The present invention relates to method for determining the nephrotoxicity or nephron- protective effect of a compound, for example a small molecule pharmaceutical, using the most reliable marker of kidney tubular dysfunction. The method comprises the steps of administering the compound to a transgenic organism expressing a fluorophore fusion protein secreted to the blood stream, and subsequently detecting the fluorophore in the urine/fish pool.

Background of the invention

The proximal tubule (PT) of the kidney plays a key role in homeostasis, via the reabsorption and processing of a large amount of filtered solutes through specialized transport systems. In physiological conditions, the epithelial cells lining the PT reabsorb the filtered low-molecular- weight (LMW) proteins (MW up to that of albumin ~69 kDa), including hormones, vitamins and their binding proteins, enzymes, immunoglobulin light chains, as well as drugs and toxins via apical receptor-mediated endocytosis and lysosomal processing. This pathway is particularly developed in PT cells, ensuring that the human urine is virtually devoid of plasma proteins (e.g. albumin) under physiological conditions. Congenital or acquired disorders targeting the endolysosomal system in PT cells cause an inappropriate loss of LMW proteins and solutes in the urine, which can culminate in renal Fanconi syndrome leading to severe clinical manifestations including renal failure, growth retardation, rickets and kidney stones. Detecting the specific loss of LMW proteins in the urine (i.e. LMW proteinuria) is the most consistent and sensitive indicator of kidney PT dysfunction of genetic and toxic origin. It is an essential part of any drug discovery effort against disorders affecting the kidney PT and of multi-organ toxicology screens.

In general, the evaluation of the toxicity of chemical compounds relies on visual examination of body size and shape and the morphology of internal organs. Furthermore, the assessment of renal function, particularly kidney PT function, relies on the visualization of the uptake of injected LMW fluorescent tracers. Such tracers can be difficult to quantify, and can be affected by quenching of fluorescence within acidic endolysosomal vesicles.

To overcome these difficulties, in one embodiment, the invention provides a transgenic zebrafish reporter line expressing a fluorescent, LMW protein amenable to PT endocytosis and processing. The vitamin D binding protein (VDBP) is secreted from liver hepatocytes into the bloodstream, filtered through the glomerulus and is entirely reabsorbed by PT cells via megalin-mediated endocytosis. Increased urinary levels of VDBP are used to detect a variety of acute and chronic disorders affecting the kidney PT. The inventors have generated and characterized transgenic zebrafish vdbp reporter lines for analysis of LMW proteinuria in congenital and acquired PT disorders. By combining genetic models and exposure to known toxins, proof-of-concept evidence is provided that substantiates the value of such zebrafish lines for large-scale screens on the kidney PT function, relevant for toxicology screens and drug discovery efforts.

Based on the above-mentioned state of the art, the objective of the present invention is to provide means and methods for determining the potential nephrotoxicity or nephron- protective effect of a compound, using a specific marker of PT dysfunction. This objective is attained by the subject-matter of the independent claims of the present specification.

Description

Summary of the invention

The present invention relates to a method for determining the nephrotoxicity or nephron- protective effect, particularly the nephrotoxicity, more particularly a toxic or protective effect on kidney proximal tubule endolysosomal function, of a compound comprising the steps of administering said compound to a non-primate, particularly non-human, transgenic organism expressing a fusion protein having a molecular weight equal to or below 69 kDa, wherein the fusion protein comprises a fluorophore that is stable under physiologically buffered acidic conditions and wherein the fusion protein is secreted to the blood stream, detecting said fluorophore in the liver, kidney and/or urine of said transgenic organism and recording a signal intensity related to the amount of said fluorophore, comparing said signal intensity with a reference signal intensity.

The method described above aims to determine the nephrotoxicity or nephron-protective effect, particularly the nephrotoxicity, of a compound by monitoring the localization, intensity or quantity, particularly localization, of a fluorescent fusion protein. Under normal conditions (without administering the compound), the fluorescent fusion protein can be detected in proximal tubule cells in the kidney. If the kidney function is impaired by said compound or in disease condition, the fusion protein either accumulates in the proximal tubule cells (the signal intensity per cell is higher compared to the control) or the fusion protein is present in urine of the animal and can be measured therein.

Terms and definitions

For purposes of interpreting this specification, the following definitions will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. In the event that any definition set forth below conflicts with any document incorporated herein by reference, the definition set forth shall control.

The terms “comprising,” “having,” “containing,” and “including,” and other similar forms, and grammatical equivalents thereof, as used herein, are intended to be equivalent in meaning and to be open ended in that an item or items following any one of these words is not meant to be an exhaustive listing of such item or items, or meant to be limited to only the listed item or items. For example, an article “comprising” components A, B, and C can consist of (i.e., contain only) components A, B, and C, or can contain not only components A, B, and C but also one or more other components. As such, it is intended and understood that “comprises” and similar forms thereof, and grammatical equivalents thereof, include disclosure of embodiments of “consisting essentially of” or “consisting of.”

Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit, unless the context clearly dictate otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.

Reference to “about” a value or parameter herein includes (and describes) variations that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X.”

As used herein, including in the appended claims, the singular forms “a,” “or,” and “the” include plural referents unless the context clearly dictates otherwise.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in cell culture, molecular genetics, nucleic acid chemistry, hybridization techniques and biochemistry). Standard techniques are used for molecular, genetic and biochemical methods (see generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. and Ausubel et al., Short Protocols in Molecular Biology (1999) 4th Ed, John Wiley & Sons, Inc.) and chemical methods.

The term polypeptide in the context of the present specification relates to a molecule consisting of 50 or more amino acids that form a linear chain wherein the amino acids are connected by peptide bonds. The amino acid sequence of a polypeptide may represent the amino acid sequence of a whole (as found physiologically) protein or fragments thereof. The term "polypeptides" and "protein" are used interchangeably herein and include proteins and fragments thereof. Polypeptides are disclosed herein as amino acid residue sequences. The term peptide in the context of the present specification relates to a molecule consisting of up to 50 amino acids, in particular 8 to 30 amino acids, more particularly 8 to 15amino acids, that form a linear chain wherein the amino acids are connected by peptide bonds.

Amino acid residue sequences are given from amino to carboxyl terminus. Capital letters for sequence positions refer to L-amino acids in the one-letter code (Stryer, Biochemistry, 3 ^rd ed. p. 21 ). Lower case letters for amino acid sequence positions refer to the corresponding D- or (2R)-amino acids. Sequences are written left to right in the direction from the amino to the carboxy terminus. In accordance with standard nomenclature, amino acid residue sequences are denominated by either a three letter or a single letter code as indicated as follows: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic Acid (Asp, D), Cysteine (Cys, C), Glutamine (Gin, Q), Glutamic Acid (Glu, E), Glycine (Gly, G), Histidine (His, H), Isoleucine (lie, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).

The term gene refers to a polynucleotide containing at least one open reading frame (ORF) that is capable of encoding a particular polypeptide or protein after being transcribed and translated. A polynucleotide sequence can be used to identify larger fragments or full-length coding sequences of the gene with which they are associated. Methods of isolating larger fragment sequences are known to those of skill in the art.

The terms gene expression or expression, or alternatively the term gene product, may refer to either of, or both of, the processes - and products thereof - of generation of ribonucleic acids (RNA) or the generation of a peptide or polypeptide, also referred to transcription and translation, respectively, or any of the intermediate processes that regulate the processing of genetic information to yield polypeptide products. The term gene expression may also be applied to the transcription and processing of a RNA gene product, for example a regulatory RNA or a structural (e.g. ribosomal) RNA. If an expressed polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. Expression may be assayed both on the level of transcription and translation, in other words mRNA and/or protein product.

The term variant refers to a polypeptide that differs from a reference polypeptide, but retains essential properties. A typical variant of a polypeptide differs in its primary amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference polypeptide and the variant are closely similar overall and, in many regions, identical. A variant and reference polypeptide may differ in amino acid sequence by one or more modifications (e.g., substitutions, additions, and/or deletions). A substituted or inserted amino acid residue may or may not be one encoded by the genetic code. A variant of a polypeptide may be naturally occurring such as an allelic variant, or it may be a variant that is not known to occur naturally.

Sequences similar or homologous (e.g., at least about 70% sequence identity) to the sequences disclosed herein are also part of the invention. In some embodiments, the sequence identity at the amino acid level can be about 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher. At the nucleic acid level, the sequence identity can be about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher. Alternatively, substantial identity exists when the nucleic acid segments will hybridize under selective hybridization conditions (e.g., very high stringency hybridization conditions), to the complement of the strand. The nucleic acids may be present in whole cells, in a cell lysate, or in a partially purified or substantially pure form.

In the context of the present specification, the terms sequence identity and percentage of sequence identity refer to a single quantitative parameter representing the result of a sequence comparison determined by comparing two aligned sequences position by position. Methods for alignment of sequences for comparison are well-known in the art. Alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981 ), by the global alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Nat. Acad. Sci. 85:2444 (1988) or by computerized implementations of these algorithms, including, but not limited to: CLUSTAL, GAP, BESTFIT, BLAST, FASTA and TFASTA. Software for performing BLAST analyses is publicly available, e.g., through the National Center for Biotechnology-Information (http://blast.ncbi.nlm.nih.gov/).

One example for comparison of amino acid sequences is the BLASTP algorithm that uses the default settings: Expect threshold: 10; Word size: 3; Max matches in a query range: 0; Matrix: BLOSUM62; Gap Costs: Existence 11 , Extension 1 ; Compositional adjustments: Conditional compositional score matrix adjustment. One such example for comparison of nucleic acid sequences is the BLASTN algorithm that uses the default settings: Expect threshold: 10; Word size: 28; Max matches in a query range: 0; Match/Mismatch Scores: 1.-2; Gap costs: Linear. Unless stated otherwise, sequence identity values provided herein refer to the value obtained using the BLAST suite of programs (Altschul et al., J. Mol. Biol. 215:403-410 (1990)) using the above identified default parameters for protein and nucleic acid comparison, respectively.

The terms low-molecular-weight protein and LMW protein in the context of the present invention relate to a protein, oligopeptide or peptide having a molecular weight (MW) up to that of albumin (~69 kDa), i.e. the molecular weight is < 69 kDa.

The terms nephrotoxicity and nephrotoxic relate to the impairment of renal function. In a healthy organism, LMW proteins present in the bloodstream are filtered through the glomerulus, reabsorbed by receptor-mediated endocytosis and processed in the lysosomes of proximal tubule cells. Particularly the impairment of receptor-mediated endocytosis of LMW proteins and/or the impairment of lysosomal processing of LMW proteins is referred to as nephrotoxicity.

The terms nephron-protective relate to the improvement of kidney function, here defined as kidney proximal tubule endolysosomal function (uptake of a filtered ligand and subsequent degradation in the lysosomes). In a healthy organism, LMW proteins present in the bloodstream are filtered through the glomerulus, reabsorbed by receptor-mediated endocytosis and processed in the lysosomes of proximal tubule cells. Particularly the improvement of receptor-mediated endocytosis of LMW proteins and/or the improvement of lysosomal processing of LMW proteins is referred to as nephron-protective effect.

The term physiologically buffered acidic conditions relates to an acidic intra- or extracellular fluid in an organism, particularly in a cell or cellular compartment. The pH in a cell or cellular compartment is regulated by plasma membrane transporters that regulate ion influx and efflux and/or by buffering systems such as bicarbonate or phosphate buffering systems. An acidic pH can for instance be found in organelles such as lysosomes (pH 4.5 to pH 5).

The term fusion protein relates to a polypeptide comprising at least two amino acid sequences that do not occur on a single polypeptide in the organism in which the fusion protein is expressed, or not in nature at all. A fusion protein suitable for the method described herein comprises a fluorophore, a signal peptide (particularly for exocytosis from hepatocytes) and an amino acid sequence that is capable of binding to a receptor selected from megalin, cubilin and amnionless, particularly to megalin, cubilin and amnionless of D. rerio.

The term megalin relates to the gene that encodes the protein “megalin”. The term is interchangeably used with the term Irp2a or low density lipoprotein receptor-related protein 2a. The term also relates to the protein per se. Reference is particularly made to the ensembl gene identifier ENSDARG00000102506 and the ZFIN accession number ZDB-GENE-050119-2.

The terms cubn and cubilin relate to the gene that encodes the protein “cubilin” or “intrinsic factor-cobalamin receptor”. The terms also relate to the protein perse. Reference is particularly made to the ensembl gene identifier ENSDARG00000087013 and the ZFIN accession number ZDB-GENE-060228-6.

The terms amnionless relates to the gene that encodes the protein “amnion associated transmembrane protein”. The terms also relate to the protein per se. Reference is particularly made to the ensembl gene identifier ENSDARG00000062947 and the ZFIN accession number ZDB-GENE-060810-59. The term transgenic organism in the context of the present invention relates to an organism that is able to synthesize a fusion protein by stable or transient gene expression, particularly by stable gene expression. For stable gene expression, the nucleic acid sequence encoding said fusion protein may be integrated into the genome of said organism. To allow expression, the nucleic acid sequence encoding the fusion protein is introduced into the genome in such a way that a promoter sequence present in the genome can be used to initiate transcription or a suitable promoter sequence, e.g. a liver specific promoter such as the promoter of fab10a, is introduced along with the nucleic acid sequence encoding the fusion protein.

The terms fabplOa and l-fabp relate to the gene that encoded the protein “fatty acid binding protein 10a”. Synonyms are L-BABP, L-FABP, Lb-FABP, fabp10, Ifabp, liver bile acid-binding protein, zgc:103719, zgc:92741. The protein is also named “liver type fatty acid binding protein”. The terms also relate to the protein per se. Reference is particularly made to the ensembl gene identifier ENSDARG00000038439 and the ZFIN accession number ZDB- GENE-020318-1 . The gene is located at chromosome 16: 52,512,025-52,516,915 in the zebrafish genome. The fab10a promoter sequence is enclosed as SEQ ID NO 022. The promotor sequence does not contain a start codon. Thus, the nucleic acid sequence encoding the fusion protein should start with a start codon ATG.

The terms vdbp, GC vitamin D binding protein or gc relates to the gene that encodes the protein “vitamin D binding protein”. The term also relates to the vitamin D binding protein per se. Synonyms are dbp, zgc:110389 and zgc:92753. Reference is particularly made to the ensembl gene identifier ENSDARG00000089310 and the ZFIN accession number ZDB-GENE-040718- 307. The gene is located at chromosome 5: 45,677,781-45,725,008 in the zebrafish genome.

The term “kidney” relates to the fully developed organ and to its embryonic and fetal developmental stages such as the pronephros.

Description of the invention

The present invention relates to a method for determining the nephrotoxicity or nephron- protective effect, particularly the nephrotoxicity, more particularly a toxic or protective effect on kidney proximal tubule endolysosomal function, of a compound comprising the steps of administering said compound to a non-primate, particularly non-human transgenic organism expressing a fusion protein having a molecular weight equal to or below 69 kDa, wherein the fusion protein comprises a fluorophore that is stable under physiologically buffered acidic conditions and wherein the fusion protein is secreted to the blood stream, detecting said fluorophore in the liver, kidney and/or urine, particularly in the kidney and/or urine, of said transgenic organism (after administration) and recording a signal intensity related to the amount of said fluorophore, comparing said signal intensity with a reference signal intensity.

The method described above aims to determine the nephrotoxicity or nephron-protective effect, particularly the nephrotoxicity, of a compound by monitoring the localization and intensity or quantity, particularly the localization, of a fluorescent fusion protein. Under normal conditions (without administering the compound), the fluorescent fusion protein can be detected in proximal tubule cells in the kidney. If the kidney function is impaired by said compound or in disease condition, the fusion protein either accumulates in the proximal tubule cells (the signal intensity per cell is higher compared to the control) or the fusion protein is present in urine of the animal and can be measured therein. In embodiments where the transgenic animal is a fish, particularly a zebrafish, the fusion protein is secreted into the water in which the fish is kept, and thus a signal can be detected in this water, also referred to as “pool”.

The epithelial cells lining the proximal tubule of the kidney reabsorb and metabolize most of the filtered LMW proteins having a molecular weight up to that of albumin (~69 kDa) through receptor-mediated endocytosis and lysosomal processing. Under normal conditions (without administering a compound), the fusion protein is thus secreted into the bloodstream, filtered through the glomerulus, reabsorbed by receptor-mediated endocytosis and processed in the lysosomes of proximal tubule cells of the non-human transgenic model organism.

If a nephrotoxic compound, i.e. a compound that impairs reabsorption and/or metabolization of LMW proteins in the kidney, is administered to the transgenic organism, the fusion protein is not or less reabsorbed by receptor-mediated endocytosis in PT cells and/or metabolized in the lysosome of PT cells. Subsequently the fusion protein may be detected in the urine/pool (impairment of endocytosis) or enriched in lysosomes (impairment of lysosomal processing). A compound tested by the method according to the invention is assessed as nephrotoxic if the signal intensity per cell (in case of impaired lysosomal processing) or the signal intensity per volume urine or per volume pool (in case of impaired receptor mediated endocytosis) is higher compared to a reference signal intensity per cell or reference signal per volume, wherein the reference signal intensity is obtained by the method described herein without administering said compound.

The reference signal intensity may be obtained each time the method is conducted. Alternatively, a sufficiently robust set of conditions of measurement can allow a reference to be obtained and used for a large number of measurements, without the necessity of obtaining a reference each time a verum is obtained. If the compound impairs receptor-mediated endocytosis, the signal intensity in tubule cells is lower or even absent in renal tubule cells and the signal intensity per volume pool is higher compared to the reference signal intensity.

If the compound impairs lysosomal processing, the fusion protein accumulates in the lysosomes. In this case, the signal intensity per cell is higher compared to the reference signal intensity.

If a nephron-protective compound, i.e. a compound that improves reabsorption and/or metabolization of LMW proteins in the kidney, is administered to the transgenic organism, the fusion protein is more or better reabsorbed by receptor-mediated endocytosis in PT cells and/or metabolized in the lysosome of PT cells. Subsequently less fusion protein may be detected in the urine/pool (improvement of endocytosis) or enriched in lysosomes (improvement of lysosomal processing).

A compound tested by the method according to the invention is assessed as nephron- protective if the signal intensity per cell (in case of improved lysosomal processing) or the signal intensity per volume urine or per volume pool (in case of improved receptor mediated endocytosis) is lower compared to a reference signal intensity per cell or reference signal per volume, wherein the reference signal intensity is obtained by the method described herein without administering said compound.

If the compound improves receptor-mediated endocytosis, the signal intensity in tubule cells is higher in renal tubule cells and the signal intensity per volume pool is lower compared to the reference signal intensity.

If the compound improves lysosomal processing, less fusion protein accumulates in the lysosomes. In this case, the signal intensity per cell is lower compared to the reference signal intensity.

The method according to the invention may for instance be applied in the context of drug development. Congenital and acquired dysfunctions of the proximal tubule are consistently reflected by the inappropriate loss of solutes including LMW proteins in the urine. Acquired dysfunctions may occur for example as side effect of a therapy that comprises the administration of a specific compound (drug). The potential nephron-protective effects or side effects of a compound, e.g. a drug candidate for the treatment of (human) patients, may be monitored by administering the compound to the model organism expressing the fusion protein.

In certain embodiments, the transgenic organism is a non-human mammal or a fish. A fast experimental setup may be achieved by using a model organism that is widely used in the field of biology and medical research such as rat, mouse or zebrafish. These animals are relatively small allowing animal keeping in limited space and their reproduction is high.

In certain embodiments, the transgenic organism is an animal having a mass of less than (<) 250 g.

In certain embodiments, the transgenic organism is an animal having a mass of less than (<) 100 g.

In certain embodiments, the transgenic organism is an animal having a mass of less than (<) 50 g.

In certain embodiments, the transgenic organism is a mouse ( Mus musculus), a rat ( Rattus norvegicus) or a zebrafish ( Danio rerio).

The overall conservation of nephron segment patterning has established the zebrafish as a prominent model organism for kidney disease and drug discovery. In particular, the proximal convoluted tubule (PCT) segment of the zebrafish pronephros is remarkably similar to the human nephron. The PCT cells show the typical characteristics of reabsorbing epithelia (brush border, infoldings of basolateral plasma membrane, abundant mitochondrial network, formation of tight junctions), express the endocytic receptors megalin and cubilin, and possess a Irp2a/ megalin-dependent endocytic transport activity reabsorbing fluorescent ligands.

In general, evaluation of the effects, particularly the toxicity, of chemical compounds in zebrafish kidney relies on visual examination of larval features (body size, shape) and morphology of internal organs, whereas assessment of PT function relies on visualization of the uptake of injected LMW fluorescent tracers. However, these assays are either indirect or limited by technical concerns (e.g. injection, visualization), can be difficult to quantify, and can be affected by quenching of fluorescence within acidic endolysosomal vesicles. As they are labor-intensive, the injection methods do not allow large-scale assessment of PT dysfunction in larvae or adult zebrafish models. Detecting biomarkers in fish urine is difficult, as such markers are diluted in the pool, and filtration/processing of endogenous LMW proteins has not been characterized.

In certain embodiments, the transgenic organism is a zebrafish.

A suitable organism is D. rerio (zebrafish), as the zebrafish pronephros shares individual functional segments with the human nephron, including the Irp2a/megalin-dependent endocytic transport processes in proximal tubule.

Although the zebrafish has been used as a model organism for toxicological studies and drug discovery, there is no available assay that allows large-scale assessment of proximal tubule function in larval or adult stages. Furthermore, a transgenic zebrafish may be used for the method described herein as the urine of mice and rat is difficult to collect. The urine of the zebrafish is diluted in the pool, in which the presence of the fusion protein can easily be detected by eye or by using antibody-based detection methods such as ELISA.

When using zebrafish as transgenic organism, the earliest time point of performing the method is 56 hours post fertilization when the pronephros is developed. Furthermore, the expression of the fusion protein in the liver has to be taken into consideration. For example, a lfabp:GFP gene product is generally seen in the liver at 3 dpf (days post fertilization). Thus, the detection method can be performed at the earliest at 3 dpf. The treatment using the drug can be started or completely performed earlier, for example at 48 hours, but the detection or evaluation can only be done at 3dpf or later.

In certain embodiments, the transgenic organism is a zebrafish at > 3 dpf.

The fusion protein expressed in the transgenic organism comprises a fluorophore fused to a protein. To allow detection of the fusion protein in cellular compartments, it should be stable under neutral and acidic conditions. Particularly for detection also in lysosomal compartments of a cell (pH 4.5 - 5), the fluorophore should be stable under acidic conditions.

In certain embodiments, the fluorophore is stable between pH 4.5 and pH 7.5.

In certain embodiments, the fluorophore is stable between pH 4.5 and pH 7.

In certain embodiments, the fluorophore is stable between pH 4.5 and pH 6.9.

In certain embodiments, the fluorophore is stable between pH 4.5 and pH 6.

In certain embodiments, the fluorophore is stable between pH 4.5 and pH 5.

To allow expression of the fusion protein in the transgenic organism, the transgenic organism comprises a transgenic nucleic acid sequence that comprises a coding sequence encoding the fusion protein.

In certain embodiments, the transgenic organism comprises a transgenic nucleic acid sequence comprising a coding sequence encoding said fusion protein.

In certain embodiments, the coding sequence comprises a start codon ATG.

Efficient initiation of translation can be achieved if the start codon is part of a Kozak consensus sequence.

In certain embodiments, the coding sequence comprises a start codon that is part of a Kozak consensus sequence, particularly the Kozak consensus sequence CACCATG.

As described above, the fusion protein enters the kidney via the bloodstream, is filtered in the glomeruli and - depending on the presence of a nephrotoxic or nephron-protective compound - the fusion protein is either reabsorbed and processed in the lysosomes or secreted in the urine/accumulated in the lysosomes of PT cells. Many proteins that are synthesized in the liver enter the bloodstream. To allow expression of the fusion protein in the liver, particularly in hepatocytes, the transgenic nucleic acid sequence further comprises a liver specific promoter. The promoter is upstream (in 5’ direction to the sense strand) of the coding sequence that encodes the fusion protein.

In certain embodiments, the transgenic nucleic acid sequence comprises a promoter upstream of said coding sequence.

The promoter comprises a transcription start site (TSS), a binding site for RNA polymerase II, general transcription factor binding sites, e.g. TATA box and B recognition element. The transcription start site is located in such a way that the coding sequence is transcribed in its open reading frame. Efficient initiation of translation may be achieved if the start codon (underlined) of the coding sequence is part of a Kozak consensus sequence such as CACCATG.

In certain embodiments, the promoter is a liver specific promoter.

In certain embodiments, the promoter is selected from the fabplOa gene promoter and the vdbp gene promoter.

In certain embodiments, the promoter is the fabplOa gene promoter.

In certain embodiments, the promoter is a D. rerio specific promoter.

Hepatocytes may secrete proteins to the extracellular environment via exocytosis. Proteins that are secreted are characterized by a signal peptide which determines that the protein is processed along the secretory pathway. The signal peptide determines that the protein is produced in the endoplasmic reticulum. After translation, the signal peptide is cleaved and not present on the mature protein. The mature protein may further be modified by post- translational modifications commonly known to the person of skill in the art.

In certain embodiments, the fusion protein comprises a signal peptide.

In certain embodiments, the signal peptide is a D. rerio specific signal peptide.

In certain embodiments, the fusion protein comprises the signal peptide MNASLILIYALIVPALLA (SEQ ID NO. 021 ; signal peptide of vdbp).

To allow discrimination between a reference signal, which is obtained if the fusion protein is processed in the kidney as any other LMW protein would be processed, and the signal that is obtained after administration of a nephrotoxic or nephron-protective, particularly a nephrotoxic, compound, the fusion protein should be a ligand for a receptor that mediates endocytosis such as megalin or cubilin. The nucleic acid sequence encoding the signal peptide may be inherent in the nucleic acid sequence encoding the ligand for the receptor that mediates endocytosis. For instance, the N-terminus of vdbp comprises a signal peptide sequence. Alternatively, the signal peptide may be fused to the ligand.

Upon entering the proximal tubule, the LMW protein binds via a specific protein domain to the receptors megalin and/or cubilin. This receptor binding initiates endocytosis of the fusion protein.

In certain embodiments, the fusion protein is a ligand for cubilin (encoded by the gene cubn (D. rerio), Cubn (mouse), Cubn (rat)) and/or megalin (encoded by the gene Irp2a (D. rerio), Lrp2 (mouse), Lrp2 (rat)) and/or amnionless (encoded by the gene amn in D. rerio).

In certain embodiments, the fusion protein is a ligand for cubilin (encoded by the gene cubn (D. rerio), Cubn (mouse), Cubn (rat)), megalin (encoded by the gene Irp2a (D. rerio), Lrp2 (mouse), Lrp2 (rat)) or amnionless (encoded by the gene amn in D. rerio).

In certain embodiments, the fusion protein is a ligand for cubilin (encoded by the gene cubn in D. rerio), megalin (encoded by the gene Irp2a in D. rerio) or amnionless (encoded by the gene amn in D. rerio).

In certain embodiments, the fusion protein is a ligand for megalin.

In certain embodiments, the fusion protein comprises ligand derived from vitamin D-binding protein, folate-binding protein, retinol-binding protein, transcobalamin, transcobamalin II, intrinsic factor, albumin, hemoglobin, myoglobin, lactoferrin, liver-type fatty acid-binding protein, metallothionein, neutrophil gelatinase-associated lipocalin, odorant-binding protein, selenoprotein P, sex hormone-binding globulin, transthyretin, transferrin, apolipoprotein B, apolipoprotein E, apolipoprotein J/clusterin, apolipoprotein H, apolipoprotein M, apolipoprotein A-l, high-density lipoprotein, angiotensin II, bone morphogenic protein 4, connective tissue growth factor, epidermal growth factor, insulin, Insulin-like growth factor, leptin, parathyroid hormone, prolactin, sonic hedgehog protein, survivin, thyroglobulin, fibroblast growth factor, recombinant activated factor Vila, a-amylase, a-galactosidase A, cathepsin B, cystatin C, lysozyme, plasminogen, plasminogen activator inhibitor type I, tissue plasminogen activator, urokinase, lipoprotein lipase, immunoglobulin light chains, a1 -microglobulin, b2-itpop¾^uNh, pancreatitis-associated protein, clara cell secretory protein, receptor-associated protein, coagulation factor VII, coagulation factor VIII, cytochrome C, or seminal vesicle secretory protein II.

In certain embodiments, the fusion protein comprises at least one albumin domain or a variant thereof.

In certain embodiments, the fusion protein comprises at least one albumin domain. To allow detection of the fusion protein, it comprises a fluorophore.

Non-limiting examples of a fluorescent detectable label/fluorophore are the fluorescent proteins derived from the green fluorescent protein of Aequorea victoria (GFP), such as EGFP (enhanced green fluorescent protein), YFP (yellow fluorescent protein and derivatives), ECFP (cyan fluorescent protein and derivatives) and the many other fluorescent protein labels known in the art.

In certain embodiments, the fluorophore is selected from green fluorescent protein (GFP) form Aequorea victoria, a fluorescent protein from Discosoma striata, a protein derived from alpha- allophycocyanine from Trichodesmium erythraeum, and derivatives thereof.

By way of non-limiting example, such fluorescent protein may be selected from green fluorescent protein (GFP) from Aequorea victoria and derivatives thereof, such as enhanced blue fluorescent protein (EBFP), enhanced blue fluorescent protein 2 (EBFP2), azurite, mKalamal , sirius enhanced green fluorescent protein (EGFP), emerald, superfolder avGFP, T-sapphire yellow fluorescent protein (YFP), enhanced yellow fluorescent protein (EYFP), citrine, venus, YPet, topaz, SYFP, mAmetrine enhanced cyan fluorescent protein (ECFP), mTurquoise, mTurquoise2, cerulean, CyPet, SCFP.

A fluorescent protein for practicing the invention may also be selected from the group comprising fluorescent protein from Discosoma striata and derivatives thereof: mTagBFP,

TagCFP, AmCyan, Midoriishi Cyan, mTFP1

Azami Green, mWasabi, ZsGreen, TagGFP, TagGFP2, TurboGFP, CopCFP, AceGFP - TagYFP, TurboYFP, ZsYellow, PhiYfP

Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, DsRed, DsRed2, DsRed-Express (T1 ), DsRed-Express2, DsRed-Max, DsRed-Monomer, TurboRFP, TagRFP, TagRFP-T mRuby, mApple, mStrawberry, AsRed2, mRFP1 , JRed, mCherry, eqFP611 , tdRFP611 , HcRedl , mRaspberry tdRFP639, mKate, mKate2, katushka, tdKatushka, HcRed-Tandem, mPlum, AQ143.

Fluorescent proteins also comprise proteins derived from alpha-allophycocyanin from the cyanobacterium Trichodesmium erythraeum such as small ultra red fluorescent protein (smURFP).

As stated above, fluorophores that are stable under acidic conditions (pH 4.5 to pH 6.9) such as mCherry are suitable for the method described herein. Suitable fluorophores are not only acid-tolerant but also with high brightness to allow detection in the pool. The brightness is expressed as product of the molar extinction coefficient s (in 10 ³ M ¹ cm ¹ ) and the fluorescence quantum yield divided by 1000. Suitable fluorophores are characterized by a brightness > 5, particularly > 10.

In certain embodiments, the fluorophore is selected from mTagBFP2, mTurquoise2, mCerulean3, mTFP1 , mT-Sapphire, mEmerald, pH-tdGFP, mVenus, Gamillus, mNeonGreen, mKOk, mRFP1 , mCherry, mCherry2, mStrawberry, mScarlet, mRuby, mRuby2, mRuby3, TagRFP, TagRFP-T, FusionRed, hmKeima4.15, mRaspberry.

Concerning the fluorophores, reference is made to Shinoda et al. 2018, particularly Table 1 and references therein.

In certain embodiments, the fluorophore is resistant to lysosomal degradation.

In certain particular embodiments, the fluorophore is not resistant to lysosomal degradation; to allow the detection of the fusion protein in the lysosome, the fluorophore is detected prior to complete degradation in the lysosome.

In certain embodiments, the fluorophore is selected from mT-Sapphire, pH-tdGFP, mVenus, Gamillus, mKOk, mRFP1 , mCherry, mCherry2, mStrawberry, mScarlet, mRuby, mRuby2, mRuby3, TagRFP, TagRFP-T, hmKeima4.15, mRaspberry.

Furthermore, fluorophores characterized by far-red emission such as mRaspberry can only be detected using a camera and cannot be seen by eyes.

In certain embodiments, the fluorophore is selected from mTagBFP2, mTurquoise2, mCerulean3, mTFP1 , mT-Sapphire, mEmerald, pH-tdGFP, mVenus, Gamillus, mNeonGreen, mKOk, mRFP1 , mCherry, mCherry2, mStrawberry, mScarlet, mRuby, mRuby2, mRuby3, TagRFP, TagRFP-T, FusionRed, hmKeima4.15.

In certain embodiments, the fluorophore is selected from mT-Sapphire, pH-tdGFP, mVenus, Gamillus, mKOk, mRFP1 , mCherry, mCherry2, mStrawberry, mScarlet, mRuby, mRuby2, mRuby3, TagRFP, TagRFP-T, hmKeima4.15.

In certain embodiments, the fluorophore is mCherry.

In certain embodiments, the signal intensity, particularly the fluorescence intensity of said fluorophore, is determined in pronephric proximal tubule epithelial cells or proximal tubule epithelial cells.

In certain embodiments, the signal intensity, particularly the fluorescence intensity of said fluorophore, is determined in the late endosome and lysosome in proximal tubule cells. In certain embodiments, the signal intensity, particularly the fluorescence intensity of said fluorophore, is determined in the urine.

In certain embodiments, the signal intensity, particularly the fluorescence intensity of said fluorophore, is determined in the pool.

In certain embodiments, the signal intensity in the urine is determined by Enzyme-linked Immunosorbent Assay (ELISA) using an antibody or antibody-like molecule against said fluorophore.

In certain embodiments, the signal intensity in the urine is determined by Enzyme-linked Immunosorbent Assay (ELISA) using an antibody against said fluorophore.

Further disclosed herein is the detection method based on luminescence. In certain embodiments of this aspect, the fusion protein comprises the gene product of a bioluminescent reporter gene, particularly a luciferase.

This aspect of the disclosure can be summarized in the following items:

Item 1 : A method for determining the nephrotoxicity or nephron-protective effect of a compound comprising the steps of administering said compound to a non-primate, particularly non-human, transgenic organism expressing a fusion protein having a molecular weight equal to or below 69 kDa, wherein the fusion protein comprises a detectable reporter that is stable under physiologically buffered acidic conditions and wherein the fusion protein is secreted to the blood stream, detecting said detectable reporter in the liver, kidney and/or urine of said transgenic organism and recording a signal intensity related to the amount of said detectable reporter, comparing said signal intensity with a reference signal intensity.

Item 2: The method according to item 1 , wherein said transgenic organism is a non-human mammal or a fish, particularly an animal having a mass of less than (<) 250g, < 100g, <50g, more particularly a mouse, a rat or a zebrafish, even more particularly wherein said transgenic organism is a zebrafish.

Item 3: The method according to any one of the preceding items, wherein said detectable reporter is stable between pH 4.5 and pH 7.5, particularly between pH 4.5 and pH 7, more particularly between pH 4.5 and pH 6. Item 4: The method according to any one of the preceding items, wherein the transgenic organism comprises a transgenic nucleic acid sequence comprising a coding sequence encoding said fusion protein.

Item 5: The method according to item 4, wherein the transgenic nucleic acid sequence comprises a promoter upstream of said coding sequence, particularly a promoter selected from a liver specific promoter, more particularly a promoter selected from the fabplOa promoter and the vdbp gene promoter, particularly the promoter is the fabplOa promoter.

Item 6: The method according to any one of the preceding items, wherein the fusion protein comprises a signal peptide, particularly MNASLILIYALIVPALLA (SEQ ID NO 021).

Item 7: The method according to any one of the preceding items, wherein the fusion protein is a ligand for cubilin and/or megalin and/or amnionless, particularly for megalin.

Item 8: The method according to any one of the preceding items, wherein the fusion protein comprises at least one albumin domain, or a variant thereof.

Item 9 A: The method according to any one of the preceding items, wherein the detectable reporter is a fluorophore.

Item 9 B: The method according to any one of the preceding items 1-8, wherein the detectable reporter is a luciferase.

Item 10: The method according to item 9 A, wherein the fluorophore is selected from green fluorescent protein (GFP) from Aequorea victoria, a fluorescent protein from Discosoma striata, a protein derived from alpha-allophycocyanine from Trichodesmium erythraeum, and derivatives thereof, particularly from mTagBFP2, mTurquoise2, mCerulean3, mTFP1 , mT- Sapphire, mEmerald, pH-tdGFP, mVenus, Gamillus, mNeonGreen, mKOk, mRFP1 , mCherry, mCherry2, mStrawberry, mScarlet, mRuby, mRuby2, mRuby3, TagRFP, TagRFP- T, FusionRed, hmKeima4.15, mRaspberry, more particularly from mTagBFP2, mTurquoise2, mCerulean3, mTFP1 , mT-Sapphire, mEmerald, pH-tdGFP, mVenus, Gamillus, mNeonGreen, mKOk, mRFP1, mCherry mCherry2, mStrawberry, mScarlet, mRuby, mRuby2, mRuby3, TagRFP, TagRFP-T, FusionRed, hmKeima4.15, even more particularly wherein the fluorophore is mCherry.

Item 11 : The method according to item 9 B, wherein the luciferase is a luciferase from Photinus pyralis (firefly luciferase), from Cypridina noctiluca (Cypridina luciferase), from Renilla reniformis (Renilla luciferase), from Gaussia princeps (gaussia luciferase), from Metridia ionga (Metridia luciferease), from Oplophorus gracilirostris (NanoLuc luciferase), or an active variant thereof, particularly the luciferase is a luciferase from from Renilla reniformis (Renilla luciferase), from Gaussia princeps (gaussia luciferase), from Metridia Ionga (Metridia luciferease), from Oplophorus gracilirostris (NanoLuc luciferase) or an active variant thereof, more particularly the luciferase is Oplophorus gracilirostris (NanoLuc luciferase) or an active variant thereof.

Item 12: The method according to any one of the preceding items, wherein the signal intensity, particularly the fluorescence intensity of said fluorophore or the luminescence from said luciferase, is determined in pronephric proximal tubule epithelial cells or proximal tubule epithelial cells.

Iterm 13: The method according to any one of the preceding items, wherein the signal intensity, particularly the fluorescence intensity of said fluorophore or the luminescence from said luciferase, is determined in the late endosome and lysosome in proximal tubule cells.

Item 14: The method according to any one of the preceding items, wherein the signal intensity, particularly the fluorescence intensity of said fluorophore or the luminescence from said luciferase, is determined in the urine.

Item 15: The method according to any one of the preceding items, wherein the signal intensity in the urine is determined by Enzyme-linked Immunosorbent Assay (ELISA) using an antibody or antibody-like molecule against said fluorophore.

When the fusion protein comprises a luciferase as detectable reporter, a suitable substrate to induce bioluminescence is administered in the detecting step.

In certain embodiments, luciferin is administered in the detecting step if the detectable reporter is a luciferase.

In certain embodiments, furimazine is administered in the detecting step if the detectable reporter is NanoLuc luciferease. The invention is further illustrated by the following examples and figures, from which further embodiments and advantages can be drawn. These examples are meant to illustrate the invention but not to limit its scope.

Description of the Figures Fig. 1 (a) Irp2a ^+/+ and i _r p2a ^del8/del8 zebrafish embryos expressing cdh17::GFP (green, pronephric tubule marker) were injected at 56hpf with p-lactoglobulin-Cy5. At 20 min after the tracer injection, zebrafish larvae were imaged by light sheet fluorescent microscope. Representative micrographs and quantifications of fluorescent signal in pronephric tubules of Irp2a zebrafish; n = 6 ( Irp2a ^+/+ ) and n = 11 (Irp2a ^del8/del8 ). Scale bar is 40pm. (b) Irp2a ^+/+ and /rp2a ^de/8/de/8 zebrafish embryos expressing cdh17::GFP (green, pronephric tubule marker) were injected at 56hpf with 10kDa Alexa647-Dextran. At 20 min after the tracer injection, the zebrafish embryos were imaged by light sheet fluorescent microscope. Representative micrographs and quantifications of fluorescent signal in pronephric tubules of Irp2a zebrafish; n = 11 ( Irp2a ^+/+ ) and n = 9 (Irp2a ^del8/del8 ). Scale bar is 40miti. (c) Representative electron micrographs and quantifications of the number of endocytic vacuoles in proximal tubules of Irp2a ^+/+ and /rp2a ^de/8/del8 zebrafish larvae at 4dpf. Yellow squares contain images at higher magnification n = 6 ( Irp2a ^+/+ ) and n = 7 (Irp2a ^del8/del8 ). Scale bar is 1 pm. (d) Whole-mount imaging and quantifications of fluorescence intensity in proximal tubules of 4dpf -Irp2a zebrafish larvae expressing PiT1\\GFP-rab5aa (green, endosome marker) n = 10 ( Irp2a ^+/+ ) and n = 12 (Irp2a ^del8/del8 ). Scale bar is 40pm. (e) clcn7 ^+/+ and clcn7 ^del4/del4 larvae expressing cdh17\\GFP (green, pronephric tubule marker) were injected at 4dpfwith p-lactoglobulin-Cy5. At the indicated times after the tracer injection, the zebrafish larvae were imaged by light sheet fluorescent microscope. Representative micrographs and quantifications of fluorescent signal in proximal tubules of clcn7 zebrafish; n = 10 (c/cn7 ^+/+ ) and n = 7 ( clcn7 ^{del4/del 4} ) for early time point; and n = 6 (c/cn7 ^+/+ ) and n = 5 ( clcn7 ^{del4/del 4} ) for late time point. Scale bar is 40pm. (f) Representative electron micrographs and quantifications of the diameter of electron-dense vesicles in proximal tubules of clcn7 zebrafish at 4dpf. n = 6 (c/cn7 ^+/+ ) and n = 5 (clcn7 ^del4/del4 ). Yellow squares contain images at higher magnification. Asterisk: enlarged electron-dense vesicles, BB: brush border, N: nucleus. Scale bar is 5pm. Plotted data represent meaniSEM. Non-parametric Mann Whitney test, ^* p<0.05, * ^* p<0.01 , ^*** p< 0.001 relative to Irp2a ^+/+ or clcn7 ^+/+ zebrafish; NS, non-significant.

Fig. 2(a) Model depicting the fate of ½vdbp-mCherry under normal conditions: ½vdbp- mCherry (~50kDa) is produced in liver ©, secreted into the bloodstream ©, filtered by the glomerulus (f), reabsorbed via receptor-mediated endocytosis by proximal tubule cells ® and processed within endo-lysosomes ©. E: endosome, LE, late endosome, L: lysosome. (b) Vector construction of Ifabp: :A _> vdbp-mCherry : the N-terminal 207 aa of zebrafish vdbp peptide is fused to mCherry and expressed under the control of liver- specific Ifabp promoter. Tol2-L and Tol2-R motifs represent the Tol2 transposon left and right arms which enable excision of the plasmid and integrate the construct into the genome. Ifabp: promoter of liver-type fatty acid binding protein, ½vdbp : N-terminal 207 aa of zebrafish vdbp peptide (c) Transcript levels of endogenous vdbp and transgene A ¹ vdbp-mCherry were analyzed by RT-PCR in liver isolated from wild type (WT) and transgenic (TG) adult zebrafish. Upper band: endogenous vdbp, lower band: ½vdbp- mCherry. (d) Western blotting of mCherry protein levels in liver from wild type (WT) and transgenic (TG) adult zebrafish. (e) Enzyme-linked immunosorbent assay (ELISA) and quantification of ½vdbp-mCherry in whole lysates derived from zebrafish larvae (lane 1), in urine derived from zebrafish larvae (lane 2), and in lysates obtained from liver and kidneys (lane 3 and 4, respectively) (f) Live imaging of mCherry (red) in liver, blood vessel and pronephric tubules of transgenic zebrafish larvae at 4dpf. The red signal in yolk sac (YS) is from auto-fluorescence. White squares contain images at higher magnification. Arrows indicate E: eye; PT: proximal tubule; L: liver; SB: swim bladder, YS: yolk sac; and CV: caudal vein. Scale bar is 500pm. (g) Zebrafish larvae co expressing lfabp::A ¹ vdbp- mCherry (red) and cdh17::GFP (green, pronephric tubule marker) were imaged at 5dpf by light sheet fluorescent microscope. PT: proximal tubule, L: liver. Scale bar is 50pm. (h) Zebrafish larvae co-expressing lfabp::A ¹ vdbp- mCherry (red) and wt1b:: GFP (green, glomerulus and proximal tubule marker) were imaged at 5dpf by light sheet fluorescent microscope. PT: proximal tubule, G: glomerulus. Scale bar is 40pm. (i) Representative micrographs and quantifications of mCherry and EGFP fluorescence intensities in proximal tubules of zebrafish larvae co-expressing lfabp::A ¹ vdbp- mCherry and PiT1::ctns-EGFP (green, lysosomal marker). Yellow indicates colocalization. PT: proximal tubule, L: liver. Scale bar is 10pm.

Fig. 3(a) Model depicting the fate of ½vdbp-mCherry in endocytosis-deficient conditions: ½vdbp-mCherry is not reabsorbed by PT cells and is ultimately excreted in the urine (b) Irp2a ^+/+ and i _r p2a ^del8/del8 zebrafish larvae co-expressing lfabp::A _> vdbp- mCherry and cdh17::GFP (green, pronephric tubule marker) were imaged at 4dpf by light sheet fluorescent microscope. Representative micrographs and quantifications of ½vdbp- mCherry fluorescent signal in Irp2a zebrafish embryos; n = 16 ( Irp2a ^+/+ ) and n = 10 (Irp2a ^del8/del8 ). Scale bar is 40pm. (c) Enzyme-linked immunosorbent assay (ELISA) and quantification of the urinary ½vdbp-mCherry in Irp2a zebrafish larvae; n = 12 ( Irp2a ^+/+ ) and n = 14 (Irp2a ^del8/del8 ). (d) Zebrafish embryos were treated at2dpfwith 1.5mM cisplatin for 4 hours and semi-quantitative scoring of developmental defects of swim bladder at 4dpf. n = 3 independent experiments. Scale bar is 1mm. (e) Zebrafish embryos co expressing lfabp::A:vdbp-rr\Cherry and cdh17::GFP (green, pronephric tubule marker) were exposed to 1.5mM cisplatin at 2dpf for 4 hours and imaged by light sheet fluorescent microscope at 5dpf. Representative micrographs and quantifications of mCherry fluorescent signal in control and cisplatin-treated transgenic larvae; n = 32 (control), n = 47 (treated with cisplatin). Scale bar is 40pm. (f) Enzyme-linked immunosorbent assay (ELISA) and quantifications of the urinary ½vdbp-mCherry in control and cisplatin-treated, transgenic zebrafish embryos; n = 14 (control), n = 31 (treated with cisplatin). (g) Representative micrographs of proximal tubules from control and cisplatin-treated zebrafish larvae. BB: brush border, Arrows indicate epithelial cells deprived of brush border, Asterisk: mitochondrial swelling n = 7 (control), n = 9 (treated with cisplatin). Scale bars are 5pm in left panel and 2pm in right panel (h) Intravenous injection of 6pg/pL gentamicin alone, or 6pg/pL gentamicin + 6.3pg/pL taurine, or 0.9% NaCI vehicle solution into 2dpf-transgenic embryos and semi-quantitative scoring of phenotypical change at 4dpf. n = 53 (gentamicin alone) and n = 46 (gentamicin + taurine). Scale bar is 1mm. (i) Enzyme-linked immunosorbent assay (ELISA) and quantifications of the urinary ½vdbp-mCherry in transgenic zebrafish larvae treated with vehicle, gentamicin alone and gentamicin + taurine injected; n = 9 (vehicle), n = 15 (gentamicin alone) and n = 16 (gentamicin + taurine) (j) Representative micrographs showing lipid droplets in proximal tubules from treated zebrafish larvae and quantifications of lipid droplets by TEM. BB: brush border, n = 5 (vehicle), n = 8 (gentamicin alone) and n = 9 (gentamicin + taurine). Scale bar is 5pm. Plotted data represent meaniSEM. Non-parametric Mann Whitney test, ^* p < 0.05, ^** p < 0.01 , ^*** p < 0.001 relative to Irp2a ^+/+ larvae or control. One-way analysis of variance followed by Kruskal-Wallis test, ^* p < 0.05, ^** p < 0.01, ^*** p < 0.001 relative to gentamicin-treated larvae.

Fig. 4(a) Model showing the fate of ½vdbp-mCherry in response to lysosomal dysfunctions induced either by genetic ( clcn7 knockout) or pharmacological (treatment with BfnA1) means. LE: late endosome, L: lysosome. (b) Transgenic clcn7 ^+/+ and clcn7 ^del4/del4 larvae or clcn7 ^del4/del4 injected with wild type zebrafish clcn7 mRNA, which express lfabp::A ¹ vdbp- mCherry in the liver, were imaged by multiphoton fluorescence microscope at 5dpf. Representative micrographs and quantifications of mCherry fluorescence intensity and vesicle size n = 8 zebrafish per group. Scale bar is 30 pm (left panel) and 10 pm (middle panel) (c) Correlative light-electron microscopy (CLEM) in proximal tubules of 5dpi-clcn7 ^del4/del4 zebrafish larvae expressing lfabp::A ¹ vdbp- mCherry. Ultrathin sections of fixed zebrafish larvae were imaged with a widefield fluorescence microscope and processed by super-resolution radial fluctuations (SRRF) analysis using ImageJ. The sections are further processed for ultrastructural analyses by using low voltage scanning electron microscopy (LVSEM). Nuclei counterstained with DAPI (blue). N: nucleus. F: beads used for alignment of the IF and EM images. Scale bar is 2 pm. (d) Zebrafish larvae expressing lfabp::A _> vdbp- mCherry were exposed to BfnA1 (20nM; for 16 h) and imaged by multiphoton fluorescence microscope. Representative micrographs and quantifications of fluorescence intensity and total mCherry-positive area n = 11 zebrafish per group. Scale bar is 30 pm (left panel) and 10 pm (middle panel). Plotted data represent meaniSEM. One-way analysis of variance followed by Bonferroni post hoc test, ^* p < 0.05, ^** p < 0.01 , ^*** p < 0.001 relative to clcn7 ^del4/del4 zebrafish larvae. Non- parametric Mann Whitney test, ^** p < 0.01 relative to vehicle-treated larvae.

Fig. 5(a) /rp2a-TALEN (SEQ ID 023) targeting site (green) in intron74-75 and exon 75. The underlined sequence represents the Acil site, which is used for the detection of the TALEN-induced deletion (b) TALEN-induced 8bp-deletion of (blue) (SEQ ID 024) generated a frameshift resulting in premature stop codon within Irp2a gene (c) Acil digestion of PCR products after the amplification of the TALEN targeting region using genomic DNA extracted from the caudal fin of wild-type ( Irp2a ^+/+ ) (SEQ ID 024), heterozygous ( Irp2a ^{+/del 8} ) and homozygous (Irp2a ^del8/del8 ) (SEQ ID 25) zebrafish. Wild type allele: two lower bands 237bp + 196bp correspond to PCR products cut by Acil, mutant allele: upper band 433bp, resistant to Acil digestion (d) Transmembrane protein structure of wild type megalin (left panel) and truncated peptide (right panel). Red segment represents the signal peptide. The wild-type megalin contains a unique transmembrane domain encoded by exon 75, while the truncated megalin peptide is deprived of its transmembrane domain (e) Dorsal views of adult zebrafish showing enlarged eye globes in /rp2a ^de/8/de/8 mutant. The eye enlargement is variable between the two eyes of a single fish.

Fig. 6(a) c/cn7-TALEN (SEQ ID 026) targeting site (green) in intron 6-7 and exon 7. The underlined sequence represents the Pstl site, which is used for the detection of the TALEN-induced deletion (b) TALEN-induced 4bp-deletion of TTGC (blue) (SEQ ID 027), generated a frameshift of the open reading frame, resulting in premature stop codon within the exon 7 of clcn7 gene (c) Pstl digestion of PCR products after the amplification of the TALEN targeting region using genomic DNA extracted from the caudal fin of wild- type (c/cn7 ^+/+ ) (SEQ ID 027), heterozygous (clcn7 ^+/del4 ) and homozygous ( clcn7 ^{del4/del 4} ) (SEQ ID028) zebrafish. Wild type allele: lower bands of 120bp+121bp correspond to PCR products cut by Pstl, mutant allele: upper band 241 bp, resistant to Pstl digestion (d) Transmembrane protein structure of wild-type clc-7 (left panel) and truncated peptide (right panel). Wild-type clc-7 contains 12 transmembrane domains, while the truncated clc-7 peptide has only 2 residual transmembrane domains.

Fig. 7Protein domain prediction of vitamin D binding protein (VDBP) using Simple Modular Architecture Research Tool (SMART). Both human VDBP (SEQ ID029) and zebrafish vdbp (SEQ ID 030) contains two homologous ALBUMIN domains I and II which participate in vitamin D sterol-binding. The C-terminal domain III of human VDBP is involved in actin-binding (Swamy 2002).

Fig. 8(a) DNA sequence encoding for ½vdbp-mCherry (SEQ ID 031). Blue: DNA sequence coding for the C-terminal 207 amino acids of zebrafish vdbp, red : sequence of mCherry, black : 9bp introduced by cloning. The bases at junction area are underlined (b) DNA sequence chromatogram of ½vdbp-mCherry at junction area (SEQ ID 032). Blue: zebrafish vdbp and red: mCherry. (c) Amino acid sequence of ½vdbp-mCherry peptide, composed of 446 amino acids, including N-terminal 207 amino acids of zebrafish vdbp peptide (SEQ ID 033) (Blue), 3 amino acids (black) introduced by the cloning and 236 amino acids of mCherry peptide (Red).

Fig. 9(a) Coomassie staining of SDS-PAGE Gel and western blotting of recombinant ½vdbp- mCherry-6His protein purified by affinity chromatography. Arrow: full-length recombinant protein (b) Blood clearance of injected ½vdbp-mCherry-6His in 3dpf larvae. At the indicated times after the tracer injection, the zebrafish larvae were imaged by light sheet fluorescence microscope. DA: dorsal aorta n = 5 zebrafish per time point. Scale bar is 100pm. (c) Transgenic larvae expressing PiT1 ::EGFP-RAB7A were injected with ½vdbp- mCherry-6His and the pronephric proximal tubule was imaged by multiphoton fluorescence microscope. PT: proximal tubule n = 5 zebrafish per time point. Scale bar is 30pm. Non-parametric Mann Whitney test, ^* p < 0.05.

Fig. 10 Transgenic larvae co-expressing lfabp::A ¹ vdbp-mCherry (red) and cdh17::GFP (green) were injected with p-lactoglobulin-Cy5 (violet) at 5dpf and visualized by light sheet fluorescence microscope. L: liver, PT: proximal tubule. Scale bar is 20pm.

Fig. 11 (a) Western blotting of ½vdbp-mCherry protein levels in liver isolated from 3-month-old transgenic Irp2a ^+/+ and i _r p2a ^del8/del8 zebrafish and quantification (b) Western blotting of ½vdbp-mCherry protein levels in whole larval lysate prepared from control or cisplatin- treated transgenic larvae at 5dpf and quantification (c) Western blotting of ½vdbp- mCherry protein levels in whole larval lysate prepared from vehicle or gentamicin- injected transgenic larvae at 4dpf and quantification (d) Western blotting of ½vdbp- mCherry protein levels in liver isolated from 3-month-old transgenic clcn7 ^+/+ and clcn7 ^del4/del4 zebrafish and quantification (e) Western blotting of ½vdbp-mCherry protein levels in whole larval lysate prepared from vehicle or Bafilomycin A1 -treated transgenic larvae at 5dpf and quantification. n= 7 for each group, Plotted data represent meaniSEM. Non-parametric Mann-Whitney test, ns: non-significant.

Fig. 12 shows a schematic overview of one embodiment of the invention: a transgenic Tg(lfabp::1/2vdbp-mCherry) zebrafish reporter line for LMW proteinuria and lysosomal storage disease a) Fluorescent tracer 1/2vdbp-mCherry is uptaken and processed in lysosome by PT cells in physiological condition b) LMW proteinuria related to nephrotoxicity or disorders affecting the PT can be assessed by ELISA or by direct measurement with microplate reader using fish pool water, suitable for high-throughput screening c) Lysosomal accumulation of the tracer can be monitored by automated imaging of PT in high-content screening.

Fig. 13 shows (a) fluorescence imaging of zebrafish larvae expressing lfabp::A ¹ vdbp-mCherry showing the accumulation of mCherry-filled vesicles in PT cells of ctns ^del8/del8 . Both fluorescence intensity and total vesicle area were significantly increased in _c tns ^del8/del8 larvae. Scale bar is 30pm (left panel) and 10pm (middle panel). n=13 ( ctns ^+/+ ) and n=11 ( ctns ^{del8/del 8} ). (b) Western blotting of LC3 protein levels in whole larval lysate prepared at 4dpf. Protein levels of LC3-II was remarkably increased in ctns- deficient zebrafish, as compared to control. n=4 ( ctns ^+/+ ) and n= 3 ( ctns ^{del8/del 8} ). (c) The PT cells displayed increased number of mCherry-hl_C3b-positive puncta in 5dpf . _c tns ^del8/del8 larvae expressing PiT1::mCherry-hLC3b. Scale bar is 20 pm. n=17 ( ctns ^+/+ ) and n= 25 ( ctns ^{del8/del 8} ). (d) Quantification of mCherry-hLC3b by enzyme-linked immunosorbent assay (ELISA) in whole larval lysate prepared from larvae expressing PiT1::mCherry- hLC3b, which showed accumulation of mCherry-hLC3b in ctns ^del8/del8 n= 13 ( ctns ^+/+ ) and n=13 ( ctns ^{del8/del 8} ). (e) Quantification of urinary ½vdbp-mCherry by ELISA at different stage. The deletion of ctns gene caused progressive development of LMW proteinuria since 10dpf. Specific overexpression of wild-type zebrafish ctns cDNA in PT epithelial cells completely rescued the LMW proteinuria in _c tns ^del8/del8 larvae expressing PiT1::ctns- EGFP at 14dpf. n=14 ( ctns ^+/+ ) and n=14 ( ctns ^{del8/del 8} ) at 5dpf; n=10 ( ctns ^+/+ ) and n=13 (ctns ^del8/del8 ) at 10dpf; n=16 ( ctns ^+/+ ) and n=17 ( ctns ^{del8/del 8} ) at 14dpf; n=11 ( ctns ^+/+ expressing PiT1::ctns-EGFP) and n=12 ( ctns ^{del8/del 8} expressing PiT1 ::ctns-EGFP) at 14dpf; n=10 ( ns ^+/+ ) and n=21 ( ctns ^{del8/del 8} ) at 6 months (f) Colorimetric measurement of urinary phosphate in _c tns ^del8/del8 zebrafish at 14dpf and 6 months. The ctns- deficiency resulted in significant increase in urinary excretion of phosphate at 6 months n = 24 (ctns ^+/+ ) and n= 24 ( ctns ^{del8/del 8} ) at 14dpf; n= 11 ( ctns ^+/+ ) and n= 22 ( ctns ^{del8/del 8} ) at 6 months (g) Representative electron micrographs and quantifications of the surface area of electron-dense vesicles in PT of ctns zebrafish at 14dpf. The ctns knockout larvae displayed enlarged electron-dense lysosomal compartment and sporadic loss of brush border in the proximal tubules. White squares contain images at a higher magnification. n= 5 ( ctns ^+/+ ) and n= 6 ( ctns ^{del8/del 8} ). Asterisk: enlarged electron-dense vesicles. Arrow: PT cell with loss of brush border. Scale bar is 5pm (left panel) and 2pm (right panel). Plotted data represent meaniSEM. Non-parametric Mann Whitney test, ^* p<0.05, ^** p<0.01 , * ^** p<0.001 relative to ctns ^+/+ zebrafish; NS, non-significant.

Fig. 14 shows (a) in _c tns ^del8/del8 zebrafish, the mutation of 8-bp deletion generated a frameshift of the open reading frame, resulting in premature stop codon (TGA) within the exon 3 of ctns gene (ctns ^+/+ : SEQ ID No. 34; ctns ^del8/del8 \ SEQ ID No 35). (b) The mRNA levels of ctns and clcn5a were analysed by real-time PCR in 14dpf zebrafish larvae; n=6 ( ctns ^+/+ ), n=11 ( ctns ^{del8/del 8} ). (c) Cystine levels in whole larval lysate were assessed by HPLC, which showed the accumulation of cystine in 5dpf _c tns ^del8/del8 larvae, as compared to ctns ^+/+ larvae. n=10 ( ctns ^+/+ ) and n=10 ( ctns ^{del8/del 8} ). Non-parametric Mann Whitney test, * ^* p<0.01 , ^*** p< 0.001 relative to ctns ^+/+ zebrafish; NS, non-significant. Examples

Example 1: Assessment of the endolysosomal pathways in zebrafish models

In order to explore the endolysosomal pathway in zebrafish PT, we generated mutant knockout lines for Irp2a (coding for megalin) and clcn7 (coding for the lysosomal channel CIC-7) using the transcription activator-like effector nucleases (TALEN) technology. Two mutant lines were identified, Irp2a ^+/del8 and clcn7 ^+/del4 , with small deletions in target exons resulting in premature stop codons and truncated proteins (Figs. 5 and 6). The homozygous mutant lines displayed normal Mendelian ratios at birth, no developmental defects during larval stage, normal fertility, and no visible anomalies, except for the observation of enlarged eye globe in Irp2a homozygous adult mutant fish (Fig. 5).

In vivo endocytic assays were performed after i.v. injection of 18.4 kDa p-lactoglobulin-Cy5 (to measure receptor-mediated endocytosis) and 10kDa dextran-Alexa 647 (to measure fluid phase endocytosis) in 56hpf zebrafish larvae with green fluorescent pronephric tubules [transgenic Tg(cdh17::GFP)] (Fig.1a-c). Injected p-lactoglobulin-Cy5 was taken up within 20 min by pronephric PT cells of Irp2a ^+/+ larvae, whereas virtually no fluorescent signal was observed in i _r 2a ^del8/del8 larvae (Irp2a ^+/+ ·. 11 .3±0.4 vs. i _rp 2a ^del8/del8 ·. 0.3±0.1 , p<0.001 ) (Fig.1a). A similar defect in the uptake of 10kDa dextran by pronephric PT cells was observed at 60 min in irp2a ^del8/del8 larvae (Irp2a ^+/+ ·. 3.9±0.4 vs. i _rp 2a ^del8/del8 ·. 0.5±0.1 , p<0.001 ) (Fig.1b). Ultrastructure analysis of PT cells by transmission electron microscopy (TEM) showed a significant reduction in the number of endocytic vesicles in /rp2a-deficient larvae, compared to Irp2a ^+/+ PT cells (Irp2a ^+/+ . 40.5±4.6 vs. / _r p2a ^de/8/del8 : 19.6±3.4 p<0.001 ) (Fig.lc). Morphological analysis using the endosome reporter line Tg(PiT1 ::GFP-rab5aa) revealed GFP fluorescence enriched at the apical side of PT cells in irp2a ^+/+ larvae, which was absent in i _r p2a ^del8/del8 larvae ( lrp2a ^+/+ \ 18.6±3.7 vs. irp2a ^del8/del8 ·. 9.6± 1.0, p<0.05) (Fig. 1d).

The lysosomal processing was analyzed by in vivo pulse-chase experiments in 4dpf clcn7 ^+/+ and clcn7 ^del4/del4 transgenic Tg(cdh17::GFP) larvae after i.v. injection of p-lactoglobulin-Cy5. The p-lactoglobulin-Cy5 signal was located at the subapical pole of pronephric PT cells in both clcn7 ^+/+ and clcn7 ^del4/del4 lines at 20 min (Fig. 1e, left panels) and up to 1 h (middle panels) post injection. At 4h post-injection, the pronephric PT cells of clcn7 ^del4/del4 larvae accumulate considerable quantities of fluorescent ligand, while it is completely degraded in clcn7 ^+/+ larvae (c/cn7 ^+/+ : 39±7 vs. clcn7 ^del4/del4 \ 876±100, p<0.01 ) (Fig. 1e, right panels). In parallel, enlarged electron-dense vesicles were observed by TEM in PT cells of c/cn -deficient larvae, as compared to controls (Fig. 1f). These results show that specific defects in endocytosis ( Irp2 ) and lysosomal processing of internalized ligands (c/cn7), with corresponding ultrastructural changes, can be detected in pronephric PT cells of larvae with genetic defects along the endolysosomal pathway. Example 2: Generation and characterization of transgenic Tq(lfabp::/ ¹ 2vdbp-mCherry) line

Injection of fluorescent LMW tracer like p-lactoglobulin-Cy5 is labor-intensive and not easy to implement for high throughput functional assay. Both human VDBP and zebrafish vdbp contains two homologous ALBUMIN domains I and II (Fig. 7). which participate in vitamin D sterol-binding. ²⁵ To create a novel genetically encoded endocytic LMW reporter protein (Fig. 2a). we cloned the N-terminal 207aa-region containing the full ALBUMIN domain I of zebrafish vdbp protein (referred to as “½vdbp”) and fused the latter with the ORF of the acid-insensitive fluorophore mCherry (Fig. 2b and Fig. 8). As the promoter of fabplOa gene (coding for liver- type fatty acid binding protein 10a or Ifabp) is sufficient to modulate liver expression in zebrafish, ²⁶ the 3.5-kb 5’ flanking sequence of the Ifabp promoter was cloned to drive the expression of ½vdbp-mCherry in liver (Fig. 2b).

The inventors next analyzed the synthesis and processing of the endogenous ½vdbp-mCherry in stable transgenic Tg(lfabp::A ¹ vdbp-mCherry) larvae. The expression of ½vdbp-mCherry in transgenic zebrafish is confirmed by RT-PCR (Fig. 2c). western blot (Fig. 2d) and ELISA (Fig. 2e) in larval lysate and/or in isolated liver and kidney tissue. Live microscopy validated signal for ½vdbp-mCherry in the liver (Fig. 2f-g), blood vessels - especially the caudal vein (CV, Fig. 2f), and PT connected to the glomerulus visualized in wt1b::GFP transgenic fish (Fig. 2h). Within pronephric PT cells, the uptaken ½vdbp-mCherry co-localized with lysosome marker ctns-EGFP, as confirmed by confocal analysis of cryosections (Fig. 2i). These data demonstrate that ½vdbp-mCherry produced in Tg(lfabp::A ¹ vdbp-mCherry) larvae liver is filtered, reabsorbed and processed in PT cells similar to endogenous LMW proteins.

Analysis of the clearance of recombinant 6His-tagged ½vdbp-mCherry revealed that almost 70% of tracer was removed from blood 30min after injection, whereas the reabsorbed fluorescent ligand was completely degraded in PT cells at 120min post-injection (15min: 8.4±1 .4 vs. 120min: 0.3±0.1 , p<0.05) (Fig. 9).

Of note, the reabsorption pattern of the endogenous ½vdbp-mCherry (Fig. 2g) differs from the exogenous tracer p-lactoglobulin-Cy5 (Fig. 1e). This observation was confirmed by injecting p-lactoglobulin-Cy5 in double transgenic Tg(ifabp::V ₂ vdbp-mCherry/cdh17::GFP) larvae: the endogenous ½vdbp-mCherry was mainly uptaken by the early PT segment, while the injected p-lactoglobulin-Cy5 was reabsorbed by the late portion of PT (Fig. 10).

Example 3: PT dysfunction cause LMW proteinuria in transgenic reporter zebrafish

The Inventors next used genetic and toxic models to validate the excretion of ½vdbp-mCherry in urine as indicator of PT dysfunction in the Tg(lfabp::A:vdbp-mCherry) larvae system (Fig. 3a). Imaging of (megalin) /rp2a-deficient transgenic Tg(lfabp::A:vdbp-mCherry) larvae revealed a major decrease in the ½vdbp-mCherry signal in the j _r p2a ^del8/del8 pronephros compared to Irp2a ^+/+ larvae ( lrp2a ^+/+ \ 24.2±4.2 vs. i _r p2a ^del8/del8 6.8±1 .2, p<0.001 ) (Fig. 3b). confirming the PT endocytic defect. The defective PT uptake was paralleled by a 20-fold increase in urinary levels of ½vdbp-mCherry by ELISA (lrp2a ^+/+ \ 2.5±0.3 pg/mL vs. i _rp 2a ^del8/del8 ·. 62.1 ±11.8 pg/mL, p Q.OOP (Fig. 3c).

Zebrafish larvae have been previously used to study the nephrotoxicity of cisplatin and gentamycin, which induce acute kidney injury (AKI) in a dosage-dependent manner (Hentschel DM et al., 2005). The inventors first treated Tg(lfabp::A ¹ vdbp-mCherry) larvae with 1.5mM cisplatin. As expected, exposure to cisplatin induced a defective development of swim bladder in 26.0% of treated larvae, compared to 6.9% for untreated controls (Fig. 3d). Three days after exposure, cisplatin-treated larvae showed a significantly decreased fluorescent signal for mCherry in PT cells (untreated control: 8.6±0.9 vs. cisplatin-treated group: 5.4±0.5, p<0.01 ) (Fig. 3e). paralleled by a 20-fold increase in urinary levels of ½vdbp-mCherry (untreated control: 2.6±0.3 pg/mL vs. cisplatin-treated group: 50.7±11.9 pg/mL, p<0.001 ) (Fig. 3f). As cisplatin is known to induce mitochondrial dysfunction, the inventors analyzed the global mitochondrial respiration, which showed a significant decrease of oxygen consumption rate (OCR) in cisplatin-treated vs. control larvae (data not shown). Ultrastructural studies revealed a partial loss of the brush border, loss of mitochondrial matrix and mitochondrial swelling in PT cells of cisplatin-treated larvae (Fig. 3o), as described previously.

Aminoglycoside antibiotics such as gentamicin are internalized in PT cells via megalin, causing PT dysfunction and structural damage. Gentamicin-induced acute tubular damage can be prevented by taurine administration in rat models. The inventors exposed Tg(lfabp::A ¹ vdbp- mCherry) larvae to gentamicin alone or co-injected with taurine in a 1 :4 molar ratio. Gentamicin-injected larvae showed mild (40%) and severe (19%) edema associated with body curvature at 2 days post-injection, compared to 22% (mild) and 11 % (severe) of gentamicin- taurine co-injected larvae (Fig. 3h). Analysis of urine collected at 2 days post-injection reveals high levels of ½vdbp-mCherry in gentamicin-injected larvae compared to control larvae (vehicle: 2.7±0.4 pg/mL vs. gentamicin: 480±258 pg/mL, p<0.001 ). Co-injection of taurine with gentamicin resulted in a significant attenuation of the urinary excretion of ½vdbp-mCherry (105.7±71.7 pg/mL, p<0.05 vs. gentamicin alone) (Fig. 3i). Ultrastructural analysis showed the accumulation of lipid droplets in PT cells of gentamicin-treated larvae, which is also partially rescued by taurine co-injection (number of lipid droplet: vehicle: 0 vs. gentamicin: 9.4±1.9 vs. gentamicin + taurine: 5.2±1.4, p<0.001 ) (Fig. 3i). Western blotting data showed that the production level of ½vdbp-mCherry was not affected by Irp2a knockout or pharmacological treatment with either cisplatin or gentamicin (Fig. 11 ). Taken together, these data demonstrate that genetic and toxic models of PT dysfunction are associated with a significant loss of ½vdbp- mCherry in the urine of the Tg(lfabp::A:vdbp-mCherry) larvae, that can be monitored by ELISA. The urinary levels of ½vdbp-mCherry reflect the severity of the tubular damage and the effect of protective strategies.

Example 4: Transgenic zebrafish reporter for lysosomal storage disease Once internalized by receptor-mediated endocytosis in PT cells, LMW proteins are delivered to early and late endosomes, and finally to lysosomes for enzymatic degradation in an acidic environment. As the mCherry remains fluorescent in acidic environment, the inventors hypothesized that ½vdbp-mCherry could be useful to monitor lysosomal dysfunction in PT cells (Fig. 4a). Since the clcn7 ^del4/del4 larvae are a model of lysosomal storage disease (see above; Fig. 1e-q), the inventors first analyzed the processing of ½vdbp-mCherry in clcn7 ^+/+ and clcn7 ^del4/del4 transgenic Tg(lfabp::A ¹ vdbp mCherry) larvae. As compared to clcn7 ^+/+ larvae, the accumulation of mCherry in PT cells was detected in clcn7 ^del4/del4 homozygous mutants, with both significantly increased fluorescence intensity ( clcn7 ^+/+ : 22±4.0 vs. clcn7 ^del4/del4 : 75.9±6.1 , p< 0.001 ) and enlarged mCherry-positive vesicles ( clcn7 ^+/+ : 10.8±1.3 pm ² vs. clcn7 ^del4/del4 : 29.5±2.0 pm ² , p< 0.001 ) (Fig. 4b). Re-introduction of zebrafish clcn7 mRNA in homozygous mutant larvae partially rescued both the fluorescence intensity (47.2±4.0, p< 0.01 vs. non- injected control) and vesicle size ( clcn7 ^{del4/del 4} + clcn7 mRNA: 19.2±2.5 pm ² , p< 0.05 vs. non- injected control), demonstrating that the renal phenotype is specifically related to clcn7 gene deletion. The accumulation of fluorescent ligand in the late-endosome/lysosome in PT cells of clcn7 ^del4/del4 larvae was confirmed by correlative light and electron microscopy (CLEM), where ½vdbp-mCherry-positive endo-lysosomal compartments overlap with the electron-dense vesicles in clcn7 mutant (Fig. 4c).

The inventors next exposed Tg(lfabp::A ¹ vdbp-mCherry) larvae to the proton pump inhibitor bafilomycin A1 (BfnA1 ), which impairs lysosomal acidification. After incubation with BfnA1 (20nM for 16 hours), both fluorescence intensity (vehicle: 18.0±3.1 vs. BfnA1 : 36.9±2.9, p<0.01 ) and total fluorescence area (vehicle: 158±21 pm ² vs. Bfn A1 : 333±37 pm ² , p<0.01 ) were significantly increased in PT cells as compared to vehicle-treated controls (Fig. 4d). Western blotting data showed that the production level of ½vdbp-mCherry was not affected by clcn7 knockout or BfnA1 treatment (Fig. 11d-e). These results indicate that the Tg(lfabp::A:vdbp-mCherry) larvae system can also be used to monitor the PT cell accumulation of ½vdbp-mCherry in congenital ( clcn7 knockout) or acquired (BfnA1 ) lysosomal dysfunction.

Example 5: Cvstinosis zebrafish develop lysosomal storage disease and LMW proteinuria

Cystinosis is a recessively inherited lysosomal storage disorder caused by mutations in the CTNS gene, which encodes the lysosomal H ⁺ -driven cystine transporter cystinosin. The disease leads to accumulation of cystine in lysosomes, with functional impairment of multiple organs including the kidneys. The inventors generated zebrafish knockout for ctns gene by

TALEN technology, which harbors a mutation of 8bp-deletion ACCGCTGA in exon 3 of ctns gene (named _c tns ^del8/del8 line) (Fig. 14). The analysis of whole larval lysates by HPLC showed accumulation of cystine in 5 dpf ctns- deficient larvae ( ctns ^+/+ \ 2.7±0.2 nmol/mg protein vs. ctns ^del8/del8 \ 5.1 ±0.4 nmol/mg protein, p<0.001 ) (Figure 1a).

In order to investigate the consequences of cystine accumulation on endocytosis and lysosomal processing in pronephric PT cells, the renal phenotypes of _c tns ^del8/del8 ,Tg ^<lfabp:: ’ ^{vdbp m} c ^herry) _ze brafi _S h were analyzed. No ½vdbp-mCherry has been detected in urine collected from ctns ^del8/del8 larvae at 5dpf (Fig. 13e), confirming that the endocytic activity has not been affected by cystinosin-deletion at this early stage. However, the fluorescence optical imaging of PT cells in _c † _ns ^del8/del8 _; jg< ^lfab P ^:: ^ ^{, vdb} P- ^mCherr y) showed accumulation of mCherry-positive vesicles in ctns- deficient transgenic larvae, with significant increase in both fluorescence intensity ( ctns ^+/+ \ 21 5±2.2 vs. ctns ^del8/del8 : 50.8±3.8, p< 0.01 ) and total area of mCherry-positive vesicles ( ctns ^+/+ : 100.2±14.2 pm2 vs. ctns ^del8/del8 \ 187.6±21.6 pm2, p< 0.001 ) (Fig. 13a). Besides the accumulation of endocytic ligand, the protein levels of autophagosomal marker LC3-II were remarkably increased in larval lysate of 4dpf-cfns-deficient zebrafish ( ctns ^+/+ \ 1.0±0.1 vs. ctns ^del8/del8 : 2.5±0.1 , p<0.05) (Fig. 13b). The pronephric PT showed accumulation of mCherry- hl_C3b-positive autophagic vesicles in ctns ^del8/del8 , Tg ^{(P,T1::mCherry~hLC3b>} larvae as demonstrated by both optical fluorescence imaging of PT cells ( ctns ^+/+ : 82.4± 5.4 vs. ctns ^del8/del8 : 135.9±7.4 , p<0.001 ) (Fig. 13c) and by ELSIA detection of mCherry-hl_C3b in larval lysate ( ctns ^+/+ : 36.9± 2.4 vs. ctns ^del8/del8 \ 52.4±1.9, p<0.001 ) (Fig. 13d). These data demonstrate that the global invalidation of cystinosin impairs the lysosomal degradation of materials delivered by both endocytic and autophagic pathways.

The inventors have realized a longitudinal study of the effects of cystine accumulation on the endocytosis of PT cells in ctns ^+/+ and cfns ^de/8/de/8 zebrafish in order to follow the disease progression in ctns zebrafish. ELISA analysis of urinary ½vdbp-mCherry in fish pool showed that _C † _ns ^del8/del8 _; jg< ^lfab P ^:: ^ ^{, vdb} P- ^mCherr y) larvae progressively developed abnormal urinary excretion of ½vdbp-mCherry since 10dpf. A 2.6-fold increase in urinary levels of ½vdbp-mCherry was detected in cfns ^de/8/de/8 larvae at 14dpf, as compared to control larvae ( ctns ^+/+ \ 21.1 ±1.5 pg/mL vs. ctns ^del8/del8 : 64.3±8.6 pg/mL, p<0.001 ) (Fig. 13e), demonstrating that the receptor- mediated endocytosis is impaired in pronephric proximal tubule in cfns-deficient larvae. Specific overexpression of wild-type ctns cDNA in PT epithelial cells resulted in the complete rescue of urinary mCherry level in 14dpf-cfns ^cte/8/cte/8 , jg( ^p > ^T1::ctns - ^EGFp ) larvae (ctns ^+/+ \ 23.7±4.2 pg/mL vs. ctns ^del8/del8 : 29.3±5.5 pg/mL, non-significant) (Fig. 13e). These data confirm that LMW proteinuria is specifically related to the deletion of ctns gene in our mutant. A 6.6-fold increase in urinary ½vdbp-mCherry concentration were observed in 6-month-old zebrafish ctns ^+/+ : 22.4±3.0 pg/mL vs. ctns ^del8/del8 \ 147.4±19.5 pg/mL, p<0.001 ) (Fig. 13e), demonstrating that the endocytosis is also impaired in mesonephric PT cells. In order to enlarge the spectrum of PT dysfunction in ctns zebrafish model, the amount of phosphate excreted in fish pool was analyzed by colorimetric method. The urinary phosphate concentration did not differ between the two genotypes in 14dpf larvae, while it was significantly increased in 6-month-old _c tns ^del8/del8 zebrafish, as compared to ctns ^+/+ ( ctns ^+/+ \

14.1 ±0.4 pmol/L vs. ctns ^del8/del8 \ 15.7±0.3 pmol/L, p<0.01 ) (Fig. 13f). Ultrastructural analysis by TEM exhibited that the pronephric PT accumulated enlarged electron-dense lysosomal compartment (Fig. 13g, left and middle panels) in 14dpf cfns ^de/8/de/8 larvae. Sporadic loss of brush border of epithelial cells was also found in ctns knockout larvae (Fig. 13g, right panel), correlating with the detection of LMW proteinuria at this stage. These data demonstrate that PT dysfunction, including both LMW proteinuria and phosphaturia is progressively developing in cfns ^de/8/de/8 zebrafish, mimicking the situation observed in patients with nephropathic cystinosis.

Methods

Method 1: Zebrafish maintenance and chemical treatment

Zebrafish ( Danio rerio) were kept at day/night cycle of 14/10 hours at 28°C. Embryos were obtained through natural spawning in Fish Facility of University of Zurich (Zurich, Switzerland) and raised in E3 medium containing 0.01 % methylene blue. For cisplatin treatment, 2dpf- zebrafish embryos were treated with E3 medium containing 1.5mM cisplatin (Sigma, C2210000) for 4 hours and re-incubated with fresh E3 medium until phenotypic analysis. The number of zebrafish larvae showing defective development of swim bladder was counted manually under stereo microscope. For gentamicin treatment, 2dpf-zebrafish embryos were injected with 1 nl of 6pg/pL gentamicin /0.9% NaCI solution (Sigma, G1264) alone or co-injected with 6.3pg/pL taurine (Sigma, T0625) into common cardinal vein after anesthesia with 0.2 mg/ml Ethyl 3-aminobenzoate methanesulfonate salt (Sigma, E10521 ). Embryos were immediately re-incubated in fresh medium until phenotypical analysis. The morphology of zebrafish larvae was analyzed at 4dpf under stereo microscope and classified as: stage I: no morphological change, stage II: mild edema and stage III: severe edema (Cianciolo Cosentino et al., 2016). Overnight urine excreted in E3 medium was collected individually after 2 days (gentamicin) or 3 days (cisplatin) of treatments. Embryos were treated with 0.003% N- Phenylthiourea (Sigma, 222909) prior to in vivo larval imaging. Stock solution of bafilomycin A1 (Sigma, B1793) was prepared in DMSO and zebrafish larvae were treated with E3 medium containing 20nM bafilomycin A1 for 16 hours at 28°C. The experiments performed on animals were approved by the local legal authority (Veterinary Office, Canton of Zurich, Switzerland).

Method 2: Generation of Irp2a and clcn7 knockout zebrafish by TALEN technology

Irp2a- and c/cn 7-specific TALENs were constructed in according to Golden Gate

TALENassembly protocol and using the Golden Gate TALEN and TAL Effector Kit 2.0 (Addgene Kit # 1000000024 ). Clscript-Goldy TALEN was a gift from Daniel Carlson & Stephen Ekker (Addgene plasmid # 38142) and TALENs were designed with the TAL Effector Nucleotide Targeter 2.0 software on the Website of Cornell University. The Irp2a- TALENs target the exon 75 of zebrafish Irp2a gene: Irp2a-TALEN-Left: CCCTTTAATGTTGTTTGT (SEQ ID NO. 001 ) and /rp2a-TALEN-Right: T ACT GTT AGCAGT GGT GATT (SEQ ID NO. 002). The c/cn7-TALENs target the exon 7 of zebrafish clcn7 gene: c/cn7-TALEN-Left: GATT ATTT ATTTTTT C AC A (SEQ ID NO. 003) and c/cn 7-TALEN-Right: AAGTGGAATCCCTCAAATAAA (SEQ ID NO. 004). The spacer of two TALEN target sites for both genes is 15 nucleotides, containing Acil (for Irp2a) and Pstl (forclcn7) restriction site used for mutant screening. The TALEN expression plasmids were linearized with BamHI and then used for in vitro transcription (mMESSAGE mMACHINE T3 kit, Ambion). Approximately 1 nL of TALEN mRNAs (400ng/pL) was injected into one-cell stage zebrafish embryos. After 24 h, genomic DNA was extracted from injected embryos with normal appearance. Targeted genomic loci were amplified using primers designed to anneal approximately 430 base pairs for Irp2a and 240 base pairs for clcn7, and mutant allele was detected by enzymatic digestion of PCR product. The TALENs-injected adulthood (F0) zebrafish were outcrossed with wild type zebrafish and embryos were then raised to adulthood (F1 ) for screening of heterozygous carriers. Homozygous mutants (F2) were generated from incross of heterozygous fish for phenotypic analysis. The structure of wild type and mutated Irp2a/megalin and chloride channel 7 proteins is predicted with the open-source tool Protter (ETH Zurich, Switzerland).

For mRNA rescue, zebrafish clcn7 cDNA was synthetized by reverse transcription of total RNA extracted from wild-type zebrafish kidney using iScript cDNA Synthesis Kit (BioRad, USA) and primers clcn7-Fw\ 5’-TATGGCCAACATCACGAAGAA-3’ (SEQ ID NO. 005), den 7 -Rev. 5’- ATCATGTCTGTGC CAGCTGAA-3’ (SEQ ID NO. 006). The dcn7 cDNA was cloned into the pDrive TOPO cloning vector (Qiagen). The plasmid pDrive-zf-dcn7 was linearized with BamHI and then used for in vitro transcription (mMESSAGE mMACHINE SP6 kit, Ambion), followed by Poly(A) tailing by E-PAP enzyme. Approximately 1nL of cicn7 mRNAs (600ng/pL) was injected into one-cell stage of transgenic cicn7 knockout embryos, and the phenotype analyzed at 5dpf.

Method 3: Generation of transgenic line with tissue-spedfic expression of reporter protein

The promoters of zebrafish fabplOa gene (fatty acid binding protein 10a, liver type-fabp or Ifabp) and slc20a1a gene (PiT 1 , phosphate transporter 1 ) were amplified from zebrafish genomic DNA by PCR (Platinum® Taq DNA Polymerase High Fidelity kit, Invitrogen) and cloned with pENTR™ 5'-TOPO® TA Cloning® Kit (Invitrogen, USA). EGFP-RAB7A was a gift from Gia Voeltz (Addgene plasmid # 61803). Zebrafish dns cDNA was synthetized by reverse transcription of total RNA extracted from zebrafish embryo using iScript cDNA Synthesis Kit (BioRad, USA). Zebrafish rab5aa cDNA was cloned from wild type zebrafish larvae and fused with GFP coding sequence using pCS-GFP vector. The coding sequence of N-terminal 207 aa of zebrafish gc gene (vitamin D binding protein, vdbp) was cloned from isolated zebrafish liver and fused with mCherry ORF using pCS2-mCherry vector. Middle entry clones pED-Atvdbp- mCherry, pED-GFP-rab5aa, pED-EGFP-RAB7A, pED-mCherry-hLC3b and pED-ctns were prepared using pENTR™/D-TOPO® Cloning Kit (Invitrogen, USA). The construction of plasmids lfabp::A ¹ vdbp-mCherry, PiT1 ::GFP-rab5aa, PiT1::EGFP-RAB7A, PiT1::mCherry- hLC3b and PiT1::ctns-EGFP were realized after LR Reaction (Gateway™ LR Clonase™ II Enzyme Mix, Invitrogen, USA) using destination vector pDestTol2CG2 (Tol2 kit v1.2) with cmlc2:EGFP transgenesis marker, homemade 5'-entry clones and middle entry clones, as well as 3'-entry clones p3E-EGFPpA or p3E-polyA. Plasmid DNA were co-injected with Tol2 transposase mRNA into zebrafish embryo at one-cell stage to generate stable transgenic lines. Primers used to clone promoters and cDNA are: Ifabp-Fw. 5’-

AAAT G C AAATT CT GAG C AAAT G AC-3 ’ (SEQ ID NO. 007), Ifabp-Rev. 5’-

G CTTT CTG G AG AAG CT C AAC A-3 ’ (3527bp) (SEQ ID NO. 008), P/Tf-Fw: 5’-

CAAAGT GCCAGT AGCCATT GA-3’ (SEQ ID NO. 009) and P/Tf-Rev: 5’-

TGAATGTCTTCTGCTGGGTTG-3’ (3496bp) (SEQ ID NO. 010). rabbaa- Fw: 5’-

AAATCAGTTCAAGCAACCTGTC-3’ (SEQ ID NO. 011 ), rab5aa-Re\r. 5’-

GGT AACAGAGTTT GGT GAGGG-3’ (793bp) (SEQ ID NO. 012); cfns-Fw: 5’-

CCTTCCGCGTATGGAGTAGC-3’ (SEQ ID NO. 013), cfns-Rev: 5’-CCCGGT-

C AG GTTTT C ACACT -3 ’ (1240bp) (SEQ ID NO. 014); vdbp- Fw (with BamHI site): 5’- TCT AACT CAT CTT G AAATT AT AACC AGT G GAT CCT AAG AAAT GAT G AAT G CAT CTTT AATT TTAATTTATG-3’ (SEQ ID NO. 015) and vdbp- Rev (with BamHI site): 5’- CT C AG AAAAAT GTTGGATCCTCT CAT CTG GATT CTCTCTTG G AAAAAAC AAG A-3 ’ (SEQ ID NO. 016). Double transgenic zebrafish larvae were produced after incross of transgenic Tg (lfabp::1/2vdbp-mCherry) zebrafish with transgenic Tg(cdh17::GFP), Tg(wt1b::GFP), or Tg(PiT1 ::ctns-GFP).

Method 4: Production and purification of recombinant AtvdbD-mCherry for clearance studies

Recombinant 6xHis-tagged ½vdbp-mCherry and (His) ₆ -fusion proteins were produced using ExpiCHO™ Expression System (Thermo Fisher Scientific). The expression vector pCMV- Atvdbp-mCherry-ehlis was transiently transfected into ExpiCHO-S™ cell in serum-free ExpiCHO™ Expression Medium using ExpiFectamine™ CHO Reagent. At 20 hours after transfection, ExpiFectamine™ CHO Enhancer and ExpiCHO™ Feed were added into the medium, which was collected for purification 3 days after transfection. The medium supplemented with EDTA-free Protease Inhibitor Cocktail (complete™) and 1 mM PMSF was concentrated and cleaned up with Amicon Ultra-15 filter unit (PLTK Ultracel-PL Membran, 30 kDa) and binding buffer (20 mM Tris pH 8.0, 500 mM NaCI, 5 mM imidazole, Protease Inhibitor and PMSF). After ultracentrifugation (170’000g for 1 hour at 4°C), the supernatant was purified by Ni ²⁺ -affinity chromatography using HiTrap® Chelating High Performance column (GE17- 0408-01 SIGMA) and Fast Protein Liquid Chromatography (FPLC, Bio-Rad). The recombinant ½vdbp-mCherry-6His protein was rescued in elution buffer (20 mM Tris pH 8.0, 500 mM NaCI, 500 mM imidazole), filtered and cleaned up 3x with 30kDa-filter unit and PBS solution to remove imidazole, followed by 1x filtration with 50kDa-filter unit and concentration determination by using ELISA mCherry kit.

The clearance rate of ½vdbp-mCherry was analyzed following i.v. injection of the purified recombinant protein (single bolus injection of 1 nl of 0.3mg/ml ½vdbp-mCherry-6His) in transgenic larvae expressing EGFP-RAB7A. The fluorescence signal was analyzed in the dorsal aorta at 5, 15, 30 and 60 minutes after tracer injection.

Method 5: Endocvtic activity assay

Bovine b-lactoglobulin (Mr 18,400, Sigma) was labeled and purified with Cy5 TM2 Ab labelling kit (Amersham BioSciences, PA35000, UK) according to the manufacturer’s instructions b- lactoglobulin-Cy5 injection solution was prepared at 5 mg/mL final concentration. Transgenic Tg(cdh17::GFP) larvae expressing GFP in pronephric epithelial cells (Dr Frank Bos, Utrecht, The Netherlands) were anaesthetized with 0.2 mg/mL tricaine solution in egg water, prior to injection of b-lactoglobulin-Cy5 or 10kDa dextran-Alexa647 (Invitrogen, D22914) into common cardinal vein. Tracer injection into larvae blood was confirmed by immediate observation of positive fluorescent vessels. Larvae were re-incubated in fresh E3 medium for 20min, 1 h or 4h, followed by overnight fixation with 2% paraformaldehyde (PFA)/PBS containing 0.1 % tween 20.

Method 6: Fluorescence microscopy

Lightsheet fluorescence microscope (ZEISS Lightsheet Z.1 , Germany) was used to visualize in vivo the expression of transgenic reporter lines or in fixed larvae after tracer injection by using 20x/1 .0 NA water immersion objective (W Plan APO, Zeiss). The whole larva imaging was followed by genotype assessment before performing data analysis. Images were processed with Imaris (Bitplane, UK) to generate a maximum intensity projection of Z-stack, which was used for the quantification of the fluorescence intensity with ImageJ. Quantitative analysis of fluorescent signals was performed with one whole pronephric tubule for each larva using the same setting parameters. Multiphoton fluorescence microscope (Leica TCS SP8 Upright MP FLIM) was used to acquire high-resolution images to ananlyze the fluorescent vesicles in proximal tubules by using 25x/1.0NA water immersion objective (HC IRAPO L, Leica). The excitation wavelength was 1100nm (tunable laser) for imaging of mCherry alone, while 925nm tunable laser and 1010nm fixed wavelength laser were used for dual-color imaging of EGFP and mCherry. The acquired data was processed by Huygens software for deconvolution, followed by segmentation using ilastik software (EMBL, Germany) and quantification of individual vesicle size or total vesicle area for each stack using ImageJ. For co-localization analysis, fixed transgenic larvae were infiltrated with 30% sucrose at 4°C for overnight, mounted in Tissue-Tek® O.C.T.™ Compound, and frozen at -80°C. 10pm cryosections were prepared and analyzed by Leica SP8 upright confocal microscope with a 40x oil immersion objective (HCX PL APO, Leica Microsystem, Germany). A single Z-stack was used for quantification of GFP and mCherry fluorescence signal by ImageJ.

Method 7: Transmission electron microscopy

After tail cutting, zebrafish larvae were fixed in 2.5% glutaraldehyde and 1.6% paraformaldehyde in 0.1 M cacodylate buffer, pH7.3 overnight. After rinsing in 0.1 M cacodylate buffer, larvae were then post-fixed in 1% osmium tetroxide in cacodylate buffer for 40min at room temperature and stained in 1 % aqueous uranyl acetate for 1 hour at room temperature. After dehydration through a graded series of ethanol, samples were infiltrated and embedded in Epon812 at 60°C for 28 hours. 350nm semi-thin sections were prepared on a Leica EM FCS ultra-microtome (Leica Microsystem, Germany) and stained by Toluidine blue solution. 60nm ultra-thin sections were collected onto formvar-coated copper grids, stained with lead phosphate dilution in water, and analyzed on an electron microscope (Philips CM100) at 80kV. Image analysis was made using ImageJ. The vesicle number was counted manually and the vesicle diameter is expressed as the average of membrane-to-membrane diameter based on the x and y axes.

Method 8: Correlative light and electron microscopy (CLEM)

After removing the head and tail, zebrafish larvae were fixed in 0.05% glutaraldehyde and 4% formaldehyde in 0.1 M cacodylate buffer at 4°C for overnight. To achieve better cutting stability, the tissue pieces were embedded in 12% gelatin (local food brand, Extra Gold, Dr. Oetker) in 0.1 M phosphate buffer, pH 7.4 at 40°C. After hardening, 1x1 mm pieces were cut out on ice and then incubated in 2.3M sucrose at 4°C. After two washes in 2.3M sucrose, the tissue/gelatin pieces were stored at -20°C or further processed in fresh 2.3M sucrose. Tissue/gelatin pieces were mounted on a cryo pin (Leica Microsystem, Germany) and cryosectioned with a cryosectioning device (UC6, Leica Microsystems). 110 nm Tokuyasu cryosections were collected on silicon wafers (7x7mm, Si-mat, Germany). Prior to sample collection, wafers were glow-discharged and fluorescent beads 170 nm (PS-SpeckTM, Thermo Fischer) were added as fiducial markers. After collection samples were washed twice with PBS and stained with DAPI for 30 sec. The sections on wafer were then incubated in 87% glycerin (Sigma)/PBS 1 :1 solution for 2 x 10 sec and then transferred with the sections facing down to a glass bottom petri dish (Ibidi, Germany) and imaged with a Widefield fluorescence microscope (Leica Microsystems TIRF - Leica SR GSD 3D) with a 160x/1.43 NA oil immersion objective (HCX PL APO, Leica Microsystems) acquiring 1000 images per channel for the SRRF analysis. Before ultrastructural analysis, the ultrathin sections were washed with PBS, post-fixed with 0.1 % glutaraldehyde in PBS for 5 min, and incubated with 2% methylcellulose in water at 0°C (2 * 5min). The wafers were then centrifuged at 14,100 * g for 90s, heated at 40°C for 10min, mounted on an scanning electron microscopy aluminium stub with conducting carbon cement (Conductive carbon, Plano) and imaged in a scanning electron microscope (Zeiss Auriga, Germany) using an acceleration voltage of 1.5 keV ( Mateos JM et al., 2018) Fluorescence images were processed with the plugin Super-Resolution Radial Fluctuations (SRRF) (Gustafsson N et al., 2016) within the open-source platform Fiji. Fluorescent beads registered in the light and electron microscopy images were used for the alignment of the images with TrakEM2 (Cardona A et al., 2012)

Method 9: Reverse-transcription polymerase chain reaction

Total RNA was extracted from liver tissue isolated from adult zebrafish using TRIzol Reagent (Invitrogen) and T10 Basic Ultra-Turrax Disperser (IKA, Germany). DNAse I treatment was performed to eliminate genomic DNA contamination. One microgram of RNA was converted into cDNA using iScript cDNA Synthesis Kit (Bio-Rad). The cDNA of vdbp and ½vdbp- mCherry was detected by polymerase chain reaction using Phusion High-Fidelity PCR Master Mix (Biolabs) and specific primers vd/bp-cDNA-Fw: 5’-

AT G AAT G CAT CTTT AATTTT AATTT AT G CTTT AAT AGT -3 ’ (SEQ ID NO. 017) (containing the start codon of vdbp cDNA) and vd/bp-cDNA-Rev: 5’-TTCAGGCGATCTCTTCATCCA-3’ (SEQ ID NO. 018) (located on the 3’ Untranslated Transcribed Region of vdbp cDNA) (for vdbp cDNA, 1459bp), and vdbp-mCherry-Fw: 5’-GCATCCAGGCATTGAGCAG-3’ (SEQ ID NO. 019) (located on the N-terminus of vdbp cDNA) and vd/bp-mCherry-Rev: 5TTACTTGTACAGCTCGTCCATGC-3’ (SEQ ID NO. 020) (containing stop codon of mCherry open reading frame) (for ½vdbp-mCherry 1030bp).

Method 10: Western blotting

Zebrafish larval or liver tissue was homogenized in RIPA buffer (Sigma, R0278) by sonication and protein concentration was determined using Pierce™ BCA Protein Assay Kit (ThermoFischer, 23225). Samples were mixed with Laemmli sample buffer and separated by SDS-PAGE under reducing conditions. After blotting onto PVDF membrane and blocking with 5% non-fat milk (Bio-Rad, 1706404) diluted in PBS, the membranes were incubated overnight at 4°C with primary antibody against mCherry (Abeam, ab167453), b-actin (Sigma, A5441 ), LC3A (Novus Biologicals, NB100-2331 ) or GAPDH (Cell signaling, 14C10). After washing and incubating with peroxidase-labeled secondary antibody (Darko, Denmark), the membranes were visualized with ChemiDoc™ Touch Imaging System (Bio-Rad). Method 11: Urine collection and ELISA mCherry

Zebrafish larvae were placed in 96-well microplate with one larvae/1 OOmI E3 medium/well and kept at 28°C for 16 hours, followed by urine collection for ELISA assays. Liver and kidney tissue were extracted using 1x Cell Extraction Buffer PTR and diluted with Sample Diluent NS from the mCherry ELISA kit (Abeam, ab221829). ½vdbp-mCherry was assayed according to manufacturer’s recommended protocol briefly descripted as follow. 50pL E3 medium containing urine or was distributed to 96-well microplate pre-coated with anti-mCherry antibody. 50pL mixture of capture antibody and detector antibody was added to each well and incubated at 37°C for 1 hour. The wells were rinsed 3x times with 1x Wash buffer PT and incubated with 10OmI of TMB Substrate at room temperature for 10 minutes. The reaction was stopped by adding 100mI of stop solution, followed by reading the absorbance of each well at 450 nm.

Method 12: Statistical analysis

The software Prism 5 (Graph Pad Software, USA) was used for all statistical analyses. The D'Agostino-Pearson normality test was applied on all data sets. For experiments with more than 2 conditions, differences between experimental groups were evaluated using one-way analysis of variance followed by Bonferroni or Kruskal-Wallis post hoc tests. When only two groups were compared, either unpaired two tailed t-test or Mann-Whitney test were used.

For experiments with Irp2a and clcn7 lines, larvae generated from crossing heterozygous lines were used. Whole mount imaging was done in a blinded manner, before genotype determination. Thus the exact sample size in each experiment was variable. None of the samples was excluded from the experiment. Zebrafish embryos were randomly selected for chemical-treatment group or control group. Statistical significance was set at a p<0.05.

Method 13: Measurement of urinary phosphate concentration

Overnight urine (16 hours) was collected in fish water and stocked at -20°C until biochemical analysis. The volume of fish water used for collection of urine was 0.5mL for 10dpf larvae, 1 mL for 14dpf larvae and 200mL for 6-month-old adult zebrafish. The urinary phosphate in fish water was assayed by colorimetric method using Phosphate assay kit (Abeam). After distribution of 2x-diluted urine/water in 96-well microplate with 200 pL/well, 30 pL of phosphate reagent was added to each well and incubated at room temperature for 30 minutes. The absorbance of each well was read at 650 nm.

References

Cardona A, Saalfeld S, Schindelin J, et al. TrakEM2 software for neural circuit reconstruction. Plos One 2012; 7: e38011. Cianciolo Cosentino C, Roman BL, Drummond IA, et al. Intravenous microinjections of zebrafish larvae to study acute kidney injury. J Vis Exp 2010.

Gustafsson N, Culley S, Ashdown G, et al. Fast live-cell conventional fluorophore nanoscopy with ImageJ through super-resolution radial fluctuations. Nat Commun 2016; 7: 12471. Hentschel DM, Park KM, Cilenti L, et al. Acute renal failure in zebrafish: a novel system to study a complex disease" (vol 288, pg923, 2005). Am J Physiol-Renal 2005; 289: F939- F939.

Mateos JM, Barmettler G, Doehner J, et al. Direct imaging of uncoated biological samples enables correlation of super-resolution and electron microscopy data. Sci Rep 2018; 8: 11610.

Shinoda H., Shannon M., Nagai T., Int J Mol Sci. 2018 Jun; 19(6): 1548, particularly Table 1 and references therein.