BACKGROUND OF THE INVENTION Bovine viral diarrhea virus (BVDV) is an economically important and world- wide distributed pathogen in cattle (Moennig and Plagemann, 1992; Thiel et a/., 1996). BVDV, together with classical swine fever virus (CSFV) and border disease virus (BDV), belongs to the genus Pestivirus of the Flaviviridae family that also includes human hepatitis C virus (Thiel et al., 1996). The pestiviraf genome is a positive, single-stranded RNA molecule of usually 12.3 kb in length that encodes one polyprotein of about 4,000 amino acids, which is co-and post-translationally processed by cell-and virus-derived proteases to give rise to the mature viral proteins (Rice, 1996; Meyers and Thiel, 1996). The order of cleavage products in the pestivirus polyprotein is as follows : NH2-NP'-C-Erns-Ei-E2-p7-NS2-NS3-NS4A- NS4B-NS5A-NS5B-COOH. The pestivirus structural proteins are composed of the basic nucleocapsid C protein and of the Erns, E1, and E2 envelope glycoproteins.

NPro protein exerts an autoproteinase activity whereas the remaining proteins are likely to be enzymatic or structural proteins of the viral RNA replication complex.

Finally, pestivirus NS3 usually possesses RNA binding, RNA-stimulated nucleoside triphosphatase, RNA helicase, and proteinase activities (Wiskerchen and Collet, 1991; Tamura et aL, 1993; Warrener et al., 1995), whereas NS5B contains the conserved GDD motif characteristic of RNA-dependent RNA polymerases (Meyers and Thiel, 1996).

BVDV strains are divided into two major genetic groups. Group I contains the classical BVDV strains (for instance, NADL, Oregon and Singer strains), whereas group 11 includes thrombocytopenic and highly virulent strains (for instance, 890 and 24515 isolates) (Pellerin et al, 1994, Ridpath et al., 1994;

Archambault et al., 2000). Based on 5'untranslated (UTR) sequences, classical BVDVs could be further divided into two subgroups (1a and 1b) (Pellerin et al., 1994, Ridpath et al., 1994; Hammers et al., 2001). BVDV strains also exist as two biotypes, cytopathogenic (cp) and noncytopathogenic (ncp), according to their effects on tissue culture cells (Kummerer et al, 2000).

Apoptosis (the so-called programmed cell death process) and necrosis are mechanisms by which eukaryotic cells die (Duvall and Wyllie, 1986).

Necrosis results from a pathological reaction in response to perturbations in the cell environment, whereas apoptosis is an innate mechanism by which the host eliminates unwanted cells with no inflammation response. In that regard, apoptosis is considered the physiological form of cell death which occurs during embryonic development, tissue remodeling and tumor regression (Schulze- Osthoff et al., 1998). Several mammalian DNA and RNA viruses have been associated with cell apoptosis (Teodoro and Branton, 1997; O'Brien, 1998)).

Viruses possess various biochemical and genetic mechanisms to evade and/or induce apoptosis in infected cells through interactions at different stages of the apoptotic pathway. Thus, in the early phases of infection, it would be advantageous for the virus to inhibit host cell death to ensure optimal genomic replication, whereas at late stages of infection, it would be beneficial for the virus to induce apoptosis for maximal production of new virions.

In pestiviruses, the glycoprotein Er,, of CSFV has been shown to induce apoptosis in vitro (Bruschke et al., 1997). Similarly, the envelope E protein of the Langat virus, a viral member of the Flavivirus genus of the Flaviviridae family, also has been identified as an inducer of apoptosis (Prikhod'ko et al, 1997). In BVDV, cells infected in vitro with the cp biotype has been shown to undergo apoptosis (Zhang et al., 1996). The apoptosis process was associated with cleavage of poly (ADP-ribose) polymerase (PARP) (Hoff and Donis, 1997) and was prevented by certain antioxidants (Schweizer and Peterhans, 1999). However, the viral determinants involved in cp BVDV-associated apoptosis in the course of cell infection in vitro have never been determined.

Most prior art disclosing treatment therapies against cancer diseases, and/or immunological or any other physiological disorders, based on induction of

apoptosis have proven to be less than adequate for clinical application. Therefore, there is a continuing need for novel candidates effective to induce apoptosis in cells.

The present invention fulfills that need and also other needs, which will be apparent to those skilled in the art upon reading the following specification.

SUMMARY OF THE INVENTION An object of the present invention is to provide the use of an isolated polynucleotide encoding a polypeptide biologically equivalent to a second polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof, for inducing apoptosis in a cell.

Another object of the invention is to provide the use of an isolated polypeptide biologically equivalent to a second polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof for inducing apoptosis in a cell.

A further object of the invention is to provide a method for inducing apoptosis in target cells comprising the step of contacting the cells with the above mentioned polypeptide.

The surprising ability of the polypeptide contemplated by the present invention to induce apoptosis in cells addresses a long unfulfilled need in the medical arts and provides an important benefit for animals and humans. The compositions incorporating said polypeptide or the polynucleotide encoding the same may be useful to treat or prevent cancer diseases and/or immunological or any other physiological disorders, when elimination of the dysregulated and pathological cells is preferably needed.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 shows a SDS-polyacrylamide gel analysis of BVDV p80 and p80A50 fusion proteins expressed in E. coli DH5a after 3 hours post-induction. Lane 1 refers to total protein extract from uninduced E. coli DH5a containing no

expression plasmid vector; lanes 2 and 3 refer to total protein extract from uninduced and induced recombinant bacteria containing the p80-expressing plasmid vector; respectively ; lanes 4 and 5 refer to total protein extract from uninduced and induced recombinant bacteria containing the p80A26-expressing plasmid vector; respectively ; lanes 6 and 7 refer to total protein extract from uninduced and induced recombinant bacteria containing the p80A50-expressing plasmid vector ; respectively; lane 8 refers to purified p80A50 protein.

Figure 2 shows the induction of apoptosis in A549tTA cells by BVDV p80 and p80A50 proteins IG. 2: Changes in cell morphology (400X enlargement) induced by BVDV p80 and p80A50 proteins. A549tTA cells were infected with GFP- expressing rec-Adenovirus (A), BVDV p80-expressing rec-Adenovirus (B) or BVDV p80A50-expressing rec-Adenovirus (C) with an MOI of 500 PFU per cell, and incubated for 40,48, and 40 hours, respectively. In situ cell DNA fragmentation was assessed using a colorimetric Tdt-mediated dUTP nick end labeling (TUNEL) commercial kit. Arrows indicate examples of nucleus condensation and labeling (dark-brownish color) with TUNEL.

Figure 3 shows the expression analysis of BVDV p80 and p80A50 proteins in A549tTA cells. Cells were mock-infected, treated with actinomycin D (50 Ag per ml), or infected with rec-Adenoviruses with an MOI of 500 PFU per cell. (A) Western blot immunoblotting on cell extracts using BVDV p80A50-rabbit antiserum, and a peroxidase-conjugated anti-rabbit antiserum. Immunological reactivity was revealed after adding the peroxidase substrate (PBSS, ph 7.3, H202, methanol and 4-chloro-naphthol) for 20 min. Lane 1, mock-infected cells (40 hours of incubation); lane 2, actinomycin D treated-cells (30 hours of incubation) ; lane 3, cells infected with GFP-expressing rec-Adenovirus (40 hours pi); lane 4, cells infected with BVDV p80-expressing rec-Adenovirus (48 hours post infection) ; lane 5, cells infected with BVDV p80A50-expressing rec-Adenovirus (40 hours of infection); lane 6, BVDV p80A50 expressed in E. coli used as a positive control.

Lane M, molecular weight standards in kDa (indicated in the left margin). (B)

Confocal fluorescence microscopy. Cells were infected with p80A50-expressing rec-Adenovirus for 40 hours, fixed in paraformaldehyde solution for 1 hour, and permeabilised with Triton X-100 solution for 10 min. Cells were then exposed to rabbit anti-BVDV p80A50, washed, and exposed to Cy3-conjugated goat anti- rabbit immunoglobulin G (whole molecule). a) unlabeled cells ; b) GFP expression; c) BVDV p80A50 expression; d) co-localization of GFP and BVDV p80A50- expressed proteins.

Figure 4 shows the cell DNA oligonucleosomal fragmentation analysis as determined on ethidium bromide stained agarose gel. A549tTA cells were mock- infected, treated with Actinomycin D (50 pg per ml), or infected with rec- Adenoviruses with an MOI of 500 PFU per cell. Lane 1, mock infected cells (40 hours of incubation); lane 2, cells infected with GFP-expressing rec-Adenovirus (40 hours post infection) ; lane 3, actinomycin D-treated cells (30 hours of incubation); lane 4, cells infected with BVDV p80-expressing rec-Adenovirus (48 hours post infection); lane 5, cells infected with BVDV p80A50-expressing rec- Adenovirus (40 hours post infection); lane 6, mock-infected MDBK cells (72 hours of incubation); lane 7, MDBK cells infected with BVDV (NADL strain) (72 hours post infection). M: Haelil-digested fX-174 and Hind replicative-form DNAs as molecular mass markers.

Figure 5 shows the determination of subdiploid DNA content and quantitation of apoptotic cells by flow cytometry. (A) Typical histograms of cell DNA fragmentation obtained after 40 hours of cell incubation are shown. A549tTA cells were mock- infected, treated with actinomycin D (50 ug per ml), or infected with GFP-or BVDV p80 or p80A50-expressing rec-Adenovirus with an MOI of 500 PFU per cell. Single cell suspension were fixed and permeabilized, and stained with propidium iodide (PI) before flow cytometry analysis. PI fluorescence was detected at 660 nm (x axis). M1 refers to areas showing lower DNA content. (B) Kinetics of percentages of cells undergoing apoptosis at different timepoints of cell incubation. Full boxes, mock-infected cells ; open boxes, cells infected with GFP-expressing rec-

Adenovirus; open circles, actinomycin D-treated cells ; full circles, BVDV p80A50- expressing rec-Adenovirus; open triangles, BVDV p80-expressing rec-Adenovirus.

Results are means + SD for duplicate samples.

Figure 6 shows the determination of subdiploid DNA content of apoptotic Vero cells by flow cytometry analysis after an incubation time of 48 h.. Vero cells were mock-infected, treated with actinomycin D (50 Mg per ml), or infected or co-infected with the indicated rec-Adenoviruses. Single cell suspensions were fixed, permeabilized, and stained with propidium iodide (PI). Pi fluorescence was detected at 660 nm (X axis). M1 refers to areas showing lower DNA content. Note the sub GO/G1 peak associated with apoptosis from cells co-infected with the p80A50-expressing rec-Adenovirus and the rec-Adenovirus expressing the tTA factor (Rec-Adenovirus-tTA + p80A50-rec-Adenovirus). The numbers within parentheses indicate the percentages of apoptotic cells.

Figure 7 shows the kinetics of the expression of PARP cleavage product by Western immunoblotting analysis. A549tTA cells were mock-infected, treated with actinomycin D (50 lig per mi), infected with GFP-or BVDV p80 or p80A50- expressing rec-Adenovirus, or co-infected with BVDV p80A50-expressing rec- Adenovirus and rec-Adenovirus expressing baculovirus p35 protein with MOIs of 500 PFU per cell. Western blot immunoblotting on cell extracts was conducted using, as primary antibody, a PARP monoclonal antibody, and, as secondary antibody, a peroxidase-conjugated goat anti-mouse immunoglobulin G (H + L chains). The membranes were developed by enhanced chemiluminescence.

Lanes 1 and 2 refer to mock-infected cells after 12 h and 60 hours of incubation, respectively; lane 3 refers to actinomycin D-treated cells after 12 and 40 hours of incubation, respectively ; lanes 5 to 10 refer to cells infected with BVDV p80- expressing rec-Adenovirus at 12,24, 30,40, 48, and 60 hours post infection, respectively; lanes 11 to 16 refer to cells infected with BVDV p80A50-expressing rec-Adenovirus at 12,24, 30,40, 48, and 60 hours post infection, respectively ; lane 17 refers to cells infected with GFP-expressing rec-Adenovirus at 40 hours

post infection; lanes 18 to 22 refer to cells co-infected with BVDV p80A50- expressing rec-Adenovirus and rec-Adenovirus expressing baculovirus p35 protein at 12,24, 30,40, and 60 hours post infection.

Figure 8 shows inhibition of BVDV p80A50-induced apoptosis by peptide inhibitors. A549tTA cells were mock-infected, or infected with Fas-expressing rec- Adenovirus (A) or BVDV p80A50-expressing rec-Adenovirus (B). Cells were treated with peptide inhibitors of apoptosis: Z-VAD-FMK (pan-caspase inhibitor), Z-IETD-FMK (caspase-8-specific inhibitor), or Z-LEDH-FMK (caspase-9-specific inhibitor). Cells were collected at 48 hours post-infection for cytometry analysis.

Results are means (percentages of apoptotic cells) SD for three independent experiments (duplicate samples for each experiment).

Figure 9 is the nucleic acid sequence of the BVDV NS3 (p80) polynucleotide and identified as SEQ ID NO. 1.

Figure 10 is the amino acid sequence of the polypeptide encoded by the BVDV NS3 (P80) polynucleotide and identified as SEQ ID NO. 2.

Figure 11 is the nucleic acid sequence of the p80A26 polynucleotide and identified as SEQ ID NO. 3.

Figure 12 is the amino acid sequence of the p80A26 polynucleotide and identified as SEQ ID NO. 4.

Figure 13 is the nucleic acid sequence of the p80A50 polynucleotide and identified as SEQ ID NO. 5.

Figure 14 is the amino acid sequence of the p80A50 polynucleotide and identified as SEQ ID NO. 6.

DETAILED DESCRIPTION OF THE INVENTION In a first embodiment, the present invention concerns the use an isolated polynucleotide encoding a polypeptide biologically equivalent to a second polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof, for inducing apoptosis in a cell. Preferably, the polynucleotide contemplated by the present invention is selected from the group consisting of: a) a polynucleotide encoding a polypeptide having at least 70% identity to a second polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof; b) a polynucleotide encoding a polypeptide having at least 80% identity to a second polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4, or 6, and fragments or analogs thereof; c) a polynucleotide encoding a polypeptide having at least 95% identity to a second polypeptide comprising an amino acid sequence chosen from SEQ fD NO 2,4 or 6, and fragments or analogs thereof; d) a polynucleotide encoding a polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof; e) a polynucleotide encoding a polypeptide having an amino acid sequence encoded by a nucleic acid sequence hybridizing under stringent conditions to the complement strand of SEQ ID NO. 1,3 or 5, and fragments or analogs thereof; and a polynucleotide comprising a nucleic acid sequence chosen from SEQ ID NO 1, 3 or 5, and fragments or analogs thereof.

Those skilled in the art will appreciate that the term"polynucleotide (s)" as mentioned above generally refers to any polyribonucleotide or poly- deoxyribonucleotide, which may be modified RNA or DNA or modified RNA or DNA. This definition includes, without limitation, single-and double-stranded DNA, DNA that is a mixture of single-and double-stranded regions or single-, double- and triple-stranded regions, single-and double-stranded RNA, and RNA that is

mixture of single-and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded, or triple- stranded regions, or a mixture of single-and double-stranded regions. In addition, "polynucleotide"as used herein refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple-helical region often is an oligonucleotide. As used herein, the term"polynucleotide (s)" also includes DNAs or RNAs as described above that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotide (s)" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein.

It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term"polynucleotide (s)" as it is employed herein thus embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including, for example, simple and complex cells which exhibits the same biological function as the polypeptide encoded by SEQ ID NOS. 1,3 or 5. Any modification made to the polynucleotide that does not affect the biological function of the polypeptide derived therefrom, the biological function being the one given by the polypeptide encoded by SEQ ID NOS. 1,3 or 5 are covered in the context of the present invention. Thus, the expression"biologically equivalent", in the characterisation of a polypeptide means that it can carry out the same biological function as the original polypeptide which is to induce apoptosis in a cell.

In a second embodiment, the present invention concerns the use of an isolated polypeptide biologically equivalent to a second polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof for inducing apoptosis in a cell. The polypeptide contemplated by the present invention is preferably selected from the group consisting of:

a) a polypeptide having at least 70% identity to a second polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof; b) a polypeptide having at least 80% identity to a second polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof; c) a polypeptide having at least 95% identity to a second polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof; d) a polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof; and e) a polypeptide having an amino acid sequence encoded by a nucleic acid hybridizing under stringent conditions to the complement strand of SEQ ID NO. 1,3 or 5, and fragments or analogs thereof.

As used herein, the term"polypeptide (s)" refers to any peptide or protein comprising two or more amino acids joined to each other by peptide bonds or modified peptide bonds."Polypeptide (s)" refers to both short chains, commonly referred to as peptides, oligopeptides and oligomers and to longer chains generally referred to as proteins. Polypeptides may contain amino acids other than the 20 gene-encoded amino acids."Polypeptide (s)" include those modified either by natural processes, such as processing and other post-translational modifications, but also by chemical modification techniques. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill in the art.

It will be appreciated that the same type of modification may be present in the same or varying degree at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications. Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side- chains, and the amino or carboxyl termini. Modifications include, for example, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or

nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation, selenoylation, sulfation and transfer-RNA mediated addition of amino acids to proteins, such as arginylation, and ubiquitination. See, for instance: PROTEINS-- <BR> <BR> STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed. , T. E. Creighton, W. H.<BR> <P>Freeman and Company, New York (1993); Wold, F. , Posttranslational Protein Modifications: Perspectives and Prospects, pgs. 1-12 in POSTTRANSLATIONAL <BR> <BR> COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed. , Academic Press, New York (1983); Seifter et al., Meth. Enzymol. 182: 626-646 (1990) ; and Rattan et al., Protein Synthesis: Posttranslational Modifications and Aging, Ann.

N. Y. Acad. Sci. 663: 48-62 (1992). Polypeptides may be branched or cyclic, with or without branching. Cyclic, branched and branched circular polypeptides may result from post-translational natural processes and may be made by entirely synthetic methods, as well.

As used herein, the term"Isolated"means altered"by the hand of man" <BR> <BR> from its natural state, i. e. , if it occurs in nature, it has been changed or removed from its original environment, or both. Thus,"isolated"may mean that the substance has been purified. For example, a polynucleotide naturally present in a living organism is neither"isolated"nor purified, the same polynucleotide separated from the coexisting materials of its natural state, obtained by cloning, amplification and/or chemical synthesis is"isolated"as the term is employed herein. Moreover, a polynucleotide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method is "isolated"even if it is still present in said organism.

The skilled person will appreciate that fragments or analogs of the polypeptides of the invention will also find use in the context of the present invention, i. e. as inducer of cell apoptosis. Thus, for instance proteins or

polypeptides which include one or more additions, deletions, substitutions or the like are encompassed by the present invention.

As used herein,"fragments","analogs"or"derivatives"of the polypeptides of the invention include those polypeptides in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably conserved) and which may be natural or unnatural. In one embodiment, derivatives and analogs of polypeptides of the invention will have about 80% identity with those sequences illustrated in the figures or fragments thereof. That is, 80% of the residues are the same. In a further embodiment, polypeptides will have greater than 80% identity. In a further embodiment, polypeptides will have greater than 85% identity. In a further embodiment, polypeptides will have greater than 90% identity. In a further embodiment, polypeptides will have greater than 95% identity. In a further embodiment, polypeptides will have greater than 99% identity. In a further embodiment, analogs of polypeptides of the invention will have fewer than about 20 amino acid residue substitutions, modifications or deletions and more preferably less than 10.

These substitutions are those having a minimal influence on the secondary structure and hydropathic nature of the polypeptide. Preferred substitutions are those known in the art as conserved, i. e. the substituted residues share physical or chemical properties such as hydrophobicity, size, charge or functional groups.

These include substitutions such as those described by Dayhoff, M. in Atlas of Protein Sequence and Structure 5,1978 and by Argos, P. in EMBO J. 8,779-785, 1989. For example, amino acids, either natural or unnatural, belonging to one of the following groups represent conservative changes: ala, pro, gly, gin, asn, ser, thr, val ; cys, ser, tyr, thr; val, ile, leu, met, ala, phe ; lys, arg, orn, his; and phe, tyr, trp, his.

As previously mentioned, preferred embodiments of the invention concern the use of a polypeptide that comprises an amino acid sequence encoded by a nucleic acid which hybridizes under stringent conditions to the complement strand of SEQ ID NO 1,3 or 5 or fragments thereof. Such a polypeptide has the ability to induce apoptosis in cells. As used herein, to hybridize under conditions of a specified stringency describes the stability of hybrids formed between two single-

stranded DNA fragments and refers to the conditions of ionic strength and temperature at which such hybrids are washed, following annealing under conditions of stringency less than or equal to that of the washing step. Typically high, medium and low stringency encompass the following conditions or equivalent conditions thereto: 1) high stringency: 0.1 x SSPE or SSC, 0.1 % SDS, 65° C 2) medium stringency: 0. 2 x SSPE or SSC, 0. 1 % SDS, 50° C 3) low stringency: 1.0 x SSPE or SSC, 0.1 % SDS, 50° C.

Amino acid or nucleotide sequence"identity"and"similarity"are determined from an optimal global alignment between the two sequences being compared. An optimal global alignment is achieved using, for example, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)."Identity" means that an amino acid or nucleotide at a particular position in a first polypeptide or polynucleotide is identical to a corresponding amino acid or nucleotide in a second polypeptide or polynucleotide that is in an optimal global alignment with the first polypeptide or polynucleotide. In contrast to identity, "similarity"encompasses amino acids that are conservative substitutions. A "conservative"substitution is any substitution that has a positive score in the blosum62 substitution matrix (Hentikoff and Hentikoff, 1992, Proc. Natl. Acad. Sci.

USA 89 : 10915-10919). By the statement"sequence A is n% similar to sequence B"is meant that n% of the positions of an optimal global alignment between sequences A and B consists of identical residues or nucleotides and conservative substitutions. By the statement"sequence A is n% identical to sequence B"is meant that n% of the positions of an optimal global alignment between sequences A and B consists of identical residues or nucleotides.

In the context of the present invention, it will be understood that the polypeptide used in accordance with the present invention is preferably a pestivirus NS3 polypeptide, and more preferably the NS3 of the Bovine Viral Diarrhea Virus (BVDV). As it will be further understood, due to recent changes in BVDV nomenclature, the terms"NS3"and"p80"are used interchangeably.

In a third embodiment, the invention is also directed to a method for

inducing apoptosis in target cells comprising the step of contacting the cells with a polypeptide biologically equivalent to a second polypeptide comprising an amino acid sequence chosen from SEQ ID NO 2,4 or 6, and fragments or analogs thereof. As can be appreciated, the polypeptide is preferably encoded by a polynucleotide as described hereinabove. As used herein, the term"contacting the cells"refers to the exposition of the cells to the polypeptide contemplated by the present invention. More specifically, it refers to the means by which the polypeptide as defined above or the polynucleotide encoding the same is introduced within the cells.

According to a preferred embodiment, the present invention provides a method for caspase-induced apoptosis. As it may be appreciated, the cells that are targetted by the method of the present invention are preferably mammalian cells and more preferably human cells. In an even more preferred embodiment, the cells are in a human or an animal subject. Thus, it will be appreciated by one skilled in the art that"in vitro","ex vivo"and"in vivo"transfection of cells is encompassed by the method of the invention.

General methods for contacting the cells with the NS3 polypeptide are of common knowledge for one skilled in the art. For instance, this can be achieved by transfecting the cells with a vector that comprises a polynucleotide as defined above. As used herein, the term"vector"refers to a polynucleotide construct designed for transduction/transfection of one or more cell types. Vectors may be, for example,"cloning vectors"which are designed for isolation, propagation and replication of inserted nucleotides,"expression vectors"which are designed for expression of a nucleotide sequence in a host cell, or a"viral vector"which is designed to result in the production of a recombinant virus or virus-like particle, or "shuttle vectors", which comprise the attributes of more than one type of vector.

A number of vectors suitable for transfection of cells are available to the public (e. g. plasmids, adenoviruses, baculoviruses, adeno-associated viruses, reoviruses, retroviruses, Herpes Simplex Viruses, Alphaviruses, Lentiviruses), as are methods for constructing such cell lines. It will be understood that the method of the present invention encompasses the use of any type of vector comprising any of the polynucleotide contemplated by the invention.

Other carriers or vehicles known to one of skill in the art may be employed for delivering within the cells the polynucleotides used in accordance with the present invention. Liquid carriers are aqueous carriers, nonaqueous carriers or both and include, but are not limited to, aqueous suspensions, saline, dimethyl sulfoxide, ethanol, oil emulsions, water in oil emulsions, water-in-oilin-water emulsions, site-specific emulsions, long-residence emulsions, stickyem u Is ions, microemulsions and nanoemulsions. Solid carriers are biological carriers, chemical carriers or both and include, but are not limited to, viral vector systems, particles, microparticles, nanoparticles, microspheres, nanospheres, minipumps, bacterial cell wall extracts and biodegradable or non-biodegradable natural or synthetic polymers that allow for sustained release of the polynucleotides.

One may also appreciate that the NS3 polypeptide itself or fragment thereof can be introduced in the cells. In such a case, the polypeptides contemplated by the present invention are preferably incorporated into a support such as polymers, lipidic vesicles, microspheres, latex beads, polystyrene beads, proteins and the like. Methods for producing the polypeptide/support complex are well known in the art and will not be described in detail herein.

The present invention will be more readily understood by referring to the following example. This example is illustrative of the wide range of applicability of the present invention and is not intended to limit its scope. Modifications and variations can be made therein without departing from the spirit and scope of the invention. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred methods and materials are described.

EXAMPLE Introduction Pestivirus bovine viral diarrhea virus (BVDV) is one of the most important pathogen in cattle. BVDV strains exist as two biotypes, cytopathogenic (cp) and noncytopathogenic (ncp), according to their effects on tissue culture cells. It has been previously reported that cell death associated to cp BVDV in vitro is

mediated by apoptosis. In this example, experiments were conducted in order to determine whether the BVDV p80 (a NS3) is a key-factor able to directly induce cell apoptosis. To do so, the p80-and p80A50 (which is the p80 deleted from the NH2-terminal 50 amino acids) -cDNA encoding sequences of BVDV NADL cp strain were cloned into AdTR5-DC-GFPq transfer vector for the generation of recombinant adenoviruses (rec-Adenovirus) from which the BVDV gene of interest could be expressed from a tetracycline-responsive promoter in a di-cistronic means coexpressing the green fluorescent protein (GFP). A549tTA cells infected in vitro with p80 or p80A50-expressing rec-Adenovirus showed cytopathogenic changes characterized by cell rounding and detachment, and nucleus chromatin condensation. DNA fragmentation assays (oligonucleosomal DNA ladder formation on agarose gel and TUNEL) performed on these infected cells clearly correlated the observed cytopathogenic changes with apoptosis. Moreover, the BVDV p80 or p80A50-induced apoptosis process correlated with the activation of cellular proteases of the ICE family (caspases), as determined by cleavage of the death substrate poly (ADP-ribose) polymerase (PARP). The results have also indicated that the BVDV p80A50 appears to be a better apoptosis inducer than the whole BVDV p80 as determined by the kinetics of PARP cleavage, quantitation of apoptotic cells over time, and by the cythopathogenic effect which appeared significantly earlier in cells infected with the BVDV p80A50-expressing rec- Adenovirus than in cells infected with the BVDV p80-expressing rec-Adenovirus.

Finally, the results presented herein show that the BVDV p80A50-associated apoptotic process was inhibited by baculovirus p35 protein. This constitutes the first exprimental proof that the p80 of BVDV is an inducer of cell apoptosis. The results also identified the BVDV p80A50 as a potent and powerful inducer of apoptosis.

Materials And Methods Cells and viruses The cells used in this study were free of mycoplasmas, and fetal bovine serum was exempt of BVDV antigen and BVDV-specific antibodies. BVDV-free

MDBK cells (a gift from Susy Carman, Animal Diagnostic Laboratory, Guelph, Ontario) were maintained in Dulbecco minimal essential medium (DMEM) with high glucose concentration supplemented with 2 mM L-glutamine, 0.2% (w/v) lactalbumin HCI, 10% fetal bovine serum (FBS) (Gibco/BRL, Gaithersburg, MD) and antibiotics. For cell infection, confluent 2-day old cultures were inoculated with type 1 cp NADL reference strain of BVDV (ATCC # VR-534) and were further incubated with 2% FBS in DMEM until 50 to 70% of the cells exhibited a cytopathic effect. After one cycle of cell freezing and thawing, the cell culture supernatant was collected by centrifugation. The viral titers were determined and calculated as the median tissue culture infective dose (TCID50) per ml (St-Laurent et a/., 1994).

BMAdE1 220-8,293A, and 293rtTA (Jani et al., 1997; Massie et al., 1998a, b) were propagated in antibiotic-free DMEM supplemented with 10% tetracycline- free FBS (Clontech Laboratories Inc., Palo Alto, CA). 293rtTA cells were used to generate recombinant adenoviruses (rec-Adenovirus) expressing the protein of interest and to titrate the adenovirus stocks by measuring green fluorescent protein (GFP) signal by cytofluorometry, whereas BMAdE1 220-8 or 293A cells were used for virus amplification to generate adenovirus stocks (Jani et al., 1997).

A549 cells (derived from human lung carcinoma tissues) which were genetically transformed to express the tetracycline transactivation factor (tTA) (A549tTA) (Massie et aL, 1998a, b) were used in the cell apoptosis experiments conducted with the rec-Adenoviruses. Monkey kidney (Vero), canine fetal thymus (Cf2Th) and bovine kidney (MDBK) continuous cell lines were also tested to determine whether the pestiviral NS3 also induces apoptosis in these cells.

Viral RNA isolation and oligonucleotide primers Viral genomic RNA was extracted using the guanidium isothiocyanate method from the supernatant of infected MDBK cells as described (Abed et a/., 1999). The oligonucleotide primers for reverse transcription-PCR (RT-PCR) amplification of nucleic acid sequences that encode BVDV p80 protein (nucleotides 5423 to 7471 of the viral genome; amino acids 1 to 683 of the p80) and truncated forms of p80 e. g. the p80A26 protein (nucleotides 5501 to 7471 of the viral genome, amino acids 27 to 683 of the p80) and the p80A50 protein

(nucleotides 5573 to 7471 of the viral genome; amino acids 51 to 683 of the p80) were selected according to the BVDV NADL strain genomic sequence (Genbank Database accession number M31182), and to the predicted NH2-and COOH- termini of the protein (Xu et al., 1997). Primers (listed in Table 1) contained short 5' extensions in which restriction endonuclease cleavage sites, initation or termination codons and/or histidine codons were present for cloning/subcloning and expression purposes.

Reverse transcription-PCR amplification, cloninc, and sequencinq The BVDV genomic RNA was converted to complementary DNA (cDNA) by reverse transcription using random hexadeoxyribonucleotides (pd (N) 6; Pharmacia Biotech Inc., Uppsala, Sweden) as previously described (St-Laurent et al., 1994).

The cDNA was then amplified by using the appropriate primer pair with a programmable thermal cycler by 35 successive cycles of denaturation at 95 °C for 1.30 min, primer annealing at 48 °C for 1.30 min, and DNA chain extension at 72 °C for 2.30 min. The amplified cDNA products were subsequently cloned into the pbluescript/KS+ (pBS) vector according to the manufacturer's instructions (Stratagene, La Jolla, CA) to generate the plasmid constructs pBS/pEt (p80), pBS/pEt (p80A26), pBS/pEt (p80A50), pBS/Ad (p80), and pBS/Ad (p80A50) (Table 1). All constructs were sequenced by the chain termination method of Sanger et a/.

(1977) to confirm the BVDV-specific nature of the amplified product.

Expression of BVDV p80 in Escherichia coli (E. coli) and production of BVDV p80- specific antiserum The cDNA sequences encoding BVDV p80, p80A26, and p80A50 were excised from the pBS/pEt (p80), pBS/pEt (p80A26), and pBS/pEt (p80A50) plasmid constructs with the appropriate restriction enzymes, purified by using a low-melting-temperature agarose gel, and ligated into the procaryotic expression vector pEt-21b (Novagen, Madison, Wl). This procedure allowed the BVDV p80-, p80A26, or p80A50-encoding sequences to be in frame with a six histidine-tag at the NH2-terminal, generating pEt-21b-p80, pEt-21b-p80A26, and pEt-21b-p80A50

which then could putatively express recombinant rHis-p80, rHis-p80A26, or rHis- p80A50 fusion proteins. The recombinant plasmids were sequenced as above to confirm that the junction sequence was in the correct reading frame.

Protein expression in E. coli strain DH5a was performed as previously described (St-Laurent and Archambault, 2000). The resulting soluble (bacterial crude extracts) and insoluble (inclusion bodies) fractions were analysed by 12 % sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Kheyar et al., 1997). Recombinant fusion proteins that were mostly present in the insoluble fraction (inclusion bodies) were purified by electroelution (Microeluter, BioRad, Hercules, CA) of the proteins that were cut out of a 8% SDS-PAGE (Kheyar et al., 1997). The purity and concentration of the purified recombinant proteins were assessed by Coomassie-blue stained-SDS-PAGE. BVDV p80- specific polyclonal antibodies were raised by immunizing a New Zealand white rabbit with rHis-p80a50 fusion protein, according to a standard protocol (Harlow and Lane, 1988). Antiserum was then tested by Western immunoblotting to confirm the presence of specific antibodies to the immunizing protein and, as an additional control, to the p80 expressed in infected cells protein (Kheyar et al., 1997). This antiserum was used in further experiments (see above) to assess BVDV p80 or p80A50 expression in mammalian cells.

Construction of recombínant adenoviruses (rec-Adenovirus) and cell infiection The procedures used were carried out essentially as described (Jani et a/., 1997). To construct the rec-Adenoviruses, the cDNA p80 and p80A50-encoding sequences were excised from plasmids pBS/Ad (p80), and pBS/Ad (p80A50), respectively, with restriction enzyme Pmel (blunt ends), purified, and cloned in the adenovirus transfer vector AdTR5-DC-GFPq digested with EcoRV (blunt ends).

This transfer vector enables the gene of interest to be expressed from a tetracycline-inducible promoter in a di-cistronic means coexpressing the green fluorescent protein (GFP) and the BVDV protein of interest. Thereafter, 293A cells were co-transfected with Fsel-restricted transfer vector, and the Clal-restricted Ad5/aE1AE3 viral DNA to generate recombinant viruses by in vivo homologous

recombination between overlapping sequences of linearized transfer vectors pADTR5f-DC-GFPq, and Ad5/hE1åE2 genomic DNA (Massie et al., 1998a, b).

Recombinant adenovirus-containing plaques were screened 10 to 15 days after cell transfection by monitoring basal GFP expression by fluorescence microscopy.

Recombinant adenoviruses were then purified by three further rounds of plaque isolation, and expanded in 293 cells as described. (Jani et al., 1997; Massie et al., 1998b). Titers of the recombinant adenovirus stocks were determined by a method based on the measurement of the GFP signal by cytofluorometry (Massie et a/., 1998a). By this means, rec-Adenovirus stocks with transformed viral titers ranging from 3.2 x 101° to 2.2 x 1011 plaque forming units (PFU) per ml were obtained.

In order to determine the apoptotic capability of BVDV p80 or p80A50, one- day old (sub-confluent) old A549tTA cells were infected with each of the rec- Adenovirus expressing the respective BVDV protein at multiplicity of infection (MOI) value of 500 PFU/cell (as determined in preliminary experiments where a range of virus titers of 125 to 1,000 PFU/cell was tested). A recombinant adenovirus only expressing GFP (rec-Adenovirus-GFP) with the same genetic background as the rec-Adenoviruses expressing the BVDV proteins was used as a negative control, whereas cells treated with actinomycin D (50 lig/ml) was used as a positive control of apoptosis (Archambault and St-Laurent, 2000). Briefly, cells wee seeded at densities of 3 X 106 cells per 75 cm2 flask (for cell DNA fragmentation assay on agarose gel, p80 and p80A50 expression by Western blot, and PARP cleavage detection), 2 X 105 cells per well in six-well plates (for flow cytometry analyses), and 3 X 104 cell per well in eight-well Labtek-chambers (Nalge Nunc International, Naperville, IL) (for TUNEL DNA fragmentation assay and fluoresence microscopy analyses) in DMEM supplemented with 10% FBS.

Cells were then washed with PBSS, pH 7.3, mock-infected, treated with actinomycin D, or inoculated with each of the recombinant virus to 12 moi (75 cm2 flasks), 2 ml (each well of six-well plates) or 300 ut (each well of eight-well Labtek chamber wells) of DMEM with 5% FBS for 4 h at 37 °C under slow agitation using a rocker platform. Cells were further incubated without agitation and analysed for cell apoptosis indicators (see below) or BVDV gene expression at different period

times pi.

Expression of BVDV p80 and p80zJ50 in mammalian cells bl/Western immunoblottina and fluorescence microscopy For the Western immunoblotting procedure, cells were washed in phosphate-buffered saline solution (PBSS), pH 7.3, and lysed in standard SDS- PAGE sample buffer. Proteins were fractionated by 15% SDS-PAGE and electrotransferred onto nitrocellulose membranes. Immunoblotting was performed by using, as the blocking reagent solution, 5% nonfat dried milk solids and 0.05% Tween 20 in PBSS. The blot was then incubated with rabbit preimmune and anti- BVDV p80A50 antiserum (used at a dilution of 1: 500) for 2 h at room temperature.

The membranes were then washed three times in PBSS before adding a peroxidase-conjugated goat anti-rabbit immunoglobulin G (whole molecule) for 1 h at room temperature. The immunological activity was revealed after adding the peroxidase substrate (PBSS, ph 7.3, H202, methanol and 4-chloro-naphthol) for 20 min (Abed et al., 1999).

For fluorescence microscopy, cells were examined with a confocal fluorescence microscope (Model MRC-1024, Biorad). Briefly, cells grown on glass coverslips (eight-well Labtek chamber) were fixed in 4% paraformaldehyde in PBSS, pH 7.3, for 1 h at room temperature and permeabilised with 0.1% Triton X- 100 in 0. 1% sodium citrate for 10 min. Cells were then exposed to rabbit anti- BVDV p80A50 antiserum (1: 100,1 h at 37 °C in a humidified chamber) in PBSS containing 3% (w/v) bovine serum albumin. Cells were washed three times in PBSS before adding for 1 h a Cy3-conjugated goat anti-rabbit immunoglobulin G (whole molecule) (Sigma Chemical Company, St-Louis, MO) used at a 1: 500 dilution. Cy3-conjugated antibody was excited with a Green HeNe 543 nm laser beam, and fluorescence emission was collected at 575 nm. GFP was excited with an argon laser at 488 nm, and fluorescence emission was collected at 515 nm.

Sequential collection was performed for each sample to avoid overlapping fluorescence.

DNA fragmentation The fragmentation of cellular DNA was analysed by visualizing oligonucleosomal-sized DNA fragments (DNA ladder formation) essentially as described (Archambault and St-Laurent, 2000). In situ DNA fragmentation from cells that were grown in coverslips (8-well Labtek chamber) was assessed using a colorimetric Tdt-mediated dUTP nick end labeling (TUNEL) commercial kit (In situ Cell Death Detection, POD; Roche Diagnostics, Mannheim, Germany), according to the supplier's instructions.

Detection of poly (ADP-ribose) polymerase PARPJ cleavage Adherent cells collected at various timepoints following treatment (actinomycin D or infection with each rec-Adenovirus) were washed with PBSS, pooled with detached cells, fysed in standard SDS-PAGE sample buffer containing 6 M urea, and sonicated for 15 sec on ice. Cell proteins were fractionated by 8% SDS-PAGE and electrotransferred onto nitrocellulose membranes. Immunoblotting was performed as above by using, as primary antibody, a PARP monoclonal antibody (C-2-10 ; BioVision Inc., Mountain View, CA), and, as secondary antibody, a peroxidase-conjugated goat anti-mouse immunoglobulin G (H + L chains). The membranes were developed by enhanced chemiluminescence (ECL; PerkinElmer, Boston, MA).

Cyfiometry analVsis Single cell suspensions (including adherent and nonadherent cells) were prepared at various timepoints following rec-Adenovirus infection by trypsinization, centrifugated and resuspended in 200 p.) of a solution containing 25 llg/ml propidium iodide (PI), 0.06% saponin, 2.5 U/ml RNAse A, and 20 uM (EDTA) for 20 min before cytometry analysis using a fluorescence-activated cell sorter (FACScan, Becton Dickinson, Mississauga, Ontario). Cell debris were excluded from the analyses by the conventional scatter gating method. The cells or the nuclei doublets were also excluded in analyses by using the pulse processor boards. Ten thousand events per sample were analysed by using the Cell Quest software system (Becton Dickinson).

Results Expression of B VD V p 80 in E coli BVDV sequence encoding futt-tength p80 protein was successfully inserted into the pEt-21b where the tac promoter could be adequately controlled by isopropyl-p-D-thiogalacto-pyranoside (IPTG). When bacterial cells were induced with IPTG for 3 hours, no p80 expression was detected from a SDS- polyacrylamide gel stained with Coomassie brilliant blue (Fig. 1, lane 3). IPTG induction of bacterial cells for longer time periods and/or using different temperatures and conditions of expression did not result in significant BVDV p80 expression (data not shown). These latter results prompted us to generate truncated forms of the BVDV p80 in which the NH2-terminal 26 or 50 amino acids of BVDV p80 were deleted. As shown in Fig. 1, this strategy allowed to produce BVDV p80A26 (lane 5) and BVDV p80A50 (lane 7) fusion proteins, respectively, in E. coli strain DH5a after 3 hours of IPTG induction. More intense protein bands were obtained when the bacterial cells were incubated for a longer incubation time period of 6 to 12 hours (data not shown). However, the best protein expression levels were consistenly obtained with the plasmid construct containing the BVDV p80A50-encoding sequence. The expressed BVDV p80A50 fusion protein which was found mostly in cytoplasmic inclusion bodies, was electroeluted from a polyacrylamide gel to obtain relatively purified fusion protein preparation (Fig. 1, lane 8). The purified fusion protein was then used to immunize a laboratory rabbit, and the antiserum obtained was confirmed to contain protein-specific antibodies by using a Western blot assay (not shown). Thus, this BVDV p80A50-specific antiserum was used in subsequent experiments to monitor p80 or p80A50 expression in mammalian cells.

Cytopathoaenicity correlates with BVDV p80 and p80Z150 expressed from rec- Adenovirus Following infection of A549tTA cells with each of the BVDV protein- expressing rec-Adenovirus and the control rec-Adenovirus-GFP, GFP signal was

gererally observed under fluorescence microscopy from 6 hours post infection (pi) to reach maximum GFP fluorescence signal in infected cells (approximately 40 to 50% of cells) at 12 to 18 hours pi (data not shown). Along with the expression of GFP signal, the cells infected with each rec-Adenovirus carrying the BVDV sequences showed the first evidence of morphological changes (cell rounding and shrinking in size and cell detachment in cell culture supernatant) at 18 (for the p80 truncated form) to 24 hours (for the whole p80) pi to reach maximal cythopathogenic effect (CPE) (e. g. morphological changes occurring in 30 to 40% of infected cells) with cell detachment from the substrate at 36 to 40 hours (for the p80 truncated form), or 48 to 60 hours (for the whole p80) pi. Microscopic observations at 40 (p80A50) or 48 (p80) hours pi showed that most of the shrinking cells carried the characteristic apoptosis nucleus chromatin condensation with reduction in cell volume (Fig. 2B and 2C for the BVDV p80-and p80A50-expressing rec-Adenovirus, respectively). No significant CPE was observed in mock-infected cells (not shown) and in cells infected with the rec- Adenovirus-GFP used as negative control (Fig. 2A) throughout the incubation period. In contrast, CPE was readily observed in cells treated with actinomycin D or the recombinant Ad5TR5AR1 (Massie et al., 1998b) which were used as positive controls of apoptosis (data not shown).

Along with the appearance of CPE, the inventor analysed whether the infected cells were indeed expressing the relevant BVDV proteins. As shown in Fig. 3A, both BVDV p80 and p80A50 proteins, as determined by Western immunoblotting, were expressed from cells infected for 48 or 40 hours with each of the respective rec-Adenovirus (lanes 4 and 5, respectively). No immune activity was obtained with the rabbit pre-immune serum (not shown). Expression of BVDV p80A50 protein, as determined by confocal fluorescence microscopy at 40 hours pi, was observed in cells which concomitantly expressed GFP (Fig. 3B, panel d), demonstrating herein the effectiveness of the di-cistronic adenovirus expression system used in this study. Interestingly, the GFP appeared to be localized mostly in the nucleus of the infected cell (Fig. 3B, panel d). On the basis ot the results, it was concluded that expression of BVDV p80 or p80A50 from each rec-Adenovirus

correlated with CPE in infected cells.

BVDV p80 and p80d50-expressinq rec-Adenovirus infections correlate with cell DNA fragmentation As the oligonucleosomal DNA ladder of multiples of 180-200 base pairs in apoptotic cells is considered a hallmark of the programmed cell death process, DNA fragmentation assays were carried out from rec-Adenovirus-infected A549tTA cells. Fig. 4 shows typical DNA fragmentation in cells infected with each of the rec-Adenovirus expressing either BVDV p80 or p80A50 (lanes 4 and 5, respectively). DNA fragmentation was observed in cells treated with actinomycin D (lane 3) or in MDBK cells infected with the NADL strain of BVDV (lane 7) which was used as an additional positive control of apoptosis. In contrast, no DNA fragmentation was observed in the mock-infected and rec-Adenovirus-GFP- infected negative control cell cultures (lanes 1 and 2, respectively). To confirm, by an independent means, the cell DNA fragmentation, a colorimetric TUNEL assay was performed to detect in situ DNA fragmentation. Labelling of cell nuclei typical of DNA fragmentation was readily detected in cells infected with rec-Adenovirus expressing either BVDV p80 (48 hours pi) or p80A50 (40 hours pi) (Fig. 2B and C, respectively). In contrast, no DNA labeling was detected in cells infected with the rec-Adenovirus-GFP negative control (Fig. 2A), nor in mock-infected cells (data not shown). Since similar results were obtained with BVDV p80 and p80A50, further experiments were mostly conducted with the BVDV p80A50-expressing rec-Adenovirus.

Flow cytomelty quanfitation of apoptotic cells over time Morphologic changes and DNA fragmentation assays are not indicative of the number of cells undergoing apoptosis. By using flow cytometry analysis, the proportion of apoptotic cells with DNA content that would decrease after sufficient endonucleolytic activity was determined, and lead to the cell DNA fragmentation described above. By gating the cells that were GFP positive (and that were also expressing the BVDV protein of interest), and by measuring the DNA content

below the diploid (Go/G1) level, cells were detected in a cluster peak associated with apoptosis from cells infected for 40 hours with the p80A50-expressing rec- Adenovirus, or treated with actinomycin D (used as an apoptosis control system) (Fig. 5A). In contrast, no sub GO/G1 peak was observed in cells mock-infected or infected with rec-Adenovirus-GFP, thereby indicating the absence of apoptotic process in these cells (Fig. 5A). By conducting cytometry analyses at different time points pi, an increase over time of the percentages of cells undergoing apoptosis, beginning at 18 hours pi (which correlated with the first evidence of morphologic changes in cell cultures), was obtained in the cell cultures infected with rec- Adenovirus expressing BVDV p80A50, or in actinomycin D-treated cell cultures (Fig. 5B). An increase over time of the percentages of apoptotic cells (albeit to a lesser degree than that obtained from cells infected with the rec-Adenovirus expressing BVDV p80A50) was also observed in cells infected with rec-Adenovirus expressing the BVDV 80. In contrast, no significant changes in the percentages of basal apoptotic cells over time was observed in mock-infected cells or in cells infected with the rec-Adenovirus-GFP.

The BVDV p80j50 induces apoptos/s in other ceAl types Then, it was analysed whether the BVDV p80A50 could induce apoptosis in other cell lines. To do this, Vero, Cf2Th, and MDBK cells were plated (for a time period of 3 hours to allow cell adherence) in each well (1.5 x 105 cells per well) of 24-well plates. Because these cells were not engineered to express the tTA factor, they were first infected with a recombinant adenovirus expressing the tTA factor (MOI of 300). After an incubation period of 3 hours, the BVDV p80A50-expressing rec-Adenovirus was added to the cell cultures as above. As shown in Fig. 6, apoptosis was clearly demonstrated in Vero cells co-infected with both of these rec-Adenoviruses, as determined by cytometry analysis. As expected, apoptosis was also detected in cells treated with actinomycin D (positive control). In contrast, no significant sub GO/G1 peak was observed in cells infected with either rec- Adenovirus (expressing the p80A50 or the tTA factor alone), nor in additional negative controls (e. g. mock-infected cells, cells infected with the GFP-expressing

rec-Adenovirus, and cells co-infected with the GFP-expressing rec-Adenovirus and the rec-Adenovirus expressing the tTA factor). Similar results of BVDV p80A50- induced apoptosis were obtained in Cf2Th or MDBK indicator cells.

Cleavage of the death substrate, PARP Chromosome DNA fragmentation requires the activation of cysteine proteases of the interleukin-lp-converting enzyme (ICE), termed the caspases. In response to apoptotic stimuli, the caspases (the so-called executioners of cell death in apoptosis) (Cohen, 1997), are involved in a proteolytic cascade that serves to transmit and amplify the death signals (Cohen, 1997; Cryns and Yuan, 1998). Caspase activation leads to the cleavage of various death substrates, including the 116 kDa PARP (Cohen, 1997; Hoff and Donis, 1997; Cryns and Yuan, 1998). As it was reported that cp BVDV-infected cells undergoing apoptosis express, late in infection, the 85 kDA cleaved-product of PARP (Hoff and Donis, 1997), the inventor wished to determine whether the rec-Adenovirus-infected cells expressing BVDV p80A50 would also express the cleaved form of PARP. The kinetics of the expression of PARP cleavage product, as determined by Western immunoblotting, was then conducted from cells infected with BVDV p80A50- expressing rec-Adenovirus. As shown in Fig. 7, evidence of PARP cleavage was observed from 24 hours pi at the time where CPE was readily apparent, and continued to 60 hours pi (lanes 12 to 16). For the BVDV p80-expressing rec- Adenovirus infected cells, PARP cleavage was only detected 60 hours pi (lane 10). Finally, PARP cleavage was observed in cells treated with actinomycin D (lane 4). The results clearly indicate that BVDV p80 and p80A50-induced apoptosis is mediated through a caspase activation pathway.

BVDV p80g50-induced apoptosis ís inhibíted by baculovirus P35 The p35 protein of baculovirus has been shown to block apoptosis in insect and mammalian cells by functioning as an inhibitor of caspases (Miller et al., 1998). Therefore, the inventor wished to determine whether this was also the case for BVDV p80A50-induced apoptosis using a rec-Adenovirus expressing

baculovirus p35 (rec-Adenovirus-baculovirus-p35). To do this, cells were infected as above with both BVDV p80A50 and p35-expressing rec-Adenovirus (with has the same adenovirus genetic background as the other rec-Adenoviruses used in this example) at MOIs of 500 each, and then checked for CPE and cleavage of PARP. Cytotoxicity developed in cells infected with BVDV p80A50-expressing rec- Adenovirus, while cells co-infected with both BVDV p80A50-expressing rec- Adenovirus and baculovirus p35-expressing rec-Adenovirus had no significant apoptotic-related CPE up to 60 hours pi. (not shown). Concomitantly, cleavage of PARP was detected in cells infected with BVDV p80A50-expressing rec- Adenovirus (as shown above), whereas no PARP cleavage product was observed from cells co-infected with the rec-Adenoviruses at any timepoint pi (Fig. 7, lanes 18 to 22). Finally, as a control for adenovirus background, cells were co-infected with BVDV p80A50-expressing rec-Adenovirus and GFP-expressing rec- Adenovirus, and showed CPE typical of apoptosis and PARP cleavage product (not shown) similar to what was observed in cells infected BVDV p80A50- expressing rec-Adenovirus alone (not shown).

BVDV p8Od50-induced apotosis is inhibited peptide inhibitors To delineate further which apoptotic pathway of the BVDV p80A50 is associated to BVDV p80A50-induced apoptosis, experiments were conducted using peptide inhibitors. To do this, A549tTA cells were plated into each well of a 24-well plates. The adhered cells (two hours of adsorption) were treated with caspase substrates (50, uM) Z-VAD-FMK (pan-caspase inhibitor), Z-IETD-FMK (caspase-8-specific inhibitor), or Z-LEDH-FMK (caspase-9-specific inhibitor), and, two hours later, infected with the BVDV p80A50-expressing rec-Adenovirus. The cells were then replenished with the caspase inhibitors 24 hours later, and collected 48 hours after infection with the rec-Adenovirus for cytometry analysis.

As shown in Fig. 8B, approximately 74%, 51.6%, and 35.5% of inhibition of apoptosis were obtained in BVDV p80A50-expressing rec-Adenovirus-infected cells treated with the pan-caspase (Z-VAD-FMK), caspase-8-specific (Z-IETD- FMK), or Z-LEDH-FMK (caspase-9-specific inhibitor) inhibitors. As a control, 71 %,

38% and 9% of inhibition of apoptosis were obtained with the pan-caspase, caspase-8-specific and caspase-9-specific inhibitors from cells infected with a rec- Adenovirus expressing Fas, a molecule known to induce apoptosis through the caspase-8 activation pathway. Thus, the results obtained here indicate that the BVDV p80A50 induces apoptosis that apparently involves caspase-8, and caspase-9 (although its inhibtion was less pronounced than that obtained for caspase 8) activation pathways.

REFERENCES <BR> <BR> Abed, Y. , St-Laurent, G. , Zhang, H., Jacobs, R. M. , and Archambault, D. (1999).

Development of a Western blot assay for detection of bovine immunodeficiency- like virus using capsid and transmembrane envelope proteins expressed from recombinant baculovirus. Clin. Diagn. Lab. Immunol. 6,68-172.

Archambault, D. , and St-Laurent, G. (2000). Induction of apoptosis by equine arteritis virus infection. Virus Genes 20,143-147.

Archambault, D. , Baliveau, C. , Couture, Y. , and Carman, S. (2000). Clinical response and immunomodulation following experimental challenge of calves with type 2 noncytopathogenic bovine viral diarrhea virus. Vet. Res. 31,215-227.

Bruscke C. J. M., Hulst M. M. , Moormann R. J. M. , van Rijn, P. A. , and van Oirschot, J. T. 1997. Glycoprotein Erns of pestiviruses induces apoptosis in lymphocytes of several species. J. Virol. 71: 6692-6696.

Cohen, J. M. (1997). Caspases: the executioners of apoptosis. Biochem. J. 326, 1-16.

Cryns, V. , and Yuan, J. (1998). Proteases to die for. Genes Dev. 12,1551-1570.<BR> <P>Duvall, E. , and Wyllie, A. H. (1986). Death and the cell. Immunol. Today 7,115-

119. <BR> <BR> <P>Gorczyca, W. , Gong, J., Ardelt, B. , Traganos, F. , and Darzynkiewicz, Z. (1993).

The cell cycle related differences in susceptibility of HL-60 cells to apoptosis induced by vaious antitumor agents. Cancer Res. 53,3186-3192.

Hammers, C. , Dehan, P. , Couvreur, B., Letellier, C. , Kerkhofs, P. , and Pastoret,<BR> P. -P. (2001). Diversity among bovine pestiviruses. Vet. J. 161,112-122.<BR> <P>Hanon, E., Hoornaert, S. , Dequiedt, F., Vanderplasschen, A. , Lyaku, J., Willems,<BR> L. , and Pastoret, P. -P. (1997). Bovine herpesvirus 1-induced apoptosis occures at the GO/G1 phase of the cell cycle. Virology 232,351-358.

Harlow, E, and Lane, D. (1988). Antibodies, a laboratory manual. New York: Cold Spring Harbor Laboratory Press.

Hoff, H. S. , and Donis, R. O. (1997). Induction of apoptosis and cleavage of poly (ADP-ribose) polymerase by cytopathic bovine viral diarrhea virus infection.

Virus Res. 49,101-113. <BR> <BR> <P>Jani, A., Lochmuller, H. , Acsadi, G. , Simoneau, M. , Huard, J., Garnier, A. , Karpati,<BR> G. , and Massie, B. (1997). Generation, validation, and large scale production of adenoviral recombinants with large size inserts such as 6.3 kb human distrophin cDNA. J. Virol. Methods 64,111-124. <BR> <BR> <P>Kheyar, A, Martin, S. , St-Laurent, G. , Timoney, P. J., McCollum, W. H., and Archambault, D. (1997). Expression cloning and humoral immune response to the nucleocapsid and membrane proteins of equine arteritis virus. Clin. Diagn. Lab.

Immunol. 4,648-652. <BR> <BR> <P>Kummerer, B. M. , Tautz, N. , Becher, P., Thiel, H. -J. , and Meyers, G. (2000). The genetic basis for cytopathogenicity of pestiviruses. Vet. Microbiol. 77,117-128.

Massie, B. , Mosser, D. D. , Koutrowmanis, M., Viné-Mony, I., Lamoureux, L.,<BR> Couture, F., Paquet, L., Guilbault, C. , Dionne, J., Chahla, D. , Jolicoeur, P. , and Langelier, Y. (1998a). New adenovirus vectors for protein production and gene transfer. Cytotechnology 28,53-64.

Massie, B. , Couture, F. , Lamoureux, L. , Mosser, D. D., Guilbault, C. , Jolicoeur, P. ,<BR> Befanger, F. , and Langelier, Y. (1998b). Inducible overexpression of a toxic protein by an adenovirus vector with a tetracycline-regulatable expression cassette. J.

Virol. 72, 2289-2298. <BR> <BR> <P>Meyers, G. , and Thiel, H. -J. (1996). Molecular characterization of pestiviruses.

Adv. Virus Res. 47,53-118. <BR> <BR> <P>Miller, L. K. , Kaiser, W. J. , and Seshagiri, S. (1998). Baculovirus regulation of apoptosis. Sem. Virol. 8,445-452.

Moennig, V. , and Plagemann, P. G. (1992). The pestiviruses. Adv. Virus Res. 41, 53-98. <BR> <BR> <P>Nuttall, P. A., Stott, E. J. , and Thomas, L. H. (1980). Experimental infection of calves with two strains of bovine virus diarrhoea virus: virus recovery and clinical reactions. Res. Vet. Sci. 28,91-95.

O'Brien, V. (1998). Viruses and apoptosis. J. Gen. Virol. 79,1833-1845.

Pellerin, C. , Van der Hurk, J. , Lecomte, J. , and Tijssen, P. (1994). Identification of a new group of bovine diarrhea virus strains associated with severe outbreaks and high mortalities. Virology 203,265-268.

Rice, C. M. (1996). Flaviviridae : the viruses and their replication. In : Fields <BR> <BR> Virology, Fields, B. N. , Knipe, D. M. , and Hewley, P. M. , eds, 3rd Edition,

Lippincott-Raven Publishers, pp. 931-939.

Ridpath, J. F., Bolin, S. R. , and Dubovi, E. J. (1994). Segregation of bovine viral diarrhea virus into genotypes. Virology 205,66-74.

Sanger, F., Nicken, S. , and Coulson, A. R. (1977). DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci (USA) 74,5473-5467.

Schulze-Osthoff, K. , Ferrari, D. , Los M., Wesselberg, S. , and Peter, M. E. (1998).

Apoptosis signaling by death receptors. Eur. J. Biochem. 254,439-459.

Schweizer, M. , and Peterhans, E. 1999. Oxydative stress in cells infected with bovine viral diarrhoea virus: a crucial step in the induction of apoptosis. J. Gen.

Virol. 80, 1147-1155.

St-Laurent, G. , Morin, G. , and Archambault, D. (1994). Detection of equine arteritis virus following amplification of structural and nontructural viral genes by reverse transcription-PCR. J. Clin. Microbiol. 32,658-665.

St-Laurent, G, and Archambault, D. (2000). Molecular cloning, phylogenetic analysis and expression of beluga whale (Delphinapterus leucas) interleukin 6.

Vet. Immunol. Immunopathol. 73,31-44.

Tamura, J. K. , Warrener, P. , and Collett, M. S. (1993). RNA-stimulated NTPase activity associated with the p80 protein of the pestivirus bovine viral diarrhea virus.

Virology 193,1-10.

Teodoro, J. G. , and Branton, P. E. (1997). Regulation of apoptosis by viral gene products. J. Virol. 71, 1739-1746.

Tereda, N. , Lucas, J. J. , and Gelfand, E. W. (1991). Differential regulation of the tumor suppressor molecules, retinoblastoma susceptibility gene product (Rb) and

p53, during cell cycle progression of normal human T cells. J. Immunol. 147,698- 704. <BR> <BR> <P>Thiel, H. -J., Plagemann, P. G. W. , and Moennig, V. (1996). Pestiviruses. In : Fields<BR> Virology, Fields, B. N. , Knipe, D. M. , and Hewley, P. M., eds, 3rd Edition, Lippincott-Raven Publishers, pp. 1059-1073.

Warrener, P, and Collet, M. S. (1995). Pestivirus NS3 (p80) protein possesses RNA helicase activity. J. Virol. 69,1720-1726.

Wiskerchen, M. , and Collet, M. S. (1991). Pestivirus gene expression: protein p80 of bovine viral diarrhea virus is a proteinase involved in polyprotein processing. Virology 184,341-350.

Zhang, G., Aldridge, S. , Clarke, M. C. , and McCauley, J. W. (1996). Cell death induced by cytopathic bovine viral diarrhoea virus is mediated by apoptosis. J.

Gen. Virol. 77, 1677-1681.

Xu, J. , Mendez, E. , Caron, P. R. , Lin, C. , Murcko, M. A., Collet, M. S. , and Rice, C. M. (1997). Bovine viral diarrhea virus NS3 serine proteinase: polyprotein cleavage sites, cofactor requirements, and molecular model of an enzyme essential for pestivirus replication. J. Virol. 71,5312-5322.

Table 1 Oligonucleotide primers used to generate recombinant plasmids containing BVDV p80-and p80A50-encoding nucleic acid sequences Recombinant Nucleotide sequences (5'-->3') Sense SEQ ID plasmide pBS/pEt (p80) CAAACATAIGGGGCCTGCCGTGTGTAAGAAG + 7 CAAA CTCGAGCAACCCGGTCACTTGCTTCA-8 pBS/pEt (p80A50) CAAACATATGGGTCTGGAGACTGCCTGGGCTTA + 9 CAAACTCGAGCAACCCGGTCACTTGCTTCA-10 pBS/pEt (p80A26) CAAA CATATGGGGATCATGCCAAGGGGGACTAC + 11 CAAACTCGAGCAACCCGGTCACTTGCTTCA-12 pBS/Ad (p80) CAAAGTTTAAACGATCCACCATGGGA CAT CA C CAT + 13 CAC CAT CAC GGGCCTGCCGTGTGTAAGAAG CAAAGTTTAAAC-14 TCACAACCCGGTCACTTGCTTCAGT pBS/Ad (p80A50) CAAAGTTTAAACGATCCACCATGGGA CAT CAC CAT + 15 CAC CAT CAC GGTCTGGAGACTGCCTGGGCTTA CAAAGTTTAAAC-16 TCACAACCCGGTCACTTGCTTCAGT The underlined nucleotides refer to restriction endonuclease cleavage sites: GTTTAAAC : Pmel ; CTCGAG: Xhol ; CATATG: Ndel. The initiation (ATG), termination (TCA) and histidine codons (CATand CAC) are also shown.