (dd, J = 13.5, 8.9 Hz, 1H). Freebase, no exchangeables visible

[0002643] Step 9: N-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-l-methyl-triazol e-4-carboxamide

[0002644] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-l-methyl-triazol e-4-carboxamide (47 mg, 0.0838 mmol) was submitted to Reach for chiral purification via SFC on a Lux iC5 (20 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO2 (0.2% v/v NH ₃ ) to afford the 1st eluting enantiomer of the product (12 mg, 0.0212 mmol, 25% yield) as a white solid.

[0002645] UPLC-MS (basic 6 mm): Rt = 2.29 mm; m/z = 561.1 for [M+H] ⁺ , 100% purity

[0002646] 1H NMR (400 MHz, DMSO-d6) 5 8.76 (s, 1H), 8.18 (s, 1H), 8.02 (d, J = 7.9 Hz, 1H), 7.88 (d, J = 8.0 Hz, 1H), 7.71 (d, J = 7.1 Hz, 1H), 7.62 (s, 1H), 7.47 - 7.42 (m, 2H), 7.37 (t, J = 7.4 Hz, 1H), 7.29 (d, J = 7.6 Hz, 1H), 7.20 - 7.10 (m, 3H), 4.89 (s, 1H), 4.15 (s, 3H), 3.00 (dd, J = 13.6, 9.3 Hz, 1H).

Example 121: Exemplary synthesis of Compound 264

[0002647] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002648] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2-aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in toluene (245 mb) was added DIPEA (22.0 mL, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirred for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid.

[0002649] UPLC-MS (basic 2 mm): Rt = 1.23 mm; m/z = 380.3 for [M+H] ⁺

[0002650] 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H). Purity appears to be ca. 90%

[0002651] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002652] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60.0 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid.

[0002653] 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 - 7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 - 7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). One CH not observed. 0.5 eq. of residual 1,4-dioxane

[0002654] UPLC-MS (basic 2 mm): Rt = 1.03 mm; m/z = 280.1 for [M+H] ⁺

[0002655] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002656] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid.

[0002657] UPLC-MS (basic 2 mm): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺

[0002658] 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0002659] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002660] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (4.45 g, 8.24 mmol, 1.0 eq.), iron (4.60 g, 82.4 mmol, 10.0 eq.) and ammonium chloride (2.20 g, 41.2 mmol, 5.0 eq.) in ethanol (45 mL) and water (22.5 mb) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (250 mL), washed with saturated sodium hydrogen carbonate solution (2 x 250 mL), and brine (250 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford the product (3.00 g, 6.90 mmol, 84% yield) as a yellow solid.

[0002661] UPLC-MS (basic 2 mm): Rt = 1.05 mm; m/z = 435.2 for [M+H] ⁺

[0002662] 1H NMR (400 MHz, DMSO-d6) 5 8.73 (d, J = 8.1 Hz, 1H), 8.09 (ddt, J = 7.9, 1.4, 0.6 Hz, 1H), 7.95 (ddt, J = 8.1, 1.2, 0.6 Hz, 1H), 7.63 - 7.39 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.58 (dddd, J = 8.5, 3.0, 2.0, 0.9 Hz, 2H), 5.41 (s, 2H), 4.93 - 4.82 (m, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0002663] Step 5: tert-Butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]piperidine- 1-carboxylate

[0002664] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added 1 -boc-piperidin-4-ylacetic acid (336 mg, 1.38 mmol, 1.2 eq.) DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 24 h. The reaction mixture was suspended in EtOAc (25 mL) and washed with water (25 mL), aq. saturated NaHCO ₃ (25 mL), and water (25 mL). The organics were dried over anhydrous sodium sulfate, filtered and concentrated to dryness to afford the product (740 mg, 1.12 mmol, 97% yield) as a yellow foam.

[0002665] UPLC-MS (basic 2 mm): Rt = 1.21 mm; m/z = 658.3 [M-H]’

[0002666] 1H NMR (400 MHz, DMSO-d6) 5 10.01 (s, 1H), 8.96 (d, J = 8.3 Hz, 1H), 8.13 - 8.06 (m, 1H), 7.98 - 7.91 (m, 1H), 7.85 (t, J = 2.0 Hz, 1H), 7.59 - 7.40 (m, 7H), 7.21 (td, J = 7.8, 4.9 Hz, 2H), 7.12 (d, J = 7.8 Hz, 1H), 4.99 - 4.89 (m, 1H), 3.93 (d, J = 13.2 Hz, 3H), 3.43 - 3.33 (m, 1H), 3.28 (d, J = 5.5 Hz, 2H), 3.03 - 2.92 (m, 1H), 2.27 (d, J = 7.0 Hz, 2H), 1.67 (d, J = 13.2 Hz, 2H), 1.40 (s, 9H), 1.39 (d, J = 2.6 Hz, 3H), 1.09 (td, J = 14.2, 7.9 Hz, 3H)

[0002667] Step 6: tert-Butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]anilino]-2-oxo-e thyl]piperidine-1-carboxylate

[0002668] To a magnetically stirred solution of tert-butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2- (3-cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]piperidi ne-1-carboxylate (740 mg, 1.12 mmol, 1.0 eq.) in ethanol (25 mL) was added DIPEA (0.59 mL, 3.36 mmol, 3.0 eq.) and hydroxylammonium chloride (156 mg, 2.24 mmol, 2.0 eq.) and the reaction mixture was heated to 85 °C and stirred for 17 h before being cooled to RT concentrated to dryness to afford the product (777 mg, 1.12 mmol, assumed quantitative yield) as a yellow foam.

[0002669] UPLC-MS (basic 2 mm): Rt = 1.11 mm; m/z = 693.4 [M+H] ⁺

[0002670] Step 7: tert-Butyl 4-[2-[3-[[2-[3-(N'-acetoxycarbamimidoyl)phenyl]-l-(l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]piper idine-1-carboxylate

[0002671] To a magnetically stirred solution of tert-butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2- [3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]anilino]- 2-oxo-ethyl]piperidine-l- carboxylate (777 mg, 1.12 mmol, 1.0 eq.) and acetic anhydride (0.30 mL, 3.36 mmol, 3.0 eq.) in acetic acid (8 mL) was stirred at RT for 4 h. The reaction mixture was concentrated to dryness and the residue was purified via normal phase column chromatography (40 g cartridge) eluting with 0-90% EtOAc in DCM to afford the product (350 mg, 0.476 mmol, 42% yield) as a yellow glass.

[0002672] UPLC-MS (basic 2 min): Rt = 1.14 min; m/z = 735.4 for [M+H]

[0002673] 1H NMR (400 MHz, DMSO-d6) 5 9.94 (s, 1H), 8.91 (d, J = 8.2 Hz, 1H), 8.08 - 8.01 (m, 1H), 7.94 - 7.88 (m, 1H), 7.87 (t, J = 1.9 Hz, 1H), 7.57 (d, J = 1.8 Hz, 1H), 7.54 - 7.45 (m, 2H), 7.45 - 7.37 (m, 2H), 7.21 (d, J = 7.6 Hz, 1H), 7.15 (t, J = 7.9 Hz, 1H), 7.13 - 7.06 (m, 2H), 6.71 (s, 2H), 4.92 (td, J = 8.9, 5.3 Hz, 1H), 3.92 (d, J = 13.1 Hz, 2H), 3.28 (d, J = 5.3 Hz, 1H), 3.00 (dd, J = 13.8, 9.6 Hz, 1H), 2.73 (s, 2H), 2.23 (d, J = 7.1 Hz, 2H), 2.15 (s, 3H), 1.65 (d, J = 12.9 Hz, 2H), 1.39 (s, 9H), 1.06 (tt, J = 12.2, 6.2 Hz, 2H).

[0002674] Step 8: tert-Butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]pip eridine-1-carboxylate

[0002675] A mixture of tert-butyl 4-[2-[3-[[2-[3-(N'-acetoxycarbamimidoyl)phenyl]-l-(l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]piper idine-l-carboxylate (350 mg, 0.476 mmol, 1.0 eq.) and zinc (311 mg, 4.76 mmol, 10.0 eq.) in acetic acid (5 mL) was stirred at RT for 42 h. The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM and the filtrate was concentrated to dryness. The residue was purified via preparative-HPLC on a Cl XBridge BEH C18 (19 mm x 150 mm, 5 um) eluting with 30-50% MeCN in 10 mM ammonium bicarbonate (+0.1% NH ₄ OH). The residue was suspended in 4 N HC1 in 1,4-dioxane (1.0 mL) and stirred at RT for 16 h before being concentrated to dryness. The residue was suspended in MeCN/water, concentrated to dryness and dried in a vacuum oven overnight to afford the product (74 mg, 0.128 mmol, 27% yield) as a beige solid.

[0002676] UPLC-MS (basic 6 mm): Rt = 1.53 mm; m/z = 577.3 for [M+H] ⁺

[0002677] 1H NMR (400 MHz, DMSO-d6) 5 10.29 (s, 1H), 9.27 (s, 2H), 9.16 (s, 2H), 8.96 (d, J = 8.0 Hz, 1H), 8.92 - 8.70 (m, 2H), 8.10 - 8.06 (m, 1H), 7.94 - 7.91 (m, 2H), 7.73 (d, J = 1.8 Hz, 1H), 7.57 (dt, J = 8.1, 1.4 Hz, 1H), 7.53 - 7.50 (m, 2H), 7.49 - 7.47 (m, 1H), 7.43 (dd, J = 8.2, 7.0 Hz, 1H), 7.23 (t, J = 7.8 Hz, 1H), 7.15 (t, J = 7.8 Hz, 1H), 7.11 (dt, J = 7.8, 1.6 Hz, 1H), 5.00 (ddd, J = 10.1, 8.0, 4.7 Hz, 1H), 3.43 - 3.34 (m, 1H), 3.25 (d, J = 12.5 Hz, 2H), 3.04 (dd, J = 13.9, 10.1 Hz, 1H), 2.88 (q, J = 12.0 Hz, 2H), 2.34 (d, J = 7.0 Hz, 2H), 2.11 - 1.99 (m, 1H), 1.86 - 1.78 (m, 2H), 1.51 - 1.40 (m, 2H). bis-HCl salt

[0002678] Step 9: N-[3-[[(lR)-l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-2-(4-piperidyl)a cetamide; dihydrochloride

[0002679] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-2-(4-piperidyl)a cetamide (74 mg, 0.128 mmol) was purified via SFC using a Lux iC5 (20 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (0.2% v/v NH ₃ ). The residue was then stirred in 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 62.5 eq.) at RT for 4 h, before being concentrated, re-suspended in a small volume of MeCN/water, concentrated to dryness and dried in a vacuum oven overnight to afford the product (12.0 mg, 0.0185 mmol, 14% yield) as a beige solid.

[0002680] UPLC-MS (acidic 6 mm): Rt = 1.44 mm; m/z = 577.2 for [M+H] ⁺ , 100% purity

[0002681] 1H NMR (400 MHz, DMSO-d6) 5 10.21 (s, 1H), 9.24 (s, 2H), 9.07 (s, 2H), 8.95 (d, J = 8.1 Hz, 1H), 8.73 (s, 1H), 8.56 (s, 1H), 8.07 (dd, J = 7.6, 1.2 Hz, 1H), 7.95 - 7.88 (m, 2H), 7.73 (s, 1H), 7.59 - 7.39 (m, 5H), 7.25 (t, J = 7.8 Hz, 1H), 7.19 - 7.06 (m, 2H), 5.06 - 4.95 (m, 1H), 3.43 - 3.33 (m, 1H), 3.25 (d, J = 11.7 Hz, 2H), 3.04 (dd, J = 13.8, 10.1 Hz, 1H), 2.89 (d, J = 12.0 Hz, 2H), 2.32 (d, J = 7.1 Hz, 2H), 2.05 (s, 1H), 1.82 (d, J = 13.8 Hz, 2H), 1.43 (q, J = 11.3 Hz, 2H).

Example 122: Exemplary synthesis of Compound 264

[0002682] Step 1 : tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]carbamat e

[0002683] To a magnetically stirred solution of 2-(tert-butoxycarbonylamino)-3-(3- cyanophenyl)propanoic acid (12.1 g, 41.7 mmol, 1.0 eq.) and 2-aminothiophenol (5.22 g, 41.7 mmol, 1.0 eq.) in toluene (245 mb) was added DIPEA (22.0 mL, 125 mmol, 3.0 eq.) and T3P (30.0 mL, 50.0 mmol, 1.2 eq.). The reaction was stirred at RT for 1 h, then at 115 °C for 6 h, and then at RT for 18 h. The reaction was then quenched via the addition of aq. saturated Na ₂ CO ₃ (200 mL) and stirred for 1 h. The reaction was then diluted with ethyl acetate (500 mL) and water (200 mL). After separation of the phases, the organics were washed with water (2 x 500 mL, 100 mL of brine was added to the second wash), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The residue was then purified by normal phase column chromatography (220 g cartridge) eluting with 0-40% EtOAc in DCM to afford impure product. This was dissolved in the minimum DCM, an equal volume of isohexane was added to it and air was cautiously blown into the homogeneous mixture until solid began to crash out. The solid was filtered, washing with further isohexane, and air dried to afford the product (6.03 g, 15.9 mmol, 38% yield) as a yellow solid.

[0002684] UPLC-MS (basic 2 mm): Rt = 1.23 mm; m/z = 380.3 for [M+H] ⁺

[0002685] 1H NMR (400 MHz, DMSO-d6) 5 8.06 (d, J = 7.9 Hz, 1H), 7.94 (ddd, J = 8.1, 1.3, 0.6 Hz, 1H), 7.88 (d, J = 8.8 Hz, 1H), 7.77 (s, 1H), 7.67 (dd, J = 7.9, 1.7 Hz, 2H), 7.49 (ddd, J = 10.3, 5.4, 2.5 Hz, 2H), 7.40 (ddd, J = 8.3, 7.3, 1.3 Hz, 1H), 5.18 - 5.08 (m, 1H), 3.52 (dd, J = 13.8, 4.3 Hz, 1H), 3.09 (dd, J = 13.8, 11.1 Hz, 1H), 1.27 (s, 9H). Purity appears to be ca. 90%

[0002686] Step 2: 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride

[0002687] A mixture of tert-butyl N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl] carbamate (6.03 g, 15.9 mmol, 1.0 eq.) and 4 N HC1 in 1,4-dioxane (60.0 mL, 238 mmol, 15.0 eq.) was stirred at RT for 2 h, during which time a large mass of dark purple oily-solid formed. The reaction mixture was then concentrated in vacuo before being triturated with diethyl ether and filtered, washing with further diethyl ether. The solid was taken and dried in a vacuum oven overnight to afford 5.143 g as a pink solid. The residue on the filter was dissolved in methanol, concentrated in vacuo and dried in a vacuum oven overnight to afford 574 mg as a pink oily-solid. These were combined to afford the product (5.72 g, 18.1 mmol, assumed quantitative yield) as a pink solid.

[0002688] 1H NMR (400 MHz, DMSO-d6) 5 9.17 - 9.07 (m, 3H), 8.13 - 8.08 (m, 1H), 8.04 -

7.96 (m, 1H), 7.78 (d, J = 1.7 Hz, 1H), 7.69 (dt, J = 7.5, 1.4 Hz, 1H), 7.56 - 7.50 (m, 2H), 7.50 -

7.42 (m, 2H), 5.27 (s, 1H), 3.52 (m, 1H), 3.35 (dd, J = 13.9, 8.6 Hz, 1H). One CH not observed. 0.5 eq. of residual 1,4-dioxane

[0002689] UPLC-MS (basic 2 min): Rt = 1.03 min; m/z = 280.1 for [M+H] ⁺

[0002690] Step 3: N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide

[0002691] A mixture of 3-[2-amino-2-(l,3-benzothiazol-2-yl)ethyl]benzonitrile;hydro chloride (5.72 g, 18.1 mmol, 1.0 eq.) and DMF (60.3 mL) was cooled to 0 °C, under a balloon of nitrogen, before the addition of triethylamine (7.6 mL, 54.3 mmol, 3.0 eq.). The resulting mixture was stirred for 10 min before the portion wise addition of 3 -nitrophenylsulfonyl chloride (4.81 g, 21.7 mmol, 1.2 eq.) over 10 min. The resulting mixture was stirred at the same temp for 10 min before being allowed to warm to RT and stirred for 2 h. The reaction was quenched via the addition of water (100 mL) and diluted with ethyl acetate (250 mL) and further water (100 mL). After separation of the phases, the organics were washed with brine (2 x 200 mL), dried over anhydrous sodium sulfate, filtered and concentrated in vacuo. The resulting yellow foam was then triturated with DCM, filtered, washing the precipitate with further DCM and air dried to afford the product (3.40 g, 7.32 mmol, 40% yield) as a yellow solid.

[0002692] UPLC-MS (basic 2 mm): Rt = 1.12 mm; m/z = 465.1 for [M+H] ⁺

[0002693] 1H NMR (400 MHz, DMSO-d6) 5 9.37 (d, J = 7.5 Hz, 1H), 8.20 (ddd, J = 8.2, 2.3, 1.0 Hz, 1H), 8.12 - 8.05 (m, 2H), 7.94 - 7.83 (m, 2H), 7.64 (t, J = 1.6 Hz, 1H), 7.62 - 7.40 (m, 5H), 7.24 (t, J = 7.7 Hz, 1H), 5.18 (s, 1H), 3.42 (dd, J = 14.0, 4.5 Hz, 1H), 3.04 (dd, J = 13.9, 10.9 Hz, 1H).

[0002694] Step 4: 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide

[0002695] A mixture of N-[l-(l,3-benzothiazol-2-yl)-2-(3-cyanophenyl)ethyl]-3-nitro - benzenesulfonamide (4.45 g, 8.24 mmol, 1.0 eq.), iron (4.60 g, 82.4 mmol, 10.0 eq.) and ammonium chloride (2.20 g, 41.2 mmol, 5.0 eq.) in ethanol (45 mL) and water (22.5 mL) was stirred, under nitrogen, at 85 °C for 4 h. After cooling to RT, the reaction mixture was filtered through Celite, washing with copious ethanol and DCM. The filtrate was concentrated in vacuo before being re-suspended in ethyl acetate (250 mL), washed with saturated sodium hydrogen carbonate solution (2 x 250 mL), and brine (250 mL), dried over anhydrous sodium sulfate and concentrated in vacuo to afford the product (3.00 g, 6.90 mmol, 84% yield) as a yellow solid.

[0002696] UPLC-MS (basic 2 mm): Rt = 1.05 mm; m/z = 435.2 for [M+H] ⁺

[0002697] 1H NMR (400 MHz, DMSO-d6) 5 8.73 (d, J = 8.1 Hz, 1H), 8.09 (ddt, J = 7.9, 1.4, 0.6 Hz, 1H), 7.95 (ddt, J = 8.1, 1.2, 0.6 Hz, 1H), 7.63 - 7.39 (m, 5H), 7.33 (t, J = 7.7 Hz, 1H), 6.92 (t, J = 7.9 Hz, 1H), 6.73 (t, J = 2.0 Hz, 1H), 6.58 (dddd, J = 8.5, 3.0, 2.0, 0.9 Hz, 2H), 5.41 (s, 2H), 4.93 - 4.82 (m, 1H), 3.41 - 3.34 (m, 1H), 2.98 (dd, J = 13.8, 10.0 Hz, 1H).

[0002698] Step 5: tert-Butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]piperidine- 1-carboxylate

[0002699] To a magnetically stirred solution of 3-amino-N-[l-(l,3-benzothiazol-2-yl)-2-(3- cyanophenyl)ethyl]benzenesulfonamide (500 mg, 1.15 mmol, 1.0 eq.) in DMF (5 mL) was added 1 -boc-piperidin-4-ylacetic acid (336 mg, 1.38 mmol, 1.2 eq.) DIPEA (0.60 mL, 3.45 mmol, 3.0 eq.) and HATU (656 mg, 1.73 mmol, 1.5 eq.) and the reaction mixture was stirred at RT for 24 h. The reaction mixture was suspended in EtOAc (25 mL) and washed with water (25 mL), aq. saturated NaHCO ₃ (25 mL), and water (25 mL). The organics were dried over anhydrous sodium sulfate, filtered and concentrated to dryness to afford the product (740 mg, 1.12 mmol, 97% yield) as a yellow foam.

[0002700] UPLC-MS (basic 2 mm): Rt = 1.21 mm; m/z = 658.3 [M-H]’

[0002701] 1H NMR (400 MHz, DMSO-d6) 5 10.01 (s, 1H), 8.96 (d, J = 8.3 Hz, 1H), 8.13 - 8.06 (m, 1H), 7.98 - 7.91 (m, 1H), 7.85 (t, J = 2.0 Hz, 1H), 7.59 - 7.40 (m, 7H), 7.21 (td, J = 7.8, 4.9 Hz, 2H), 7.12 (d, J = 7.8 Hz, 1H), 4.99 - 4.89 (m, 1H), 3.93 (d, J = 13.2 Hz, 3H), 3.43 - 3.33

(m, 1H), 3.28 (d, J = 5.5 Hz, 2H), 3.03 - 2.92 (m, 1H), 2.27 (d, J = 7.0 Hz, 2H), 1.67 (d, J = 13.2 Hz, 2H), 1.40 (s, 9H), 1.39 (d, J = 2.6 Hz, 3H), 1.09 (td, J = 14.2, 7.9 Hz, 3H)

[0002702] Step 6: tert-Butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-[3-(N'- hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]anilino]-2-oxo-e thyl]piperidine-1-carboxylate

[0002703] To a magnetically stirred solution of tert-butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2- (3-cyanophenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]piperidi ne-1-carboxylate (740 mg, 1.12 mmol, 1.0 eq.) in ethanol (25 mL) was added DIPEA (0.59 mL, 3.36 mmol, 3.0 eq.) and hydroxylammonium chloride (156 mg, 2.24 mmol, 2.0 eq.) and the reaction mixture was heated to 85 °C and stirred for 17 h before being cooled to RT concentrated to dryness to afford the product (777 mg, 1.12 mmol, assumed quantitative yield) as a yellow foam.

[0002704] UPLC-MS (basic 2 mm): Rt = 1.11 mm; m/z = 693.4 [M+H] ⁺

[0002705] Step 7: tert-Butyl 4-[2-[3-[[2-[3-(N'-acetoxycarbamimidoyl)phenyl]-l-(l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]piper idine-1-carboxylate

[0002706] To a magnetically stirred solution of tert-butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2- [3-(N'-hydroxycarbamimidoyl)phenyl]ethyl]sulfamoyl]anilino]- 2-oxo-ethyl]piperidine-l- carboxylate (777 mg, 1.12 mmol, 1.0 eq.) and acetic anhydride (0.30 mL, 3.36 mmol, 3.0 eq.) in acetic acid (8 mL) was stirred at RT for 4 h. The reaction mixture was concentrated to dryness and the residue was purified via normal phase column chromatography (40 g cartridge) eluting with 0-90% EtOAc in DCM to afford the product (350 mg, 0.476 mmol, 42% yield) as a yellow glass.

[0002707] UPLC-MS (basic 2 mm): Rt = 1.14 mm; m/z = 735.4 for [M+H] ⁺

[0002708] 1H NMR (400 MHz, DMSO-d6) 5 9.94 (s, 1H), 8.91 (d, J = 8.2 Hz, 1H), 8.08 - 8.01 (m, 1H), 7.94 - 7.88 (m, 1H), 7.87 (t, J = 1.9 Hz, 1H), 7.57 (d, J = 1.8 Hz, 1H), 7.54 - 7.45 (m, 2H), 7.45 - 7.37 (m, 2H), 7.21 (d, J = 7.6 Hz, 1H), 7.15 (t, J = 7.9 Hz, 1H), 7.13 - 7.06 (m, 2H), 6.71 (s, 2H), 4.92 (td, J = 8.9, 5.3 Hz, 1H), 3.92 (d, J = 13.1 Hz, 2H), 3.28 (d, J = 5.3 Hz, 1H),

3.00 (dd, J = 13.8, 9.6 Hz, 1H), 2.73 (s, 2H), 2.23 (d, J = 7.1 Hz, 2H), 2.15 (s, 3H), 1.65 (d, J = 12.9 Hz, 2H), 1.39 (s, 9H), 1.06 (tt, J = 12.2, 6.2 Hz, 2H).

[0002709] Step 8: tert-Butyl 4-[2-[3-[[l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]pip eridine-1-carboxylate

[0002710] A mixture of tert-butyl 4-[2-[3-[[2-[3-(N'-acetoxycarbamimidoyl)phenyl]-l-(l,3- benzothiazol-2-yl)ethyl]sulfamoyl]anilino]-2-oxo-ethyl]piper idine-l-carboxylate (350 mg, 0.476 mmol, 1.0 eq.) and zinc (311 mg, 4.76 mmol, 10.0 eq.) in acetic acid (5 mL) was stirred at RT for 42 h. The reaction mixture was filtered through Celite, washing with copious acetonitrile, ethanol and DCM and the filtrate was concentrated to dryness. The residue was purified via preparative-HPLC on a Cl XBridge BEH C18 (19 mm x 150 mm, 5 um) eluting with 30-50% MeCN in 10 mM ammonium bicarbonate (+0.1% NH ₄ OH). The residue was suspended in 4 N HC1 in 1,4-dioxane (1.0 mL) and stirred at RT for 16 h before being concentrated to dryness. The residue was suspended in MeCN/water, concentrated to dryness and dried in a vacuum oven overnight to afford the product (74 mg, 0.128 mmol, 27% yield) as a beige solid.

[0002711] UPLC-MS (basic 6 mm): Rt = 1.53 mm; m/z = 577.3 for [M+H] ⁺

[0002712] 1H NMR (400 MHz, DMSO-d6) 5 10.29 (s, 1H), 9.27 (s, 2H), 9.16 (s, 2H), 8.96 (d, J = 8.0 Hz, 1H), 8.92 - 8.70 (m, 2H), 8.10 - 8.06 (m, 1H), 7.94 - 7.91 (m, 2H), 7.73 (d, J = 1.8 Hz, 1H), 7.57 (dt, J = 8.1, 1.4 Hz, 1H), 7.53 - 7.50 (m, 2H), 7.49 - 7.47 (m, 1H), 7.43 (dd, J = 8.2, 7.0 Hz, 1H), 7.23 (t, J = 7.8 Hz, 1H), 7.15 (t, J = 7.8 Hz, 1H), 7.11 (dt, J = 7.8, 1.6 Hz, 1H), 5.00 (ddd, J = 10.1, 8.0, 4.7 Hz, 1H), 3.43 - 3.34 (m, 1H), 3.25 (d, J = 12.5 Hz, 2H), 3.04 (dd, J = 13.9, 10.1 Hz, 1H), 2.88 (q, J = 12.0 Hz, 2H), 2.34 (d, J = 7.0 Hz, 2H), 2.11 - 1.99 (m, 1H), 1.86 - 1.78 (m, 2H), 1.51 - 1.40 (m, 2H). bis-HCl salt

[0002713] Step 9: N-[3-[[(lR)-l-(l,3-benzothiazol-2-yl)-2-(3- carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-2-(4-piperidyl)a cetamide;dihydrochloride

[0002714] N- [3 - [ [ 1 -( 1 ,3 -benzothiazol-2-yl)-2-(3 - carbamimidoylphenyl)ethyl]sulfamoyl]phenyl]-2-(4-piperidyl)a cetamide (74 mg, 0.128 mmol,

1.0 eq.) was purified via SFC using a Lux iC5 (20 mm x 250 mm, 5 um) eluting with 50:50 EtOH:CO ₂ (0.2% v/v NH ₃ ). The residue was then stirred in 4 N HC1 in 1,4-dioxane (2.0 mL, 8.00 mmol, 62.5 eq.) at RT for 4 h, before being concentrated, re-suspended in a small volume of MeCN/water, concentrated to dryness and dried in a vacuum oven overnight to afford the product (13.0 mg, 0.0200 mmol, 16% yield) as a beige solid.

[0002715] UPLC-MS (acidic 6 mm): Rt = 1.44 mm; m/z = 577.2 for [M+H] ⁺ , 100% purity

[0002716] 1H NMR (400 MHz, DMSO-d6) 5 10.21 (s, 1H), 9.24 (s, 2H), 9.07 (s, 2H), 8.95 (d, J = 8.1 Hz, 1H), 8.74 (s, 1H), 8.56 (s, 1H), 8.08 (ddd, J = 7.9, 1.4, 0.6 Hz, 1H), 7.95 - 7.88 (m, 2H), 7.72 (s, 1H), 7.56 (d, J = 7.8 Hz, 1H), 7.53 - 7.41 (m, 4H), 7.25 (t, J = 7.8 Hz, 1H), 7.18 - 7.06 (m, 2H), 5.00 (td, J = 9.2, 4.6 Hz, 1H), 3.43 - 3.33 (m, 1H), 3.26 (d, J = 12.6 Hz, 2H), 3.04 (dd, J = 13.8, 10.1 Hz, 1H), 2.89 (d, J = 11.9 Hz, 2H), 2.32 (d, J = 7.3 Hz, 2H), 2.05 (s, 1H), 1.82 (d, J = 13.8 Hz, 2H), 1.42 (q, J = 12.8 Hz, 2H).

Example 123: Exemplary cloning of the catalytic domain of TMPRSS2, and expression, purification, refolding and activation of the catalytic domain of TMPRSS2

Cloning of the catalytic domain of TMPRSS2

[0002717] The nucleotide sequence of the serine protease domain was amplified from the plasmid pCAGGS-TMPRSS2 by PCR using 5’- GGATATCATATGAAACATCACCATCACCATCACATCGTGGGCGGTGAGAG- 3’ and 5’- GGATATGAATTCTTAGCCGTTTGCCTTCATTTG- 3’ as sense and antisense primers respectively. The primers were chosen to introduce a sequence coding for Met-Lys-(His)e at the 5 ’-end of the cDNA encoding the protease domain. The approximately 750-bp long amplification product was purified and subcloned into a pET24(b) vector (Novagen, Merck Bioscience) for expression into E. coli.

[0002718] The catalytic domain of TMPRSS2 was expressed in the form of inclusion bodies, as described below, then denatured, purified, refolded and activated.

Expression, purification, refolding and activation of the catalytic domain ofTMPRSS2

[0002719] The expression vector, encoding the protease domain, was transformed into E. coli BL21 (DE3) CodonPlus competent cells. The cells were incubated in LB (Luria-Bertani) medium containing 30μg/ml kanamycin at 37°C for 3 h and 220 rev./min. The expression of the catalytic domain was induced by the addition of 1 mM IPTG (isopropyl /LD- thiogalactopyranoside) at D600 =1 and the incubation was continued for 10 h at 5°C. The cells were harvested and suspended in buffer (50 mM Tris/HCl and 0.9% NaCl, pH 7.5) and lysed via ultrasound. After DNA depletion with Benzonase (25 units/g of cell pellet, Novagen), the inclusion bodies were washed and denatured in denaturation buffer (8 M urea, 10 mM Tris and 100 mM sodium phosphate, pH 8.0). The denatured protein was freed from insoluble constituents by centrifugation and filtration (0.2 //m) and the His-tagged TMPRSS2 was purified by metal chelate chromatography (Ni2+ -nitrilotriacetate agarose, Qiagen). TMPRSS2- containing fractions were pooled and renatured by rapid dilution in 50-fold volume refolding buffer (50 mM Tris, pH 7.5, 0.5 M L-argimne, 20 mM CaCh, ImM EDTA, 100 mM NaCl, 0.05% Brij 58, 0.05 mM GSSG and 0.5 mM GSH). After 3 days of incubation at 8°C, the refolding solution was concentrated by tangential filtration (Vivaflow 200, 10 kDa cut-off, Sartorius) and the buffer was exchanged to activation buffer (50 mM Tris, pH 7.5, I M NaCl and 0.05% Brij 58). The refolded TMPRSS2 was activated by removal of the N-terminal Met-Lys- (His)6 sequence, because a free isoleucine residue in position 16 at the N-terminus of the protease domain was required for activity. This was obtained by incubating the protease for 5 h with 2.5 m-units/ml of activated DAPase (Qiagen) at room temperature (~20°C). The activated protease was separated from non-activated protease and His-tagged DAPase by metal chelate chromatography and was later designated as active TMPRSS2.

[0002720] A yield of this protocol was about 0.6 mg of active catalytic domain per 2 L cell culture. For analysis of the purified protein, an SDS-side followed by Western blotting was performed using TMPRSS2-specific antibodies.

Example 124. Exemplary enzyme kinetic studies for the determination of TMPRSS2

[0002721] All measurements were performed at room temperature in 50 mM Tris/HCl buffer (pH 8.0; containing 154 mM NaCl). All substrate stock solutions (2 mM) were prepared in ultrapure water containing 10% DMSO and further diluted by water to the appropriate concentrations.

Measurements with chromogenic pNa substrates

[0002722] The cleavage of the pNa substrates was measured at 405 nm using a microplate IEMS Reader MF 1401 (Labsystems). The initial screening was performed with a single substrate concentration of 200 pM in the assay. For the five best substrates, the enzyme kinetic parameters K _m and Fmax were determined from two independent experiments.

Measurements with fluorogenic AMC substrates

[0002723] The determination of the TMPRSS2-inhibitory effect was carried out using a Satire ² fluorescence plate reader (Tecan; ZEX =380 nm and zEm =460 nm) and H-dCha-Pro-Arg- AMC x 2 TFA as a substrate. The enzyme used was the recombinant protease domain of TMPRSS2. For the determination of the inhibition constants, the measurement buffer was combined with substrate with different inhibitor concentrations, which were varied at least over the range of one order of magnitude. After enzyme addition, the steady-state rates were determined by linear regression. The K _m and Fmax values (in unit: ARFU/s) were calculated as the average of two independent measurements. The Ki values were calculated by adapting the determined rates as a function of the inhibitor and substrate concentrations to the rate equation for completely reversible binding inhibitors:

Inhibitor measurements

[0002724] The K determinations were performed according to the method of Dixon (Dixon, M. (1953). The determination of enzyme inhibitor constants. Biochem. J. 55, 170-171) using the fluorogenic substrate H-D- cyclohexylalanine-Pro-Arg-AMC (200, 100 and 50 //M). The K values were calculated as the average of two independent measurements.

Example 125. Exemplary inhibition of TMPRSSl-mediated virus propagation in the presence of synthetic serine protease inhibitors

[0002725] MDCK-TMPRSS2 cells with inducible expression of the protease TMPRSS2 were used for the experiments. MDCK-TMPRSS2 cells were isolated by stable transfection of MDCK cells (Madin Darby Canine Kidney) with the plasmids pcEFTet-On / NEO and pTRE2pur-TMPRSS2-FLAG (Bbttcher et al., Vaccine 27, 62324-6329 (2009); Bottcher et J Vira184, 5605-5614 (2010)). The expression of TMPRSS2 in these cells can be induced by adding doxycycline (Dox) to the culture medium (Tet-On expression system, Gossen and Bujard, Science 1995).

[0002726] To analyze the efficacy of synthetic serine protease inhibitors on the inhibition of influenza virus proteolytic activation by TMPRSS2, multicyclic replication and virus spread in MDCK-TMPRSS2 cells in the presence of the inhibitors was examined. MDCK-TMPRSS2 cells were first cultured in 24- well plates for 24 h in the presence and absence of 0.2 pg/mL doxycycline. The cells were subsequently infected with the human influenza isolate A/Memphis/14/96 (H1N1) and incubated for 24 h in the presence or absence of various inhibitors at 37 °C. and 5% CO ₂ . Subsequently, infected cells were immunohistochemically stained against the viral nucleoprotein. A concentration-dependent inhibition of virus proliferation and spread by the synthetic inhibitors used was demonstrated.

Example 126. Exemplary inhibition of TMPRSS2-mediated virus propagation by synthetic serine protease inhibitors in human airway epithelial cells

[0002727] Calu-3 cells (human respiratory epithelial cells, endogenous expression of TMPRSS2) were used to demonstrate the inhibitory effect of TMPRSS2-mediated viral spread. For this purpose, the cells were cultured in 6-well plates and infected with the human influenza virus isolate A/Memphis/14/96 (H1N1) in the presence and absence of inhibitor 2 (50 pM) for 72 h and at various times the virus titers in cell culture supernatant by means of Plaque test (determination of infectious virus per ml, pfu: plaque forming units) determined. A significant delay in virus replication and a 1000-fold decrease in the virus titer in the presence of inhibitor 2 compared to the control without inhibitor (w/o inhibitor) was observed.

Example 127. Inhibition of TMPRSSl-mediated viral replication by synthetic serine protease inhibitors in human respiratory epithelial cells after treatment with the inhibitors at different times

[0002728] These experiments were carried out analogously to previous examples, where the inhibitors are indicated 14 or 24 hours after infection of the cells with the influenza viral A/Memphis/14/96 (H1N1) or A/Hamburg/5/09 (H1N1) to the cell culture. Even in these cases, significant inhibition of virus replication and 50-100 fold reduction in virus titers were observed.

Example 128. Inhibition of TMPRSS2-mediated viral replication by combined treatment with a synthetic serine protease inhibitor and a neuraminidase inhibitor in human respiratory epithelial cells

[0002729] This experiment was carried out analogously to previous examples. For this purpose, Calu-3 cells were infected with the isolate A/Aichi/2/68 (H3N2) and then in the presence or absence of inhibitor 2 (20 pM) or the neuraminidase inhibitor oseltamivir carboxylate (0.1 pM) or in the presence of both inhibitors (same concentrations) for 72 h. At various times, the virus titer was determined by plaque assay. It was observed that inhibitor-2 and oseltamivir carboxylate act synergistically and that an almost complete inhibition of viral replication by combination of both inhibitors were achieved.

Example 129. Exemplary infection and multicycle viral replication in inhibitor-treated cells

[0002730] All infection experiments were performed using infection medium. For analysis of influenza virus multicycle replication in Calu-3 cells in the presence of inhibitors, cells were seeded in six-well plates and grown to confluence. The cells were then inoculated with virus at a low MOI (multiplicity of infection) of 0.0001 for 1 h in the absence of inhibitors, washed with PBS and replenished with fresh infection medium containing inhibitors at the indicated concentrations. The cells were incubated for 72 h and at 24, 48 and 72 h postinfection, supernatants were collected and viral titres were determined as pfu (plaque-forming units) by plaque assay as described previously. Briefly, MDCK cells grown in 24-well plates were inoculated with 10-fold serial dilutions of each virus sample for 1 h. The inoculum was then removed and replaced by Avicel overlay containing 1 pg/ml TPCK-treated trypsin. The cells were incubated for 48 h and subsequently immunostained using virus-specific antibodies, HRP- conjugated secondary antibodies and the peroxidase substrate TrueBlue® (KPL).

[0002731] To analyze cleavage of HA of progeny virus, Calu-3 cells were infected at a 100- fold higher MOI of 0.01 and incubated for 24 h (for A/Aichi/H3N2) or 48 h (for A/Hamburg/HINl). Virus-containing cell supernatants were cleared from cell debris by low- speed centrifugation (4100 g, 5 min) and then pelleted by ultracentrifugation (Beckman Coulter rotor SW 41 Ti, 30000 rev./min, 2 h, 4°C). Pellets were resuspended in reducing SDS sample buffer, heated at 95 °C for 5 min and subjected to SDS/PAGE and Western blot analysis using antibodies against Hl or H3 as described above.

Example 130. Exemplary cytotoxicity assay

[0002732] To determine the viability of inhibitor-treated cells, a quantitative colorimetric MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl- 2H-tetrazolium bromide] assay (Sigma) was used. Calu-3 cells grown in 96- well plates were treated with PBS or the different inhibitors at the indicated concentrations in infection medium (total volume 100 pl per well) for 48 h at 37°C. Then, 20 pl of MTT stock solution (2 mg/ml in PBS) was added to each well and the cells were further incubated for 2-3 h at 37°C, until purple formazan crystals are visible. Finally, the MTT- containing medium was removed and the formazan dissolved in 200 pl of DMSO, after which the absorbance was measured at 562 nm on a microplate ELISA reader.

Example 131. Exemplary examination of Coronaviruses Employing TMPRSS2 for S Protein Priming in Human Cell Lines

[0002733] The examination of coronaviruses can be done using methods known from the literature (Hoffmann, M. et al. 2020 Apr 16;181(2):271-280).

[0002734] Calu-3 cells were pre-incubated with TMPRSS2 inhibitor and subsequently inoculated with pseudoparticles harboring MERS-S, SARS-S and SARS-2-S viral glycoproteins (coronaviruses employing TMPRSS2 for S protein priming in human cell lines).

[0002735] Calu-3 cells were pre-incubated with TMPRSS2 inhibitor and infected with SARS-CoV-2. Subsequently, the cells were washed and genome equivalents in culture supernatants are determined by quantitative RT-PCR.

Example 132. Evaluation of activity of compounds in the TMPRSS2

Materials

[0002736] Reaction Buffer: 50 mM Tris-HCl pH 8, 150 mM NaCl, 0.005% Bnj35, 1% DMSO.

[0002737] Enzymes: TMPRSS2: CusaBio cat# CSB-YP023924HU; Recombinant Human TMPRSS2 protein (106-492 aa) N-terminal 6xHis-tagged, expressed in Yeast cells. MW=44.8 kDa, Lyophilized from 20mM: Tris HC1, 0.5 M NaCl, 6% Trehalose, pH 8.0, > 85% purity as determined by SDS-PAGEty. Uniprot: 015393; 10 nM in the reaction.

[0002738] Substrate: Boc-Gln-Ala-Arg-AMC: Enzo Cat#; ML-P237-0005, MW=581.76 Da; 25 pM in the reaction.

[0002739] Control compound: Camostat mesylate

[0002740] Measurement: EnVision (PE)Ex/Em 355/460 nm

[0002741] The enzyme (TMPRSS2: CusaBio cat# CSB-YP023924HU. Recombinant Human TMPRSS2 protein (106-492 aa) N-terminal 6xHis-tagged, expressed in Yeast cells. MW=44.8 kDa, Lyophilized from 20mM: Tris HC1, 0.5 M NaCl, 6% Trehalose, pH 8.0, > 85% purity as determined by SDS-PAGEty. Uniprot: 015393 10 nM in the reaction) and substrate (Boc-Gln- Ala-Arg-AMC: Enzo Cat# BML-P237-0005, MW=581.76 Da; 25 pM in the reaction) were prepared in Reaction Buffer (50 mM Tris-HCl pH 8, 150 mM NaCl, 0.005% Brij35, 1% DMSO). After the enzyme solution was delivered into the reaction well, the compounds in DMSO were delivered to the reaction mixture by using Acoustic Technology (Echo 550, LabCyte Inc.

Sunnyvale, CA) in nanoliter range. After 20 min pre-incubation, the substrate solution was delivered into the reaction well to initiate the reaction. The enzyme activities were monitored every 5 min as a time-course measurement of the increase in fluorescence signal from fluorescently-labeled peptide substrate for 120 min. at room temperature. Data was analyzed by taking slope* (signal/time) of linear portion of measurement. The slope was calculated using Excel, and the curve fits were performed using Prism software.

[0002742] Table 3a and Table 3b below shows activity data.

Table 3a. In Vitro TMPRSS2 biochemical activity of compounds measured using assay described in Example 132.

Table 3b. In Vitro TMPRSS2 biochemical activity of compounds measured using assay described in Example 132.

A = IC50 < 10pM; B = IC50 > 10pM (or minimal or no inhibition and/or compound activity that cannot be fit to an IC50 curve)

[0002743] Table 4 below shows activity data.

Table 4. In Vitro Cathepsin B biochemical activity of compounds measured using assay described in Example 132.

A = IC50 < 10pM; B = IC50 > 10pM (or minimal or no inhibition and/or compound activity that cannot be fit to an IC50 curve)

INCORPORATION BY REFERENCE

[0002744] All publications and patents mentioned herein, including those items listed below, are hereby incorporated by reference in their entirety for all purposes as if each individual publication or patent was specifically and individually incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.

EQUIVALENTS

[0002745] While specific embodiments of the subject disclosure have been discussed, the above specification is illustrative and not restrictive. Many variations of the disclosure will become apparent to those skilled in the art upon review of this specification. The full scope of the disclosure should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

[0002746] Unless otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term “about.” Accordingly, unless indicated to the contrary, the numerical parameters set forth in this specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present disclosure.